Immunogenic compositions containing conjugated capsular sugar antigens and their uses

Abstract

This invention relates to novel immunogenic compositions comprising conjugated Streptococcus pneumoniae capsular glycoantigens (glycoconjugates) and their uses. The immunogenic compositions of this invention will generally comprise at least one glycoconjugate derived from a Streptococcus pneumoniae serotype not found in Prevnar, Synflorix, and / or Prevnar 13. This invention also relates to the use of said novel immunogenic compositions for the vaccination of human subjects, particularly infants and the elderly, against pneumococcal infection.

Description

[0001] This application is a divisional application of Chinese Patent Application No. 201580015008.8, filed on January 15, 2015, entitled "Immunogenic Composition Containing Conjugated Capsular Sugar Antigen and Its Use Thereof". Invention Field

[0002] This invention relates to novel immunogenic compositions comprising conjugated capsular sugar antigens (glycoconjugates) and their uses. The immunogenic compositions of this invention will generally comprise glycoconjugates, wherein the sugars are derived from serotypes of Streptococcus pneumoniae. This invention also relates to the use of said novel immunogenic compositions for the vaccination of human subjects, particularly infants and the elderly, against pneumococcal infection. Background of the Invention

[0003] Infections caused by pneumococcus are a leading cause of morbidity and mortality worldwide. Pneumonia, febrile bacteremia, and meningitis are the most common manifestations of invasive pneumococcal disease, while the spread of bacteria in the respiratory tract can lead to middle ear infection, sinusitis, or recurrent bronchitis. Non-invasive manifestations are usually less severe than invasive diseases, but are far more common.

[0004] In Europe and the Americas, pneumococcal pneumonia is the most common community-acquired bacterial pneumonia, estimated to affect approximately 100 people per 100,000 adults annually. The corresponding figures for febrile bacteremia and meningitis are 15–19 people per 100,000 and 1–2 people per 100,000, respectively. The risk of one or more of these manifestations is much higher in infants and the elderly, as well as in immunocompromised individuals of any age. Even in economically developed regions, invasive pneumococcal disease results in high mortality rates; the mortality rate for adults with pneumococcal pneumonia averages 10%–20%, while it can exceed 50% in high-risk groups. Pneumonia is currently the leading cause of death from pneumococcal disease worldwide.

[0005] The causative agent of pneumococcal disease, *Streptococcus pneumoniae*, is a Gram-positive cystic coccus surrounded by a polysaccharide capsule. Differences in the composition of this capsule allow for serological differentiation of approximately 91 capsule types, some of which are frequently associated with pneumococcal disease, while others are less common. Invasive pneumococcal infections include pneumonia, meningitis, and febrile bacteremia; common non-invasive manifestations include otitis media, sinusitis, and bronchitis.

[0006] Pneumococcal conjugate vaccines (PCVs) are pneumococcal vaccines used to protect against diseases caused by Streptococcus pneumoniae (S. pneumoniae). Currently, three types of PCV vaccines are available on the global market: (In some countries it is called Prevenar) (7-valent vaccine) (10-valent vaccine) and PREVNAR (13-valent vaccine)

[0007] The recent development of microbial resistance to basic antibiotics and the increasing number of immunocompromised individuals highlight the need for pneumococcal vaccines with broader protective effects.

[0008] Specifically, there is a need to address the remaining unmet medical needs related to pneumococcal disease coverage, which are due to PREVNAR The absence of serotypes and the potential for serotype replacement over time. (Prevnar) The specific serotypes causing the disease, in addition to the 13 listed, vary by region and population and can change over time due to acquired antibiotic resistance, the introduction of pneumococcal vaccines, and long-term trends from unknown sources. There is a need for immunogenic compositions that can induce an immune response in humans, particularly in children under 2 years of age, against additional pneumococcal serotypes.

[0009] The novel immunogenic composition of this invention is targeted at PREVNAR. The immunogenic compositions of the present invention aim to provide suitable protection against Streptococcus pneumoniae serotypes not found in the literature. (7-valent vaccine) and / or PREVNAR It provides adequate protection against pneumococcal serotypes not found in the vaccine, while maintaining an immune response against the serotypes currently covered by the vaccine. Invention Overview

[0010] This invention relates to immunogenic compositions comprising at least one glycoconjugate selected from the group consisting of: a glycoconjugate from Streptococcus pneumoniae serotype 15B, a glycoconjugate from Streptococcus pneumoniae serotype 22F, a glycoconjugate from Streptococcus pneumoniae serotype 33F, a glycoconjugate from Streptococcus pneumoniae serotype 12F, a glycoconjugate from Streptococcus pneumoniae serotype 10A, a glycoconjugate from Streptococcus pneumoniae serotype 11A, and a glycoconjugate from Streptococcus pneumoniae serotype 8.

[0011] In one aspect, the present invention provides an immunogenic composition comprising at least one glycoconjugate from Streptococcus pneumoniae serotype 15B, at least one glycoconjugate from Streptococcus pneumoniae serotype 22F, and at least one glycoconjugate from Streptococcus pneumoniae serotype 33F.

[0012] In another aspect, the present invention provides an immunogenic composition comprising at least one glycoconjugate from Streptococcus pneumoniae serotype 15B, at least one glycoconjugate from Streptococcus pneumoniae serotype 22F, at least one glycoconjugate from Streptococcus pneumoniae serotype 33F, at least one glycoconjugate from Streptococcus pneumoniae serotype 12F, at least one glycoconjugate from Streptococcus pneumoniae serotype 10A, at least one glycoconjugate from Streptococcus pneumoniae serotype 11A, and at least one glycoconjugate from Streptococcus pneumoniae serotype 8.

[0013] In one aspect, the aforementioned immunogenic composition also comprises glycoconjugates derived from Streptococcus pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F.

[0014] On the other hand, the above-mentioned immunogenic composition also contains glycoconjugates from Streptococcus pneumoniae serotypes 1, 5, and 7F.

[0015] On the other hand, the above-mentioned immunogenic composition also contains glycoconjugates from Streptococcus pneumoniae serotypes 6A and 19A.

[0016] On the other hand, the above-mentioned immunogenic composition also contains a glycoconjugate derived from Streptococcus pneumoniae serotype 3.

[0017] On the other hand, the above-mentioned immunogenic composition also contains glycoconjugates derived from Streptococcus pneumoniae serotypes 2, 9N, 17F, 20 and / or 15C.

[0018] On the one hand, the above-mentioned immunogenic compositions do not contain capsular sugars from Streptococcus pneumoniae serotypes 9N, 9A and / or 9L.

[0019] In one aspect, the above-mentioned immunogenic composition is a composition of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20-valent pneumococcal conjugates. In another aspect, the above-mentioned immunogenic composition is a composition of 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25-valent pneumococcal conjugates.

[0020] In one aspect, the glycoconjugate is independently conjugated to a carrier protein selected from the group consisting of: DT (diphtheria toxin), TT (tetanus toxoid), CRM. 197 Other DT mutants, PD (Haemophilus influenzae protein D), or their immunological equivalents.

[0021] In one aspect, the present invention provides a container filled with any immunogenic composition as defined herein.

[0022] In one aspect, the present invention provides any immunogenic composition as defined herein for use as a medicine, and in particular as a vaccine.

[0023] In one aspect, the present invention provides a method for preventing, treating, or alleviating an infection, disease, or symptom associated with Streptococcus pneumoniae in a subject, comprising administering to the subject an immunologically effective amount of any immunogenic composition as defined herein. Brief description of the attached diagram

[0024] Figure 1 The repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 8 (Pn-8) is shown.

[0025] Figure 2 The repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 10A (Pn-10A) is shown.

[0026] Figure 3 The repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 11A (Pn-11A) is shown.

[0027] Figure 4 The repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 12F (Pn-12F) is shown.

[0028] Figure 5 The repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 15B (Pn-15B) is shown.

[0029] Figure 6 The repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 22F (Pn-22F) is shown.

[0030] Figure 7 The repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 33F (Pn-33F) is shown.

[0031] Figure 8 The diagram shows a representative process flow chart of activation (A) and conjugation (B) methods that can be used to prepare Pn-33F glycoconjugates.

[0032] Figure 9 This shows the effect of changing the amount of NCS in the TEMPO / NCS oxidation reaction on DO.

[0033] Figure 10 This demonstrates an assessment of the stability of the Pn-12F glycoconjugate.

[0034] Figure 11Cross-functional OPA response. In OPA, the presence of functional antibodies against serotypes 9V, 9A, 9L, and 9N was evaluated in a subset of 59 sera from adults vaccinated with the 13-valent pneumococcal conjugate vaccine (US Study 6115A1-004; ClinicalTrials.gov Identifier: NCT00427895). The percentage of samples with an OPA-positive titer (i.e., ≥1:8) is indicated above each group. Geometric mean titer (GMT) is listed below each group on the X-axis.

[0035] Figure 12 Cross-functional OPA responses were evaluated in 66 matched pre- and post-vaccination sera. In OPA, the presence of functional antibodies against serotypes 9V, 9A, 9L, and 9N was assessed in subsets of 66 matched pre- and post-vaccination sera from adults vaccinated with the 13-valent pneumococcal conjugate vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The percentage of samples with an OPA-positive titer (i.e., ≥1:8) is indicated above each group. Geometric mean titer (GMT) is listed below each group on the X-axis.

[0036] Figure 13 : Reverse cumulative distribution curves (RCDC) before and after immunization - pneumococcal serotype 9V (Pn9V).

[0037] Inverse cumulative distribution curves of OPA for serotype 9V from matched pre- and post-vaccination serogroups (N=66) who received the 13-valent pneumococcal vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). This figure represents the percentage of serogroups with OPA positive titers (i.e., ≥1:8).

[0038] Figure 14 : Reverse cumulative distribution curves (RCDC) before and after immunization - pneumococcal serotype 9A (Pn9A).

[0039] Inverse cumulative distribution curves of OPA for serotype 9A from matched pre- and post-vaccination serogroups (N=66) who received the 13-valent pneumococcal vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). This figure represents the percentage of serogroups with an OPA-positive titer (i.e., ≥1:8).

[0040] Figure 15: Reverse cumulative distribution curves (RCDC) before and after immunization - pneumococcal serotype 9L (Pn9L).

[0041] The reverse cumulative distribution curves of OPA for serotype 9L from matched pre- and post-vaccination serogroups (N=66) who received the 13-valent pneumococcal vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). This figure represents the percentage of serogroups with an OPA-positive titer (i.e., ≥1:8).

[0042] Figure 16 : Reverse cumulative distribution curves (RCDC) before and after immunization - pneumococcal serotype 9N (Pn9N).

[0043] The reverse cumulative distribution curves of OPA for serotype 9N from matched pre- and post-vaccination serogroups (N=66) who received the 13-valent pneumococcal vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). This figure represents the percentage of sera with an OPA-positive titer (i.e., ≥1:8). Invention Details

[0044] 1. The immunogenic composition of the present invention

[0045] The immunogenic compositions of the present invention will generally contain conjugated capsular glycoantigens (also known as glycoconjugates), wherein the glycosides are derived from a serotype of Streptococcus pneumoniae.

[0046] Preferably, the number of Streptococcus pneumoniae capsular sugars can range from 8 different serotypes (or "v", valence) to 20 different serotypes (20v). One embodiment has 8 different serotypes. One embodiment has 9 different serotypes. One embodiment has 10 different serotypes. One embodiment has 11 different serotypes. One embodiment has 12 different serotypes. One embodiment has 13 different serotypes. One embodiment has 14 different serotypes. One embodiment has 15 different serotypes. One embodiment has 16 different serotypes. One embodiment has 17 different serotypes. One embodiment has 18 different serotypes. One embodiment has 19 different serotypes. One embodiment has 20 different serotypes. The capsular sugars conjugate to a carrier protein to form the glycoconjugates described below.

[0047] If the protein carriers of two or more sugars in the composition are the same, then the sugars can be conjugated to the same molecule of the protein carrier (the carrier molecule is conjugated to two or more different sugars) [see, for example, WO2004 / 083251].

[0048] However, in a preferred embodiment, the sugars are each independently conjugated to different protein carrier molecules (each protein carrier molecule is conjugated to only one type of sugar). In this embodiment, the capsular sugars are referred to as being independently conjugated to carrier proteins.

[0049] For the purposes of this invention, the term "glycoconjugate" refers to a capsular sugar covalently linked to a carrier protein. In one embodiment, the capsular sugar is directly linked to the carrier protein. In a second embodiment, the bacterial sugar is linked to the protein via a spacer / connector.

[0050] 1.1 The carrier protein of the present invention

[0051] One component of the glycoconjugate of this invention is a carrier protein to which the glycoconjugate is attached. The terms "protein carrier," "carrier protein," or "carrier" are used interchangeably herein. The carrier protein should conform to a standard conjugation process.

[0052] In a preferred embodiment, the carrier protein of the glycoconjugate is selected from the group consisting of: DT (diphtheria toxin), TT (tetanus toxoid), or fragments C and CRM of TT. 197(Non-toxic but immunogenic equivalent variants of diphtheria toxin), other DT mutants (such as CRM176, CRM228, CRM45 (Uchida et al. (1973) J. Biol. Chem. 218:3838-3844), CRM9, CRM102, CRM103 or CRM107; and other mutations described by Nicholls and Youle in Genetically Engineered Toxins, Ed: Frankel, Maecel Dekker Inc. (1992); Glu-148 deletion or mutation to Asp, Gln or Ser and / or Ala 158 deletion or mutation to GIy and other mutations disclosed in U.S. Patent Nos. 4,709,017 and 4,950,740; residues Lys 516, Lys 526, Phe 530 and / or Lys At least one or more mutations of 534 and other mutations disclosed in U.S. Patent Nos. 5,917,017 and 6,455,673; or fragments disclosed in U.S. Patent No. 5,843,711, pneumococcal pneumolysin (ply) (Kuo et al. (1995) Infect lmmun 63:2706-2713) includes a ply that has been detoxified in some way, such as dPLY-GMBS (WO 2004 / 081515, WO 2006 / 032499) or dPLY-formol, PhtX, including PhtA, PhtB, PhtD, PhtE (the sequences of PhtA, PhtB, PhtD or PhtE are in WO 00 / 37105 and WO (Disclosed in 00 / 39299) and Pht protein fusions, such as PhtDE fusion, PhtBE fusion, Pht AE (WO 01 / 98334, WO 03 / 054007, WO 2009 / 000826), OMPC (meningococcal outer membrane protein), which is often extracted from Neisseria meningitidis serum group B (EP0372501), PorB (from Neisseria meningitidis (N.Haemophilus influenzae protein D (see, for example, EP0594610 B), or its immunological equivalents, synthetic peptides (EP0378881, EP0427347), heat shock proteins (WO 93 / 17712, WO 94 / 03208), pertussis proteins (WO98 / 58668, EP0471177), cytokines, lymphokines, growth factors or hormones (WO91 / 01146), artificial proteins containing multiple human CD4+ T cell epitopes (antigens from various pathogen sources) (Falugi et al. (2001) Eur J Immunol 31:3816-3824), such as N19 protein (Baraldoi et al. (2004) Infectlmmun 72:4884-4887), pneumococcal surface protein PspA (WO 02 / 091998), iron uptake protein (WO 01 / 72337), Clostridium difficile toxin A and toxin B (WO 00 / 61761), transferrin-binding protein, pneumococcal adhesion protein (PsaA), recombinant Pseudomonas aeruginosa exotoxin A (especially its non-toxic mutants (such as exotoxin A with a substitution at glutamate 553 (Douglas et al. (1987) J. Bacteriol. 169(11):4967-4971)). Other proteins, such as ovalbumin, keyhole hemocyanin (KLH), bovine serum albumin (BSA), or purified protein derivatives of tuberculin (PPD), can also be used as carrier proteins. Other suitable carrier proteins include inactivated bacterial toxins such as cholera toxins (e.g. WO 02 / 091998), iron uptake protein (WO 01 / 72337), Clostridium difficile toxin A and toxin B (WO 00 / 61761), transferrin-binding protein, pneumococcal adhesion protein (PsaA), recombinant Pseudomonas aeruginosa exotoxin A (especially its non-toxic mutants (such as exotoxin A with a substitution at glutamate 553) (Douglas et al. (1987) J. Bacteriol. 169(11):4967-4971)). The bacteria described in 2004 / 083251 include *Escherichia coli* LT, *Escherichia coli* ST, and exotoxin A from *Pseudomonas aeruginosa*.

[0053] In a preferred embodiment, the carrier protein of the glycoconjugate is independently selected from the group consisting of: TT, DT, DT mutants (such as CRM). 197 Haemophilus influenzae protein D, PhtX, PhtD, PhtDE fusions (especially those described in WO 01 / 98334 and WO 03 / 054007), detoxified pneumococcal hemolysin, PorB, N19 protein, PspA, OMPC, Clostridium difficile toxins A and B, and PsaA.

[0054] In one embodiment, the carrier protein of the glycoconjugate of the present invention is DT (diphtheria toxoid). In another embodiment, the carrier protein of the glycoconjugate of the present invention is TT (tetanus toxoid).

[0055] In another embodiment, the carrier protein of the glycoconjugate of the present invention is PD (Haemophilus influenzae protein D; see, for example, EP0594610 B).

[0056] In a preferred embodiment, the capsular sugar of the present invention is conjugated to CRM. 197 Protein. The CRM 197 The protein is a non-toxic form of diphtheria toxin, but it is immunologically indistinguishable from diphtheria toxin. (CRM) 197 It was generated by non-toxin-producing bacteriophage β197 tox- CRM is produced by Corynebacterium diphtheriae infection (created through mutagenesis of toxin-producing β-rodactylophages via nitrosoguanidine mutagenesis) (Uchida et al. (1971) Nature New Biology 233:8-11). 197 The protein has the same molecular weight as diphtheria toxin, but the difference lies in a single base change in its structural gene (guanine is replaced by adenine). This single base change causes an amino acid substitution in the mature protein (glycine is replaced by glutamic acid) and eliminates the toxicity of diphtheria toxin. CRM 197 Proteins are safe and effective T-cell-dependent carriers of glucose. (Regarding CRM) 197 Further details of this can be found, for example, in U.S. Patent No. 5,614,382.

[0057] In one embodiment, the capsular sugar of the present invention is conjugated to CRM. 197 protein or CRM 197 The A chain (see CN103495161). In one embodiment, the capsular sugar of the present invention is conjugated to CRM obtained by expression in genetically recombinant Escherichia coli. 197 The A chain (see CN103495161). In one embodiment, all capsular sugars of the present invention are conjugated to CRM. 197 In one embodiment, all capsular sugars of the present invention are conjugated to CRM. 197 Chain A.

[0058] Therefore, in common embodiments, the glycoconjugates of the present invention contain CRM. 197 As a carrier protein, the capsular polysaccharide is covalently linked to CRM. 197 .

[0059] 1.2 The capsular sugar of the present invention

[0060] The term "sugar" throughout this specification can refer to or include both polysaccharides and oligosaccharides. In common embodiments, the sugar is a polysaccharide, particularly Streptococcus pneumoniae capsular polysaccharide.

[0061] Capsular polysaccharides are prepared using standard techniques known to those skilled in the art.

[0062] In this invention, capsular polysaccharides can be prepared from, for example, serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F of Streptococcus pneumoniae. Typically, capsular polysaccharides are produced by culturing Streptococcus pneumoniae serotypes in a culture medium (e.g., in a soybean-based medium), followed by preparation of the polysaccharides from the bacterial culture. The Streptococcus pneumoniae strains used to prepare the various polysaccharides used in the glycoconjugates of this invention can be obtained from established culture collections or clinical samples.

[0063] The population of organisms (for each Streptococcus pneumoniae serotype) is often scaled up from seed vials to seed bottles and passaged through one or more seed fermenters of increasing volume until a production-scale fermentation volume is reached. At the end of the growth cycle, the cells are lysed and the lysate is then harvested for downstream (purification) processing (see, for example, WO 2006 / 110381, WO2008 / 118752, and U.S. Patent Application Publications 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838).

[0064] Polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752).

[0065] Purified polysaccharides can be activated (e.g., chemically activated) to enable them to react (e.g. with eTEC spacers) and subsequently incorporated into the glycoconjugates of the present invention, as further described herein.

[0066] Streptococcus pneumoniae capsular polysaccharide contains repeating oligosaccharide units (which may contain up to 8 sugar residues).

[0067] In one embodiment, the capsular sugar of the present invention can be an oligosaccharide unit or a repeating oligosaccharide unit of a sugar chain shorter than its natural length. In one embodiment, the capsular sugar of the present invention is a repeating oligosaccharide unit of a relevant serotype.

[0068] In one embodiment, the capsular sugar of the present invention may be an oligosaccharide. Oligosaccharides have a low number of repeating units (typically 5-15 repeating units) and are typically derived from synthesis or from the hydrolysis of polysaccharides.

[0069] However, preferably, all capsular sugars of the present invention, and all capsular sugars in the immunogenic compositions of the present invention, are polysaccharides. High molecular weight capsular polysaccharides can induce certain antibody immune responses (due to epitopes present on the surface of antigens). For the conjugates, compositions, and methods of the present invention, it is preferable to isolate and purify high molecular weight capsular polysaccharides.

[0070] In some embodiments, the purified polysaccharide has a molecular weight of 10 kDa to 4,000 kDa prior to conjugation. In other such embodiments, the polysaccharide has a molecular weight of 50 kDa to 4,000 kDa. In another such embodiment, the polysaccharide has the following molecular weights: 50 kDa to 3,500 kDa; 50 kDa to 3,000 kDa; 50 kDa to 2,500 kDa; 50 kDa to 2,000 kDa; 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 4,000 kDa; 100 kDa to 3,500 kDa; 100 kDa to 3,000 kDa; 100 kDa to 2,500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1 750kDa; 100kDa to 1,500kDa; 100kDa to 1,250kDa; 100kDa to 1,000kDa; 100kDa to 750kDa; 100kDa to 500kDa; 200kDa to 4,000kDa; 200kDa to 3,500kDa; 200kDa to 3,000kDa; 200kDa to 2,500kDa; 200kDa to 2,000kDa; 200kDa to 2,000kDa; 200kDa to 1,750kDa; 200kDa to 1,500kDa; 200kDa to 1,250kDa; 200kDa to 1,000kDa; 200kDa to 750kDa; or 200kDa to 500kDa. Any integer within the range described above is considered an implementation of this disclosure.

[0071] Polysaccharides can decrease in size slightly during normal purification. Additionally, as described herein, polysaccharides can undergo sizing techniques prior to conjugation. These sizing techniques can be mechanical or chemical. Chemical hydrolysis with acetic acid is possible. Mechanical sizing can be performed using high-pressure homogenous shearing. The molecular weight ranges mentioned above refer to purified polysaccharides prior to conjugation (e.g., prior to activation).

[0072] In a preferred embodiment, the purified polysaccharide is a capsular polysaccharide derived from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, or 33F of Streptococcus pneumoniae, wherein the capsular polysaccharide has a molecular weight falling within the molecular weight range described above.

[0073] As used herein, the “molecular weight” of the term polysaccharide or carrier protein-polysaccharide conjugate refers to the molecular weight calculated by size exclusion chromatography (SEC) combined with a multi-angle laser light scattering detector (MALLS).

[0074] In some embodiments, the pneumococcal sugars of serotypes 9V, 18C, 11A, 15B, 22F, and / or 33F of the present invention are O-acetylated.

[0075] The purified polysaccharides described herein are chemically activated to enable the sugars to react with carrier proteins. These pneumococcal conjugates are prepared by separate processes and formulated into single-dose formulations as described herein.

[0076] 1.2.1 Polysaccharides from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F

[0077] Capsular polysaccharides from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F can be prepared using standard techniques known to those skilled in the art (see, for example, WO 2006 / 110381). Capsular polysaccharides can be produced by growing each Streptococcus pneumoniae serotype in a culture medium; at the end of the growth cycle, the cells are hydrolyzed, and the lysate is then harvested for downstream (purification) processing. The polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752). The purified polysaccharides can be further processed as described herein to prepare the glycoconjugates of the present invention.

[0078] In some embodiments, purified polysaccharides from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and / or 23F have a molecular weight of 10 kDa to 4,000 kDa prior to conjugation. In other such embodiments, the polysaccharides have a molecular weight of 50 kDa to 4,000 kDa; 50 kDa to 3,000 kDa; or 50 kDa to 2,000 kDa.

[0079] In another such embodiment, the polysaccharide has a molecular weight of 50 kDa to 3,500 kDa; 50 kDa to 3,000 kDa; 50 kDa to 2,500 kDa; 50 kDa to 2,000 kDa; 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa. Molecular weight from 0 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 4,000 kDa; 100 kDa to 3,500 kDa; 100 kDa to 3,000 kDa; 100 kDa to 2,500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa Molecular weight; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa; 100 kDa to 1,000 kDa; 100 kDa to 750 kDa; 100 kDa to 500 kDa; 200 kDa to 4,000 kDa; 200 kDa to 3,500 kDa; 200 kDa to 3,000 kDa Molecular weight; 200 kDa to 2,500 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,750 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa. Any integer within any of the above ranges is considered an embodiment of this disclosure.

[0080] Polysaccharides can be slightly reduced in size during normal purification. Additionally, as described herein, polysaccharides can undergo size-modifying techniques prior to conjugation. The molecular weight ranges mentioned above refer to purified polysaccharides prior to conjugation (e.g., before activation) and after the final size-modifying step.

[0081] In some embodiments, the pneumococcal sugars of serotype 9V and / or 18C are O-acetylated. In some embodiments, the pneumococcal sugars of serotype 9V are O-acetylated and the pneumococcal sugars of serotype 18C are de-O-acetylated.

[0082] 1.2.2 Pneumococcal polysaccharide serotype 8

[0083] The polysaccharide repeating unit of serotype 8 consists of linear tetrasaccharide units, including one glucuronic acid (GlcpA), two pyranose glucose units (Glcp), and one galactopyranose unit (Galp) (Jones et al. (1957) The Journal of the American Chemical Society. 79(11):2787-2793). All four monosaccharides are linked by 1,4-bonds, such as... Figure 1 As shown.

[0084] Serum type 8 sugars can be obtained directly from bacteria using isolation processes known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Application Publications Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). Alternatively, they can be produced using synthetic methods.

[0085] Serotype 8 Streptococcus pneumoniae strains can be obtained from self-established culture collections (e.g., from the Centers for Disease Control and Prevention, Atlanta, GA) or clinical samples.

[0086] In some embodiments, the purified polysaccharide from Streptococcus pneumoniae serotype 8 has a molecular weight of 10 kDa to 2,000 kDa prior to conjugation. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 900 kDa. In yet another embodiment, the capsular polysaccharide has a molecular weight of 100 kDa to 800 kDa.

[0087] In another embodiment, the capsular polysaccharide has the following molecular weights: 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 200 kDa to 600 kDa; 200 kDa to 500 kDa; 200 kDa to 400 kDa; 250 kDa to 600 kDa; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa to 350 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; 400 kDa to 600 kDa; 500 kDa to 600 kDa; and similar desired molecular weight ranges. Any integer within the range described above is considered an implementation of this disclosure.

[0088] Polysaccharides can be slightly reduced in size during normal purification. Additionally, as described herein, polysaccharides can undergo size-modifying techniques prior to conjugation. The molecular weight ranges mentioned above refer to purified polysaccharides prior to conjugation (e.g., before activation) and after the final size-modifying step.

[0089] 1.2.3 Pneumococcal polysaccharide serotype 10A

[0090] The purified polysaccharide repeating unit of serum type 10A consists of branched hexasaccharide repeating units, including two galactofuranose units. f ), three galactopyranoses (Gal p ), one N-acetylgalactosamine (Gal p NAc) and skeletal phosphoribitol (Jones, C. (2005) Carbohydrate Research 269(1):175-181). The β-GalpNAc moiety contains two branched monosaccharides (β-3-Galp and β-6-Galf), such as... Figure 2 As shown.

[0091] Serum type 10A sugars can be obtained directly from bacteria using isolation processes known to those skilled in the art (see, for example, methods disclosed in U.S. Patent Application Publications Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). Alternatively, they can be produced using synthetic methods.

[0092] Serotype 10A Streptococcus pneumoniae strains can be obtained from self-established culture collections (such as those from Streptococcus Reference Laboratories (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical samples.

[0093] In some embodiments, the purified polysaccharide from Streptococcus pneumoniae serotype 10A has a molecular weight of 10 kDa to 2,000 kDa prior to conjugation. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 900 kDa. In yet another embodiment, the capsular polysaccharide has a molecular weight of 100 kDa to 800 kDa.

[0094] In another embodiment, the capsular polysaccharide has the following molecular weights: 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 200 kDa to 600 kDa; 200 kDa to 500 kDa; 200 kDa to 400 kDa; 250 kDa to 600 kDa; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa to 350 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; 400 kDa to 600 kDa; 500 kDa to 600 kDa; and similar desired molecular weight ranges. Any integer within the range described above is considered an implementation of this disclosure.

[0095] Polysaccharides can be slightly reduced in size during normal purification. Additionally, as described herein, polysaccharides can undergo size-modifying techniques prior to conjugation. The molecular weight ranges mentioned above refer to purified polysaccharides prior to conjugation (e.g., before activation) and after the final size-modifying step.

[0096] 1.2.4 Pneumococcal polysaccharide serotype 11A

[0097] The purified polysaccharide repeating unit of serum type 11A consists of a linear tetrasaccharide backbone (two galactopyranoses). p ) and two pyranoses (Glc p )) and suspended glycerol phosphate composition (Richards et al. (1988) Adv. Exp. Med. Biol. 228:595-597), such as Figure 3As shown. The polysaccharide is O-acetylated at multiple positions, and based on data reported in the literature (Calix et al. (2011) J Bacteriol. 193(19): 5271-5278), the total amount of O-acetylation in 11A polysaccharide is approximately 2.6 O-acyl groups per polysaccharide repeating unit.

[0098] Serum type 11A sugars can be obtained directly from bacteria using isolation processes known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Application Publications Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). Alternatively, they can be produced using synthetic methods.

[0099] Serotype 11A Streptococcus pneumoniae strains can be obtained from self-established culture collections (e.g., from Streptococcus reference laboratories (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical samples.

[0100] Isolated serotype 11A capsular polysaccharides obtained by purifying serotype 11A polysaccharides from Streptococcus pneumoniae hydrolysates and optionally by altering the size of the purified polysaccharides can be characterized by various properties, including, for example, molecular weight (MW) and the number of mM acetate / salts per mM of the serotype 11A capsular polysaccharide.

[0101] In some embodiments, the purified polysaccharide from Streptococcus pneumoniae serotype 11A has a molecular weight of 10 kDa to 2,000 kDa before conjugation. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 900 kDa. In yet another embodiment, the capsular polysaccharide has a molecular weight of 100 kDa to 800 kDa.

[0102] In another embodiment, the capsular polysaccharide has the following molecular weights: 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 100 kDa to 200 kDa; 150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 150 kDa to 300 kDa; 150 kDa to 200 kDa; 200 kDa to 600 kDa. 00 kDa; 200 kDa to 500 kDa; 200 kDa to 400 kDa; 250 kDa to 600 kDa; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa to 350 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; 400 kDa to 600 kDa; 500 kDa to 600 kDa; and similar desired molecular weight ranges. Any integer within any of the above ranges is considered an embodiment of this disclosure.

[0103] Polysaccharides can be slightly reduced in size during normal purification. Additionally, as described herein, polysaccharides can undergo size-modifying techniques prior to conjugation. The molecular weight ranges mentioned above refer to purified polysaccharides prior to conjugation (e.g., before activation) and after the final size-modifying step.

[0104] In one embodiment, the size of the purified serum-type 11A polysaccharide is reduced by high-pressure homogenization. High-pressure homogenization achieves a high shear rate by pumping the processing stream through a sufficiently small flow path. The shear rate can be increased by using a larger application homogenization pressure, and the exposure time can be increased by recirculating the feed stream through the homogenizer.

[0105] The high-pressure homogenization process is particularly suitable for reducing the size of purified serum-type 11A polysaccharide while retaining its structural features, such as the presence of the O-acetyl group.

[0106] The presence of O-acetyl groups in purified, isolated, or activated serum type 11A capsular polysaccharides or in serum type 11A polysaccharide-carrier protein conjugates is expressed as the number of mM of the polysaccharide acetate / salt per mM or as the number of O-acetyl groups per polysaccharide repeating unit.

[0107] In a preferred embodiment, the purified polysaccharide from Streptococcus pneumoniae serotype 11A has at least 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4 or 1.6 μmol of acetate / salt per μmol of said serotype 11A capsular polysaccharide.

[0108] 1.2.5 Pneumococcal polysaccharide serotype 12F

[0109] The purified polysaccharide of serum type 12F consists of a repeating unit composed of a linear trisaccharide backbone (one N-acetylfucosamine (Fuc)). p NAc), one N-acetylgalactosamine (Gal) p NAc), and an N-acetylmannuronic acid (Man) p NAcA), which has two branches: a pendant α-galactopyranose (Gal) p ) Connected in Fuc p C3 and α-Glc of NAc p -(1→2)-α-Glc p disaccharide branching link in Man p NAcA C3 (Leontein et al. (1983) Carbohydrate Research 114(2):257-266.), such as Figure 4 As shown.

[0110] Serotype 12F Streptococcus pneumoniae strains can be obtained from self-established culture collections (such as those from Streptococcus Reference Laboratories (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical samples.

[0111] Capsular sugars from Streptococcus pneumoniae serotype 12F can be prepared using standard techniques known to those skilled in the art. Capsular polysaccharides are typically produced by growing each Streptococcus pneumoniae serotype in a culture medium (e.g., in a soybean-based medium), followed by polysaccharide preparation from the bacterial culture. Populations of organisms (Streptococcus pneumoniae serotype 12F) are often scaled up from seed vials to seed bottles and passaged through one or more seed fermenters of increasing volume until a production-scale fermentation volume is reached. At the end of the growth cycle, the cells are lysed and the lysate is harvested for downstream (purification) processing (see, for example, WO 2006 / 110381 and WO 2008 / 118752, U.S. Patent Application Publications 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and US2008 / 0286838). Polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752).

[0112] Purified polysaccharides from serotype 12F can be activated (e.g., chemically activated) to enable them to react and subsequently incorporate into the glycoconjugates of the present invention, as further described herein.

[0113] In some embodiments, the purified polysaccharide from Streptococcus pneumoniae serotype 12F has a molecular weight of 10 kDa to 2,000 kDa prior to conjugation. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 300 kDa. In yet another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 300 kDa. In another embodiment, the capsular polysaccharide has the following molecular weights: 90 kDa to 250 kDa; 90 kDa to 150 kDa; 90 kDa to 120 kDa; 80 kDa to 120 kDa; 70 kDa to 100 kDa; 70 kDa to 110 kDa; 70 kDa to 120 kDa; 70 kDa to 130 kDa; 70 kDa to 140 kDa; 70 kDa to 150 kDa; 70 kDa to 160 kDa; 80 kDa to 110 kDa; 80 kDa to 120 kDa; 80 kDa to 130 kDa. Da; 80kDa to 140kDa; 80kDa to 150kDa; 80kDa to 160kDa; 90kDa to 110kDa; 90kDa to 120kDa; 90kDa to 130kDa; 90kDa to 140kDa; 90kDa to 150kDa; 90kDa to 160kDa; 100kDa to 120kDa; 100kDa to 130kDa; 100kDa to 140kDa; 100kDa to 150kDa; 100kDa to 160kDa; and similar desired molecular weight ranges. Any integer within any of the above ranges is considered an embodiment of this disclosure.

[0114] Polysaccharides can be slightly reduced in size during normal purification. Additionally, as described herein, polysaccharides can undergo size-modifying techniques prior to conjugation. The molecular weight ranges mentioned above refer to purified polysaccharides prior to conjugation (e.g., before activation) and after the final size-modifying step.

[0115] 1.2.6 Pneumococcal polysaccharide serotype 15B

[0116] like Figure 5 As shown, the purified polysaccharide repeating unit of serotype 15B consists of a branched trisaccharide backbone (one N-acetylglucosamine (Glc)). p NAc), one galactopyranose (Gal) p ), and a pyranose (Glc) p )) and connected to Glc p α-Gal of the C4 hydroxyl group of NAc p -βGal p The disaccharide branches are composed of glycerol phosphate linked to β-Gal in the disaccharide branches.p The C3 hydroxyl group of the residue (Jones et al. (2005) Carbohydrate Research 340(3):403-409). The capsular polysaccharide from serotype 15C has the same skeletal structure as serotype 15B but lacks O-acetylation.

[0117] Serotype 15B polysaccharides can be obtained directly from bacteria using isolation processes known to those skilled in the art (see, for example, methods disclosed in U.S. Patent Application Publications 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). They can be produced using synthetic methods known to those skilled in the art.

[0118] Serotype 15B Streptococcus pneumoniae strains can be obtained from established culture collections (such as the American Type Culture Collection (ATCC, Manassas, VA USA) (e.g., strain number ATCC10354) or Streptococcus reference laboratories (Centers for Disease Control and Prevention, Atlanta, GA USA)) or from clinical samples.

[0119] Bacterial cells are grown in a culture medium, preferably a soybean-based medium. Following fermentation of bacterial cells producing pneumococcal serotype 15B capsular polysaccharide, the bacterial cells are lysed to produce cell lysates. The serotype 15B polysaccharide can then be isolated from the cell lysates using purification techniques known in the art, including centrifugation, deep filtration, precipitation, ultrafiltration, treatment with activated carbon, percolation, and / or column chromatography (see, for example, U.S. Patent Application Publications Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498 and WO2008 / 118752). The purified serotype 15B capsular polysaccharide can then be used to prepare immunogenic conjugates.

[0120] The isolated serotype 15B capsular polysaccharide obtained by purifying serotype 15B polysaccharide from Streptococcus pneumoniae hydrolysate and optionally by resizing the purified polysaccharide can be characterized by various parameters, including, for example, molecular weight (MW), the number of mM acetate / salts per mM of the serotype 15B capsular polysaccharide, and the number of mM glycerols per mM of the serotype 15B capsular polysaccharide.

[0121] Preferably, to produce a serum-type 15B conjugate with favorable filterability and / or yield, the polysaccharide size is modified to the target molecular weight range before conjugation to the carrier protein. Advantageously, the size of the purified serum-type 15B polysaccharide is reduced while retaining key structural features of the polysaccharide, such as the presence of an O-acetyl group. Preferably, the size of the purified serum-type 15B polysaccharide is reduced by mechanical homogenization.

[0122] In a preferred embodiment, the size of the purified serum-type 15B polysaccharide is reduced by high-pressure homogenization. High-pressure homogenization achieves a high shear rate by pumping the processing stream through a sufficiently small flow path. The shear rate can be increased by using a larger application homogenization pressure, and the exposure time can be increased by recirculating the feed stream through the homogenizer.

[0123] The high-pressure homogenization process is particularly suitable for reducing the size of purified serum-type 15B polysaccharide while retaining its structural features, such as the presence of the O-acetyl group.

[0124] In a preferred embodiment, the isolated serum-type 15B capsular polysaccharide has the following molecular weights: 5 kDa to 500 kDa, 50 kDa to 500 kDa, 50 kDa to 450 kDa, 100 kDa to 400 kDa, and 100 kDa to 350 kDa. In a preferred embodiment, the isolated serum-type 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa. In a preferred embodiment, the isolated serum-type 15B capsular polysaccharide has a molecular weight of 100 kDa to 300 kDa. In a preferred embodiment, the isolated serum-type 15B capsular polysaccharide has a molecular weight of 150 kDa to 300 kDa. In a preferred embodiment, the isolated serum-type 15B capsular polysaccharide has a molecular weight of 150 kDa to 350 kDa. In another embodiment, the capsular polysaccharide has the following molecular weights: 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 100 kDa to 200 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 150 kDa to 300 kDa; 150 kDa to 200 kDa; 200 kDa to 500 kDa; 200 kDa to 400 kDa; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa to 350 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; and similar desired molecular weight ranges. Any integer within any of the above ranges is considered an embodiment of this disclosure.

[0125] The serum-type 15B polysaccharide is O-acetylated, and the total O-acetylation is approximately 0.8-0.9 O-acetyl groups per polysaccharide repeating unit. The degree of O-acetylation of the polysaccharide can be determined by any method known in the art, such as proton NMR (see, for example, Lemercinier et al. (1996) Carbohydrate Research 296:83-96; Jones et al. (2002) J. Pharmaceutical and Biomedical Analysis 30:1233-1247; WO 2005 / 033148 and WO 00 / 56357). Other commonly used methods are described in Hestrin, S. (1949) J. Biol. Chem. 180:249-261. Preferably, the presence of O-acetyl groups is determined by ion HPLC analysis.

[0126] The presence of O-acetyl groups in purified, isolated, or activated serum type 15B capsular polysaccharides or in serum type 15B polysaccharide-carrier protein conjugates is expressed as the number of acetate / salts per mM of the polysaccharide, or as the number of O-acetyl groups per polysaccharide repeating unit.

[0127] In a preferred embodiment, the purified polysaccharide from Streptococcus pneumoniae serotype 15B contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM of acetate / salt per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.5, 0.6, or 0.7 mM of acetate / salt per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.6 mM of acetate / salt per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.7 mM of acetate / salt per mM of the serotype 15B capsular polysaccharide.

[0128] The presence of the glycerol phosphate side chain (after its release by treatment of the polysaccharide with hydrofluoric acid (HF)) was determined by measuring glycerol using high-performance anion exchange chromatography-pulse amperometric detection (HPAEC-PAD). Glycerol present in purified, isolated, or activated serum type 15B polysaccharide or in serum type 15B polysaccharide-carrier protein conjugates is expressed as the number of mM of glycerol per mM serum type 15B polysaccharide.

[0129] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM of glycerol per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.5, 0.6, or 0.7 mM of glycerol per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.6 mM of glycerol per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide contains at least 0.7 mM of glycerol per mM of the serotype 15B capsular polysaccharide.

[0130] In a preferred embodiment, the isolated serum type 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa and each mM of the serum type 15B capsular polysaccharide contains at least 0.6 mM of acetate / salt.

[0131] In a preferred embodiment, the isolated serum type 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa such that each mM of the serum type 15B capsular polysaccharide contains at least 0.6 mM of glycerol.

[0132] In a preferred embodiment, the isolated serum type 15B capsular polysaccharide has a molecular weight of 150 kDa to 300 kDa such that each mM of the serum type 15B capsular polysaccharide contains at least 0.6 mM of acetate / salt.

[0133] In a preferred embodiment, the isolated serum type 15B capsular polysaccharide has a molecular weight of 150 kDa to 300 kDa such that each mM of the serum type 15B capsular polysaccharide contains at least 0.6 mM of glycerol.

[0134] In a preferred embodiment, the isolated serum type 15B capsular polysaccharide has a molecular weight of 150 kDa to 350 kDa such that each mM of the serum type 15B capsular polysaccharide contains at least 0.6 mM of acetate / salt.

[0135] In a preferred embodiment, the isolated serum type 15B capsular polysaccharide has a molecular weight of 150 kDa to 350 kDa such that each mM of the serum type 15B capsular polysaccharide contains at least 0.6 mM of glycerol.

[0136] In a preferred embodiment, the isolated serum type 15B capsular polysaccharide contains at least 0.6 mM of acetate / salt and at least 0.6 mM of glycerol per mM of serum type 15B capsular polysaccharide.

[0137] In a preferred embodiment, the isolated serum type 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa such that each mM of the serum type 15B capsular polysaccharide contains at least 0.6 mM of acetate / salt and at least 0.6 mM of glycerol.

[0138] In a preferred embodiment, the isolated serum type 15B capsular polysaccharide has a molecular weight of 150 kDa to 300 kDa such that each mM of the serum type 15B capsular polysaccharide contains at least 0.6 mM of acetate / salt and at least 0.6 mM of glycerol.

[0139] In a preferred embodiment, the isolated serum type 15B capsular polysaccharide has a molecular weight of 150 kDa to 350 kDa such that each mM of the serum type 15B capsular polysaccharide contains at least 0.6 mM of acetate / salt and at least 0.6 mM of glycerol.

[0140] 1.2.7 Pneumococcal polysaccharide serotype 22F

[0141] like Figure 6 As shown, the purified polysaccharide repeating unit of serum type 22F consists of a branched pentasaccharide backbone (one glucuronic acid (Glc)). p A) One pyranose (Glc) p ), one galactoferrin (Gal) f ) and two pyranose rhamnose (Rha p )) and connected to βRha p αGlc of C3 hydroxyl group p Branching composition (Richards et al. (1989) Canadian Journal of Chemistry 67(6):1038-1050). βRha in polysaccharide repeating units p Approximately 80% of the C2 hydroxyl groups in the residues are O-acetylated.

[0142] Serotype 22F polysaccharides can be obtained directly from bacteria using isolation processes known to those skilled in the art (see, for example, methods disclosed in U.S. Patent Application Publications Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). Alternatively, they can be produced using synthetic methods.

[0143] Serotype 22F Streptococcus pneumoniae strains can be obtained from established culture collections (such as, for example, the Streptococcus Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical samples.

[0144] The isolated serotype 22F capsular polysaccharide obtained by purifying serotype 22F polysaccharide from Streptococcus pneumoniae hydrolysate and optionally by resizing the purified polysaccharide can be characterized by various parameters, including, for example, molecular weight (MW) and the number of mM acetate / salts per mM of the serotype 22F capsular polysaccharide.

[0145] Preferably, to produce a serum-type 22F conjugate with favorable filterability and / or yield, the polysaccharide size is modified to the target molecular weight range before conjugation to the carrier protein. Advantageously, the size of the purified serum-type 22F polysaccharide is reduced while retaining key structural features of the polysaccharide, such as the presence of an O-acetyl group. Preferably, the size of the purified serum-type 22F polysaccharide is reduced by mechanical homogenization.

[0146] In a preferred embodiment, the size of the purified polysaccharide is reduced by high-pressure homogenization. High-pressure homogenization achieves a high shear rate by pumping the processing stream through a sufficiently small flow path. The shear rate can be increased by using a larger application homogenization pressure, and the exposure time can be increased by recirculating the feed stream through the homogenizer.

[0147] The high-pressure homogenization process is particularly suitable for reducing the size of purified serum-type 22F polysaccharide while retaining its structural features, such as the presence of the O-acetyl group.

[0148] In some embodiments, the purified polysaccharide from Streptococcus pneumoniae serotype 22F has a molecular weight of 10 kDa to 2,000 kDa before conjugation. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 900 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 100 kDa to 800 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 200 kDa to 600 kDa. In yet another embodiment, the capsular polysaccharide has a molecular weight of 400 kDa to 700 kDa.

[0149] In another embodiment, the capsular polysaccharide has the following molecular weights: 100 kDa to 1,000 kDa; 100 kDa to 900 kDa; 100 kDa to 800 kDa; 100 kDa to 700 kDa; 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 150 kDa to 1,000 kDa; 150 kDa to 900 kDa; 1 50kDa to 800kDa; 150kDa to 700kDa; 150kDa to 600kDa; 150kDa to 500kDa; 150kDa to 400kDa; 150kDa to 300kDa; 200kDa to 1,000kDa; 200kDa to 900kDa; 200kDa to 800kDa; 200kDa to 700kDa; 200kDa to 600kDa; 200kDa to 500kDa; 2 00kDa to 400kDa; 200kDa to 300kDa; 250kDa to 1,000kDa; 250kDa to 900kDa; 250kDa to 800kDa; 250kDa to 700kDa; 250kDa to 600kDa; 250kDa to 500kDa; 250kDa to 400kDa; 250kDa to 350kDa; 300kDa to 1,000kDa; 300kDa to 900kDa ; 300 kDa to 800 kDa; 300 kDa to 700 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; 400 kDa to 1,000 kDa; 400 kDa to 900 kDa; 400 kDa to 800 kDa; 400 kDa to 700 kDa; 400 kDa to 600 kDa; 500 kDa to 600 kDa; and similar desired molecular weight ranges. Any integer within any of the above ranges is considered an embodiment of this disclosure.

[0150] Polysaccharides can be slightly reduced in size during normal purification. Additionally, as mentioned above, 22F polysaccharides can undergo size-modifying techniques before conjugation. The molecular weight ranges mentioned above refer to purified polysaccharides prior to conjugation (e.g., before activation) and after the final size-modifying step.

[0151] The degree of O-acetylation of the polysaccharide can be determined by any method known in the art, such as proton NMR (Lemercinier et al. (1996) Carbohydrate Research 296:83-96; Jones et al. (2002) J. Pharmaceutical and Biomedical Analysis 30:1233-1247; WO 2005 / 033148 and WO 00 / 56357). Other commonly used methods are described in Hestrin, S. (1949) J. Biol. Chem. 180:249-261. Preferably, the presence of the O-acetyl group is determined by ion HPLC analysis.

[0152] The presence of O-acetyl groups in purified, isolated, or activated serum-type 22F capsular polysaccharides or in serum-type 22F polysaccharide-carrier protein conjugates is expressed as the number of mM of the polysaccharide acetate / salt per mM or as the number of O-acetyl groups per polysaccharide repeating unit.

[0153] In a preferred embodiment, the purified polysaccharide from Streptococcus pneumoniae serotype 22F has at least 0.2, 0.4, 0.6, 0.8, 1, 1.2, 1.4 or 1.6 μmol of acetate / salt per μmol of said serotype 22F capsular polysaccharide.

[0154] 1.2.8 Pneumococcal polysaccharide serotype 33F

[0155] like Figure 7 As shown, the purified polysaccharide repeating unit of serum type 33F consists of a branched pentasaccharide backbone (two galactopyranoses). p ), two galactoferrins (Gal f ) and a pyranose (Glc) p ) and connected to the αGal within the skeleton p The terminal αGal of the C2 hydroxyl group of the residue p Composition (Lemercinier et al. (2006) Carbohydrate Research 341(1):68-74.). The literature reports a skeleton of 3-β-Gal. f The C2 hydroxyl group of the residue is O-acetylated.

[0156] Serum-type 33F polysaccharides can be obtained directly from bacteria using isolation processes known to those skilled in the art (see, for example, methods disclosed in U.S. Patent Application Publications Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). Alternatively, they can be produced using synthetic methods.

[0157] Serotype 33F Streptococcus pneumoniae strains can be obtained from established culture collections (such as, for example, the Streptococcus Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical samples.

[0158] Purified polysaccharides from serum type 33F can be activated (e.g., chemically activated) to enable them to react and subsequently incorporate into the glycoconjugates of the present invention, as further described herein.

[0159] The isolated serum-type 33F capsular polysaccharide obtained by purifying serum-type 33F polysaccharide from Streptococcus pneumoniae hydrolysate and optionally by resizing the purified polysaccharide can be characterized by various parameters, including, for example, molecular weight and the number of mM acetate / salts per mM of the serum-type 33F capsular polysaccharide.

[0160] In some embodiments, the purified polysaccharide from Streptococcus pneumoniae serotype 33F has a molecular weight of 10 kDa to 2,000 kDa before conjugation. In other such embodiments, the sugar has a molecular weight of 50 kDa to 2,000 kDa. In still other such embodiments, the sugar has the following molecular weights: 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa Up to 1,250 kDa; 100 kDa to 1,000 kDa; 100 kDa to 750 kDa; 100 kDa to 500 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,750 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa. Any integer within any of the above ranges is considered an embodiment of this disclosure.

[0161] Polysaccharides can be slightly reduced in size during normal purification. Additionally, as described herein, polysaccharides can undergo size-modifying techniques prior to conjugation. The molecular weight ranges mentioned above refer to purified polysaccharides prior to conjugation (e.g., before activation) and after the final size-modifying step.

[0162] The presence of O-acetyl groups in purified, isolated, or activated serum-type 33F capsular polysaccharides or in serum-type 33F polysaccharide-carrier protein conjugates is expressed as the number of mM of the polysaccharide acetate / salt per mM or as the number of O-acetyl groups per polysaccharide repeating unit.

[0163] In a preferred embodiment, the purified polysaccharide from Streptococcus pneumoniae serotype 33F has at least 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4 or 1.6 μmol of acetate / salt per μmol of said serotype 33F capsular polysaccharide.

[0164] 1.3 Sugar conjugates of the present invention

[0165] The purified sugar is chemically activated to enable it to react with a carrier protein. Once activated, each capsular sugar is conjugated to the carrier protein to form a glycoconjugate. In one embodiment, each capsular sugar is conjugated to the same carrier protein. The chemical activation of the sugar and the subsequent conjugation to the carrier protein can be accomplished using the activation and conjugation methods disclosed herein.

[0166] 1.3.1 Glycoconjugates from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F

[0167] Capsular polysaccharides from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F are prepared using standard techniques known to those skilled in the art (see, for example, WO 2006 / 110381, WO 2008 / 118752, WO 2006 / 110352, and U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838).

[0168] In one embodiment, the polysaccharide is activated with 1-cyano-4-dimethylaminopyridine tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide is then coupled directly or via a spacer (connector) group to a carrier protein (preferably CRM). 197The amino group on the spacer. For example, the spacer may be cystamine or cysteine ​​to give a thiolated polysaccharide that can be coupled to the carrier via a thioether bond obtained by reacting with a maleimide-activated carrier protein (e.g., using N-[γ-maleimide butyloxy]succinimide ester (GMBS)) or by reacting with a haloacetylated carrier protein (e.g., using iodoacetylimide, N-succinimide bromoacetate (SBA; SIB), N-succinimide (4-iodoacetyl)aminobenzoate (SlAB), thiosuccinimide (4-iodoacetyl)aminobenzoate (sulfo-SIAB), N-succinimide iodoacetate (SIA), or succinimide 3-[bromoacetamide]propionate (SBAP)). Preferably, the cyanate ester (optionally prepared by CDAP chemistry) is coupled to hexamethylenediamine or adipic hydrazide (ADH), and the amino-derived sugar is conjugated to the carrier protein (e.g., CRM) via the carboxyl group on the protein carrier using carbodiimide (e.g., EDAC or EDC). 197 Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO 96 / 129094.

[0169] Other suitable techniques for conjugation include carbodiimide, hydrazide, active ester, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reacting the free hydroxyl group of the sugar with 1,1'-carbonyldiimidazole (CDI) (see Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by a reaction with the protein to form a urethane bond. This can involve reducing the anolyte to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a urethane intermediate, and coupling the CDI urethane intermediate to an amino group on the protein.

[0170] In a preferred embodiment, at least one capsular polysaccharide from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F is conjugated to a carrier protein via reductive amination (as described in U.S. Patent Application Publications Nos. 2006 / 0228380, 2007 / 0231340, 2007 / 0184071 and 2007 / 0184072, WO 2006 / 110381, WO 2008 / 079653, and WO 2008 / 143709). In a preferred embodiment, all capsular polysaccharides from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F are conjugated to the carrier protein via reductive amination.

[0171] Reductive amination involves two steps: (1) oxidation of the polysaccharide, and (2) reduction of the activated polysaccharide with a carrier protein to form a conjugate. Prior to oxidation, the polysaccharide is optionally hydrolyzed. Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be performed using acetic acid. The oxidation step may involve a reaction with periodate. For the purposes of this invention, the term "periodate" includes periodate and periodic acid; the term also includes metaperiodate (IO4). - ) and periodate (IO6) 5- And various salts of periodic acid (such as sodium periodate and potassium periodate).

[0172] In one embodiment, the capsular polysaccharides from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, or 23F are oxidized in the presence of metaperiodate, preferably in the presence of sodium periodate (NaIO4). In another embodiment, the capsular polysaccharides from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F are oxidized in the presence of orthoperiodate, preferably in the presence of periodic acid.

[0173] Following the oxidation step of the polysaccharide, the polysaccharide is considered activated and will be referred to below as "activated polysaccharide". The activated polysaccharide and the carrier protein may be lyophilized separately (isolated lyophilization) or together (co-lyophilization). In one embodiment, the activated polysaccharide and the carrier protein are co-lyophilized. In another embodiment, the activated polysaccharide and the carrier protein are lyophilized separately.

[0174] In one embodiment, the freeze-drying is carried out in the presence of non-reducing sugars, which may include sucrose, trehalose, raffinose, stachyose, melitriose, dextran, mannitol, lactitol, and isomaltitol.

[0175] The second step of the conjugation method is the reduction of the activated polysaccharide with the carrier protein to form a conjugate (so-called reductive amination), wherein a reducing agent is used. Suitable reducing agents include cyanoborohydrides, such as sodium cyanoborohydride, boranepyridine, or borohydride exchange resins. In one embodiment, the reducing agent is sodium cyanoborohydride.

[0176] In one embodiment, the reduction reaction is carried out in an aqueous solvent; in another embodiment, the reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. The DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.

[0177] At the end of the reduction reaction, unreacted aldehyde groups may remain in the conjugate, which can be capped (terminated) using a suitable capping agent. In one embodiment, this capping agent is sodium borohydride (NaBH4). After conjugation (reduction and optional capping), the glycoconjugate can be purified. The glycoconjugate can be purified by percolation and / or ion exchange chromatography and / or size exclusion chromatography. In one embodiment, the glycoconjugate is purified by percolation or ion exchange chromatography or size exclusion chromatography. In one embodiment, the glycoconjugate is sterile filtered.

[0178] In some embodiments, the glycoconjugate derived from Streptococcus pneumoniae serotype 9V and / or 18C comprises a sugar having the following degrees of O-acetylation: 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 75% to 100%, 80% to 100%, 90% to 100%, 50% to 90%, 60% to 90%, 70% to 90%, or 80% to 90%. In other embodiments, the degree of O-acetylation is ≥10%, ≥20%, ≥30%, ≥40%, ≥50%, ≥60%, ≥70%, ≥80%, or ≥90%, or about 100%.

[0179] In some embodiments, the glycoconjugates of Streptococcus pneumoniae serotypes 9V and / or 18C of the present invention are O-acetylated. In some embodiments, the glycoconjugates of Streptococcus pneumoniae serotype 9V are O-acetylated while the glycoconjugates of Streptococcus pneumoniae serotype 18C are de-O-acetylated.

[0180] 1.3.2 Glycoconjugates from Streptococcus pneumoniae serotype 22F

[0181] In one embodiment, the serum-type 22F glycoconjugate is obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridine tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled directly or via a spacer (connector) group to an amino group on a carrier protein. For example, the spacer can be cystamine or cysteine ​​to provide a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained by reacting with a maleimide-activated carrier protein (e.g., using GMBS) or with a halogenated acetylated carrier protein (e.g., using iodoacetylimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (optionally prepared by CDAP chemistry) is coupled with hexamethylenediamine or adipic dihydrazide (ADH), and the amino-derived sugar is chemically conjugated to the carrier protein via a carbodiimide (e.g., EDAC or EDC) via a carboxyl group on the protein carrier. Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO 96 / 129094.

[0182] Other suitable techniques use carbodiimide, hydrazide, active ester, norbornene, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. The conjugation may involve a carbonyl linker, which can be formed by reacting the free hydroxyl group of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by a reaction with the protein to form a carbamate bond. This can involve reducing the anolyte to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0183] In a preferred embodiment, the serotype 22F glycoconjugate of the present invention is prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functionality from the ortho-diol in the individual hexasaccharide unit, and (2) activation of the polysaccharide and carrier protein (e.g., CRM). 197 The reduction of ) to produce conjugates.

[0184] Preferably, prior to oxidation, the size of the serotype 22F polysaccharide is resized to the target molecular weight (MW) range. Advantageously, the size of the purified serotype 22F polysaccharide is reduced while retaining key structural features of the polysaccharide, such as the presence of an O-acetyl group. Preferably, the size of the purified serotype 22F polysaccharide is reduced by mechanical homogenization (see Section 1.2.7 above).

[0185] In one embodiment, serum-type polysaccharides are activated (oxidized) by a method comprising the following steps:

[0186] (a) Reaction of isolated serum-type 22F polysaccharide with an oxidizing agent;

[0187] (b) The oxidation reaction was quenched by adding a quencher, resulting in activated serum-type 22F polysaccharide.

[0188] In a preferred embodiment, the oxidant is periodate. For the purposes of this invention, the term "periodate" includes periodate and periodic acid; the term also includes metaperiodate (IO4). - ) and periodate (IO6) 5- And various salts of periodic acid (e.g., sodium periodate and potassium periodate). In a preferred embodiment, the oxidizing agent is sodium periodate. In a preferred embodiment, the periodate used for oxidizing serum-type 22F polysaccharide is metaperiodate. In a preferred embodiment, the periodate used for oxidizing serum-type 22F polysaccharide is sodium metaperiodate.

[0189] In one embodiment, the quencher is selected from ortho-diols, 1,2-amino alcohols, amino acids, glutathione, sulfites, bisulfites, dithionites, metabisulfites, thiosulfates, phosphites, hypophosphites, or phosphoric acid.

[0190] In one embodiment, the quencher is a 1,2-amino alcohol of formula (I):

[0191]

[0192] Where R 1 Selected from H, methyl, ethyl, propyl, or isopropyl.

[0193] In one embodiment, the quencher is selected from sodium and potassium salts of sulfurous acid, bisulfite, dithionite, metabisulfite, thiosulfate, phosphite, hypophosphite, or phosphoric acid.

[0194] In one embodiment, the quencher is an amino acid. In such embodiments, the amino acid may be selected from serine, threonine, cysteine, cystine, methionine, proline, hydroxyproline, tryptophan, tyrosine, and histidine.

[0195] In one embodiment, the quencher is a sulfite such as bisulfite, dithionite, metabisulfite, or thiosulfate.

[0196] In one embodiment, the quencher is a compound containing two ortho-hydroxyl groups (ortho-diols), i.e., the two hydroxyl groups are covalently linked to two adjacent carbon atoms.

[0197] Preferably, the quencher is a compound of formula (II):

[0198]

[0199] Where R 1 and R 2 They are independently selected from H, methyl, ethyl, propyl, or isopropyl.

[0200] In a preferred embodiment, the quencher is glycerol, ethylene glycol, 1,2-propanediol, 1,2-butanediol, or 2,3-butanediol, or ascorbic acid. In a preferred embodiment, the quencher is 2,3-butanediol.

[0201] In a preferred embodiment, the isolated serum-type 22F polysaccharide is activated by a method comprising the following steps:

[0202] (a) Reaction of serum type 22F polysaccharide with periodate;

[0203] (b) The oxidation reaction was quenched by the addition of 2,3-butanediol, resulting in activated serum-type 22F polysaccharide.

[0204] Following the oxidation step, the polysaccharide is considered activated and will be referred to below as "activated polysaccharide".

[0205] In a preferred embodiment, the activated serum-type 22F polysaccharide is purified. The activated serum-type 22F polysaccharide is purified using methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis, or ultrafiltration / permeation. For example, the activated 22F polysaccharide is purified by concentration and permeation using an ultrafiltration device.

[0206] In a preferred embodiment, the oxidation degree of the activated serum-type 22F polysaccharide is 2 to 30, 2 to 25, 2 to 20, 2 to 15, 2 to 10, 2 to 5, 5 to 30, 5 to 25, 5 to 20, 5 to 15, 5 to 10, 10 to 30, 10 to 25, 10 to 20, 10 to 15, 15 to 30, 15 to 25, 15 to 20, 20 to 30, or 20 to 25. In a preferred embodiment, the oxidation degree of the activated serum-type 22F polysaccharide is 2 to 10, 4 to 8, 4 to 6, 6 to 8, 6 to 12, 8 to 14, 9 to 11, 10 to 16, 12 to 16, 14 to 18, 16 to 20, 16 to 18, 18 to 22, or 18 to 20.

[0207] In a preferred embodiment, the activated serum-type 22F polysaccharide has the following molecular weights: 25 kDa to 1,000 kDa, 100 kDa to 1,000 kDa, 300 kDa to 800 kDa, 300 kDa to 700 kDa, 300 kDa to 600 kDa, 400 kDa to 1,000 kDa, 400 kDa to 800 kDa, 400 kDa to 700 kDa, or 400 kDa to 600 kDa. In one embodiment, the activated serum-type 22F polysaccharide has a molecular weight of 300 kDa to 800 kDa. In another embodiment, the activated serum-type 22F polysaccharide has a molecular weight of 400 kDa to 600 kDa. In a preferred embodiment, the activated serum-type 22F polysaccharide has a molecular weight of 400 kDa to 600 kDa and an oxidation degree between 10 and 25, 10 and 20, 12 and 20, or 14 and 18. In a preferred embodiment, the activated serum-type 22F polysaccharide has a molecular weight of 400 kDa to 600 kDa and an oxidation degree between 10 and 20.

[0208] In a preferred embodiment, the activated serotype 22F polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, or 0.7, or about 0.8 mM of acetate / salt per mM. In a preferred embodiment, the activated serotype 22F polysaccharide comprises at least 0.5, 0.6, or 0.7 mM of acetate / salt per mM. In a preferred embodiment, the activated serotype 22F polysaccharide comprises at least 0.6 mM of acetate / salt per mM. In a preferred embodiment, the activated serotype 22F polysaccharide comprises at least 0.7 mM of acetate / salt per mM.

[0209] In a preferred embodiment, the activated serum-type 22F polysaccharide has a molecular weight of 400 kDa to 800 kDa and contains at least 0.6 mM of acetate / salt per mM of serum-type 22F polysaccharide.

[0210] In a preferred embodiment, the activated serum-type 22F polysaccharide has a molecular weight of 400 kDa to 800 kDa, an oxidation degree of 12 to 20, and contains at least 0.6 mM of acetate / salt per mM of serum-type 22F polysaccharide.

[0211] The activated polysaccharide and / or the carrier protein may be lyophilized individually (isolated lyophilization) or together (co-lyophilization) (freeze-drying).

[0212] In one embodiment, the activated serum-type 22F polysaccharide is lyophilized, optionally in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melitriose, dextran, mannitol, lactitol, and isomaltitol. In a preferred embodiment, the sugar is sucrose. In one embodiment, the lyophilized activated polysaccharide is then mixed with a solution containing a carrier protein.

[0213] In another embodiment, the activated polysaccharide and the carrier protein are co-lyophilized. In such embodiments, the activated serotype 22F polysaccharide is mixed with the carrier protein and optionally lyophilized in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melitriose, dextran, mannitol, lactitol, and isomaltitol. In a preferred embodiment, the sugar is sucrose. The co-lyophilized polysaccharide and carrier protein can then be resuspended in solution and reacted with a reducing agent.

[0214] The second step of the conjugation method is the reduction of the activated polysaccharide with the carrier protein to form a conjugate (reductive amination), wherein a reducing agent is used.

[0215] The activated serum-type 22F polysaccharide can be conjugated to a carrier protein by a method including the following steps:

[0216] (c) Mix the activated serum-type 22F polysaccharide with the carrier protein; and

[0217] (d) The mixture of activated serum type 22F polysaccharide and carrier protein is reacted with a reducing agent to form a serum type 22F polysaccharide-carrier protein conjugate.

[0218] In one embodiment, the reduction reaction is carried out in an aqueous solvent; in another embodiment, the reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. The DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.

[0219] The activated serum-type 22F polysaccharide is conjugated to a protein carrier via reductive amination in dimethyl sulfoxide (DMSO), which is suitable for preserving the O-acetyl content of the polysaccharide, for example, by reductive amination in an aqueous phase, which can significantly reduce the O-acetylation level of the polysaccharide. Therefore, in a preferred embodiment, steps (c) and (d) are carried out in DMSO.

[0220] In one embodiment, the reducing agent is sodium cyanoborohydride, sodium triacetoxyborohydride, sodium borohydride, or zinc borohydride, wherein Bronsted or Lewis acid, aminoborane such as boranepyridine, 2-methylpyridineborane, 2,6-diborane-methanol, dimethylaminoborane, or t-BuMe are present. i PrN-BH3, benzylamine-BH3, or 5-ethyl-2-methylboranepyridine (PEMB). In a preferred embodiment, the reducing agent is sodium cyanoborohydride.

[0221] At the end of the reduction reaction, unreacted aldehyde groups may remain in the conjugate, which can be capped using a suitable capping agent. In one embodiment, this capping agent is sodium borohydride (NaBH4).

[0222] After the serum-type 22F polysaccharide is conjugated to the carrier protein, the conjugate can be purified (enriched in quantity) using a variety of techniques known to those skilled in the art. These techniques include dialysis, concentration / percolation, tangential flow filtration precipitation / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and deep filtration.

[0223] In some embodiments, the serum-type 22F glycoconjugate of the present invention comprises a sugar having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the sugar has a molecular weight of 50 kDa to 1,000 kDa. In other such embodiments, the sugar has a molecular weight of 70 kDa to 900 kDa. In other such embodiments, the sugar has a molecular weight of 100 kDa to 800 kDa. In other such embodiments, the sugar has a molecular weight of 200 kDa to 600 kDa. In other embodiments of this kind, the sugar has the following molecular weights: 100 kDa to 1,000 kDa; 100 kDa to 900 kDa; 100 kDa to 800 kDa; 100 kDa to 700 kDa; 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 150 kDa to 1,000 kDa; 150 kDa to 900 kDa ; 150kDa to 800kDa; 150kDa to 700kDa; 150kDa to 600kDa; 150kDa to 500kDa; 150kDa to 400kDa; 150kDa to 300kDa; 200kDa to 1,000kDa; 200kDa to 900kDa; 200kDa to 800kDa; 200kDa to 700kDa; 200kDa to 600kDa; 200kDa to 500kDa 0 kDa; 200 kDa to 400 kDa; 200 kDa to 300 kDa; 250 kDa to 1,000 kDa; 250 kDa to 900 kDa; 250 kDa to 800 kDa; 250 kDa to 700 kDa; 250 kDa to 600 kDa; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa to 350 kDa; 300 kDa to 1000 kDa; 300 kDa Da to 900 kDa; 300 kDa to 800 kDa; 300 kDa to 700 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; 400 kDa to 1,000 kDa; 400 kDa to 900 kDa; 400 kDa to 800 kDa; 400 kDa to 700 kDa; 400 kDa to 600 kDa; 500 kDa to 600 kDa. Any integer within any of the above ranges is considered an embodiment of this disclosure. In some such embodiments, the serotype 22F glycoconjugate is prepared using reductive amination.

[0224] In some embodiments, the serotype 22F glycoconjugate of the present invention has the following molecular weights: 400 kDa to 15,000 kDa; 500 kDa to 10,000 kDa; 2,000 kDa to 10,000 kDa; 3,000 kDa to 8,000 kDa; or 3,000 kDa to 5,000 kDa. In other embodiments, the serotype 22F glycoconjugate has a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 22F glycoconjugate has a molecular weight of 1,000 kDa to 8,000 kDa. In other embodiments, the serotype 22F glycoconjugate has a molecular weight of 2,000 kDa to 8,000 kDa or 3,000 kDa to 7,000 kDa.In another embodiment, the serotype 22F glycoconjugate of the present invention has the following molecular weights: 200 kDa to 20,000 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,500 kDa; 500 kDa a to 10,000 kDa; 500 kDa to 7,500 kDa; 500 kDa to 6,000 kDa; 500 kDa to 5,000 kDa; 500 kDa to 4,000 kDa; 500 kDa to 3,000 kDa; 500 kDa to 2,000 kDa; 500 kDa to 1,500 kDa; 500 kDa to 1,000 kDa; 750 kDa to 20,000 kDa; 750 kDa to 15,000 kDa; 750 kDa to 12,500 kDa; 750 kDa to 10,000 kDa Da; 750kDa to 7,500kDa; 750kDa to 6,000kDa; 750kDa to 5,000kDa; 750kDa to 4,000kDa; 750kDa to 3,000kDa; 750kDa to 2,000kDa; 750kDa to 1,500kDa; 1,000kDa to 15,000kDa; 1,000kDa to 12,500kDa; 1,000kDa to 10,000kDa; 1,000kDa to 7,500kDa; 1,000kDa to 6,000kDa Da; 1,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 2,500 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa.

[0225] In another embodiment, the serotype 22F glycoconjugate of the present invention has the following molecular weights: 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa.

[0226] In another embodiment, the serotype 22F glycoconjugate of the present invention has the following molecular weights: 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa; 5,000 kDa to 7,500 kDa; 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 12,500 kDa; 6,000 kDa to 10,000 kDa; or 6,000 kDa to 7,500 kDa.

[0227] The molecular weight of the glycoconjugate was measured using SEC-MALLS. Any integer within the above range is considered an embodiment of this disclosure.

[0228] In a preferred embodiment, the serotype 22F glycoconjugate of the present invention contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, or 0.7, or about 0.8 mM of acetate / salt per mM of serotype 22F polysaccharide. In a preferred embodiment, the glycoconjugate contains at least 0.5, 0.6, or 0.7 mM of acetate / salt per mM of serotype 22F polysaccharide. In a preferred embodiment, the glycoconjugate contains at least 0.6 mM of acetate / salt per mM of serotype 22F polysaccharide. In a preferred embodiment, the glycoconjugate contains at least 0.7 mM of acetate / salt per mM of serotype 22F polysaccharide.

[0229] In a preferred embodiment, the ratio of acetate / salt mM per mM of serum-type 22F polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum-type 22F polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred embodiment, the ratio of acetate / salt mM per mM of serum-type 22F polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum-type 22F polysaccharide in the isolated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of acetate / salt mM per mM of serum-type 22F polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum-type 22F polysaccharide in the isolated polysaccharide is at least 0.9.

[0230] In a preferred embodiment, the ratio of acetate / salt mM per mM of serum-type 22F polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum-type 22F polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred embodiment, the ratio of acetate / salt mM per mM of serum-type 22F polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum-type 22F polysaccharide in the activated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of acetate / salt mM per mM of serum-type 22F polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum-type 22F polysaccharide in the activated polysaccharide is at least 0.9.

[0231] Another way to characterize the serotype 22F glycoconjugate of the present invention is by means of a carrier protein (e.g., CRM). 197 The number of lysine residues conjugated with the sugar in the protein can be characterized as the range of conjugated lysine residues (degree of conjugation). Evidence of lysine modification of the carrier protein (due to covalent bonds with the polysaccharide) can be obtained by amino acid analysis using conventional methods known to those skilled in the art. The number of lysine residues recovered due to conjugation is related to the CRM used to generate the conjugated material. 197The protein starting material is reduced compared to the standard. In a preferred embodiment, the degree of conjugation of the glycoconjugate of serotype 22F of the present invention is 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In one embodiment, the degree of conjugation of the glycoconjugate of serotype 22F of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In a preferred embodiment, the degree of conjugation of the glycoconjugate of serotype 22F of the present invention is 4 to 7. In some such embodiments, the carrier protein is CRM. 197 .

[0232] The serotype 22F glycoconjugate of the present invention can also be characterized by the ratio (w / w) of sugar to carrier protein. In some embodiments, the ratio (w / w) of serotype 22F polysaccharide to carrier protein in the glycoconjugate is 0.5 to 3.0 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.0). In other embodiments, the sugar-to-carrier protein ratio (w / w) is 0.5 to 2.0, 0.5 to 1.5, 0.8 to 1.2, 0.5 to 1.0, 1.0 to 1.5, or 1.0 to 2.0. In yet another embodiment, the sugar-to-carrier protein ratio (w / w) is 0.8 to 1.2. In a preferred embodiment, the ratio of serum-type 22F capsular polysaccharide to carrier protein in the conjugate is 0.9 to 1.1. In some such embodiments, the carrier protein is CRM. 197 .

[0233] The serum-type 22F glycoconjugate and immunogenic composition of the present invention may contain free sugars that are not covalently conjugated to the carrier protein but are present in the glycoconjugate composition. The free sugars may be non-covalently associated with the glycoconjugate (i.e., non-covalently bound to, adsorbed to, or embedded in the glycoconjugate).

[0234] In a preferred embodiment, the serotype 22F glycoconjugate comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 15% free serotype 22F polysaccharides relative to the total amount of serotype 22F polysaccharides. In a preferred embodiment, the serotype 22F glycoconjugate comprises less than about 40% free serotype 22F polysaccharides relative to the total amount of serotype 22F polysaccharides. In a preferred embodiment, the serotype 22F glycoconjugate comprises less than about 25% free serotype 22F polysaccharides relative to the total amount of serotype 22F polysaccharides. In a preferred embodiment, the serotype 22F glycoconjugate comprises less than about 20% free serotype 22F polysaccharides relative to the total amount of serotype 22F polysaccharides. In a preferred embodiment, the serotype 22F glycoconjugate comprises less than about 15% free serotype 22F polysaccharides relative to the total amount of serotype 22F polysaccharides.

[0235] Serum-type 22F glycoconjugates can also be classified according to their molecular size distribution (K). d Characterization was performed using size exclusion chromatography (SEC). Size exclusion chromatography media (CL-4B) was used to determine the relative molecular weight distribution of the conjugates. SEC was used in a gravity-fed column to characterize the molecular size distribution of the conjugates. Large molecules elute from the pores of the media much faster than small molecules. A fraction collector was used to collect the column elute. The fractions were analyzed colorimetrically using a sugar assay. To determine K... d The column was calibrated to establish the fraction with complete molecular expulsion (V0), (K d =0), and the level representing the maximum retention (V) i ), (K d =1). The grade (V) of the specified sample attribute is achieved. e ) through expression K d =(V e -V0) / (V i -V0) and K d Related.

[0236] In a preferred embodiment, at least 30% of the serum-type 22F glycoconjugates have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40% of the glycoconjugates have a Kc of less than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serum-type 22F glycoconjugate has a Kc of less than or equal to 0.3 in a CL-4B column. dIn a preferred embodiment, at least 60% of the serum-type 22F glycoconjugates have a Kc of less than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, 50% to 80% of the serum-type 22F glycoconjugates have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 65% to 80% of the serum-type 22F glycoconjugates have a Kc of less than or equal to 0.3 in a CL-4B column. d .

[0237] 1.3.3 Glycoconjugates from Streptococcus pneumoniae serotype 33F

[0238] In one embodiment, the serum-type 33F glycoconjugate is obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridine tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled directly or via a spacer (connector) group to an amino group on a carrier protein. For example, the spacer can be cystamine or cysteine ​​to provide a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained by reacting with a maleimide-activated carrier protein (e.g., using GMBS) or with a halogenated acetylated carrier protein (e.g., using iodoacetylimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (optionally prepared by CDAP chemistry) is coupled with hexamethylenediamine or adipic dihydrazide (ADH), and the amino-derived sugar is chemically conjugated to the carrier protein via a carbodiimide (e.g., EDAC or EDC) via a carboxyl group on the protein carrier. Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO96 / 129094.

[0239] Other suitable techniques use carbodiimide, hydrazide, active ester, norbornene, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. The conjugation may involve a carbonyl linker, which can be formed by reacting the free hydroxyl group of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by a reaction with the protein to form a carbamate bond. This can involve reducing the anolyte to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0240] In some embodiments, the serotype 33F glycoconjugate of the present invention is prepared using reductive amination. In this embodiment, the serotype 33F glycoconjugate of the present invention can be prepared by reductive amination in an aqueous phase (RAC / water). Reductive amination in an aqueous phase has been successfully used to produce pneumococcal conjugate vaccines (see, for example, WO 2006 / 110381). However, it is preferable that, when using reductive amination, the serotype 33F glycoconjugate is prepared by reductive amination in DMSO (RAC / DMSO). Considering the challenges associated with maintaining the functionality of the O-acetyl group when using the RAC / water method, reductive amination in DMSO is preferred. RAC / DMSO has been successfully used to produce pneumococcal conjugate vaccines (see, for example, WO 2006 / 110381).

[0241] In a preferred embodiment, the serum-type 33F glycoconjugate of the present invention is prepared by eTEC conjugation (hereinafter referred to as "serum-type 33F eTEC-linked glycoconjugate"), as described in Examples 1, 2, and 3 and WO 2014 / 027302. The 33F glycoconjugate comprises a sugar covalently conjugated to a carrier protein via one or more eTEC spacers, wherein the sugar is covalently conjugated to the eTEC spacers via carbamate bonds, and wherein the carrier protein is covalently conjugated to the eTEC spacers via amide bonds. The eTEC-linked glycoconjugate of the present invention can be represented by general formula (III):

[0242]

[0243] The atoms that make up the eTEC spacers are contained within the middle boxes.

[0244] The eTEC spacer comprises seven linear atoms (i.e., –C(O)NH(CH2)2SCH2C(O)-) and provides stable thioether and amide bonds between the sugar and the carrier protein. The synthesis of the eTEC-linked sugar conjugate involves the reaction of the activated hydroxyl group of the sugar with the amino group of a thioalkylamine reagent (e.g., cystamine or cysteine ​​amine or its salt), causing the sugar to form a carbamate bond to provide a thiolated sugar. One or more free thiol groups are generated through a reaction with a reducing agent to provide an activated thiolated sugar. The free thiol groups of the activated thiolated sugar react with an activated carrier protein (having one or more α-haloacetamide groups on amine-containing residues) to generate thioether bonds to form a conjugate, wherein the carrier protein is attached to the eTEC spacer via amide bonds.

[0245] In the serotype 33F glycoconjugate of the present invention, the sugar may be a polysaccharide or an oligosaccharide. The carrier protein may be selected from any suitable carrier described herein or known to those skilled in the art. In common embodiments, the sugar is a polysaccharide. In some such embodiments, the carrier protein is CRM. 197 In some such embodiments, the eTEC-linked glycoconjugate comprises Streptococcus pneumoniae serotype 33F capsular polysaccharide.

[0246] In a particularly preferred embodiment, the eTEC-linked glycoconjugate comprises Pn-33F capsular polysaccharide, which is covalently conjugated to CRM via an eTEC spacer. 197 (Serogenous 33F eTEC-linked glycoconjugate).

[0247] In some embodiments, the glycoconjugate of serotype 33F of the present invention comprises a sugar having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the sugar has a molecular weight of 50 kDa to 2,000 kDa. In still other such embodiments, the sugar has a molecular weight of 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,100 kDa; 100 kDa to 1,250 kDa; 100 kDa to 1,250 kDa; 5 ... 250kDa; 100kDa to 1,000kDa; 100kDa to 750kDa; 100kDa to 500kDa; 200kDa to 2,000kDa; 200kDa to 1,750kDa; 200kDa to 1,500kDa; 200kDa to 1,250kDa; 200kDa to 1,000kDa; 200kDa to 750kDa; or 200kDa to 500kDa. Any integer within any of the above ranges is considered an embodiment of this disclosure.

[0248] In some embodiments, the serum-type 33F glycoconjugate of the present invention has a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serum-type 33F glycoconjugate has a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serum-type 33F glycoconjugate has a molecular weight of 200 kDa to 10,000 kDa. In other embodiments, the serum-type 33F glycoconjugate has a molecular weight of 1,000 kDa to 3,000 kDa.

[0249] In another embodiment, the serum-type 33F glycoconjugate of the present invention has the following molecular weights: 200 kDa to 20,000 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,500 kDa; 500 kDa to 10,000 kDa; 500 kDa to 7,500 kDa; 500 kDa to 6,000 kDa. ; 500kDa to 5,000kDa; 500kDa to 4,000kDa; 500kDa to 3,000kDa; 500kDa to 2,000kDa; 500kDa to 1,500kDa; 500kDa to 1,000kDa; 750kDa to 20,000kDa; 750kDa to 15,000kDa; 750kDa to 12,500kDa; 750kDa to 10,000kDa; 750kDa to 7,500kDa; 750kDa to 6,000kDa; 750kDa to 5,000kDa; 750kDa to 4,000kDa; 750kDa to 3,000kDa; 7 50kDa to 2,000kDa; 750kDa to 1,500kDa; 1,000kDa to 15,000kDa; 1,000kDa to 12,500kDa; 1,000kDa to 10,000kDa; 1,000kDa to 7,500kDa; 1,000kDa to 6,000kDa; 1,000kDa to 5,000kDa; 1,000kDa to 4,000kDa; 1,000kDa to 2,500kDa; 2,000kDa to 15,000kDa; 2,000kDa to 12,500kDa; 2,000kDa to 10,000kDa; 2,000kDa to 7 500kDa; 2,000kDa to 6,000kDa; 2,000kDa to 5,000kDa; 2,000kDa to 4,000kDa; 2,000kDa to 3,000kDa; 3,000kDa to 20,000kDa; 3,000kDa to 15,000kDa; 3,000kDa to 12,500kDa; 3,000kDa to 10,000kDa; 3,000kDa to 9,000kDa; 3,000kDa to 8,000kDa; 3,000kDa to 7,000kDa; 3,000kDa to 6,000kDa; 3,000kDa to 5,000kDa;Or 3,000 kDa to 4,000 kDa. Any integer within the above range is considered an embodiment of this disclosure.

[0250] Another way to characterize the serotype 33F glycoconjugate of the present invention is by means of a carrier protein (e.g., CRM). 197 The number of lysine residues conjugated with sugars in a sugar can be characterized as the range of conjugated lysine residues (degree of conjugation).

[0251] In a preferred embodiment, the degree of conjugation of the glycoconjugate of serotype 33F of the present invention is 2 to 20, 4 to 16, 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In one embodiment, the degree of conjugation of the glycoconjugate of serotype 33F of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20. In a preferred embodiment, the degree of conjugation of the glycoconjugate of serotype 33F of the present invention is 4 to 16. In some such embodiments, the carrier protein is CRM. 197 .

[0252] In a preferred embodiment, the carrier protein comprises CRM. 197 It contains 39 lysine residues. In some such embodiments, the CRM 197 The 39 lysine residues covalently linked to the sugar can contain 4 to 16 lysine residues. Another way to express this parameter is approximately 10% to approximately 41% CRM. 197 Lysine is covalently linked to the sugar. In another such embodiment, the CRM... 197 The 39 lysine residues covalently linked to the sugar can contain 2 to 20 lysine residues. Another way to express this parameter is approximately 5% to approximately 50% CRM. 197 Lysine is covalently linked to the sugar. In some embodiments, the CRM 197 The 39 lysine residues covalently linked to the sugar may contain approximately 4, approximately 5, approximately 6, approximately 7, approximately 8, approximately 9, approximately 10, approximately 11, approximately 12, approximately 13, approximately 14, approximately 15, or approximately 16 lysine residues.

[0253] In common embodiments, the carrier protein is covalently conjugated to the eTEC spacer via an amide bond of one or more ε-amino groups of lysine residues on the carrier protein. In some such embodiments, the carrier protein comprises 2 to 20 lysine residues covalently conjugated to the sugar. In other such embodiments, the carrier protein comprises 4 to 16 lysine residues covalently conjugated to the sugar.

[0254] The serotype 33F glycoconjugate of the present invention can also be characterized by the sugar-to-carrier protein ratio (w / w). In some embodiments, the sugar-to-carrier protein ratio (w / w) is 0.2 to 4.0 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In other embodiments, the sugar-to-carrier protein ratio (w / w) is 1.0 to 2.5. In still other embodiments, the sugar-to-carrier protein ratio (w / w) is 0.4 to 1.7. In some such embodiments, the carrier protein is CRM. 197 .

[0255] The frequency of lysine residues attached to the carrier protein by the glycan chain is another parameter characterizing the serum-type 33F glycoconjugate of the present invention. For example, in some embodiments, at least one covalent bond between the carrier protein and the polysaccharide occurs for every four sugar repeat units of the polysaccharide. In another embodiment, at least one covalent bond between the carrier protein and the polysaccharide occurs for every ten sugar repeat units of the polysaccharide. In yet another embodiment, at least one covalent bond between the carrier protein and the polysaccharide occurs for every 15 sugar repeat units of the polysaccharide. In still another embodiment, at least one covalent bond between the carrier protein and the polysaccharide occurs for every 25 sugar repeat units of the polysaccharide.

[0256] In a common implementation, the carrier protein is CRM. 197 Furthermore, at least one CRM occurs every 4, 10, 15, or 25 sugar repeating units of the polysaccharide. 197 The covalent bonds between the polysaccharide and the eTEC spacer.

[0257] In other embodiments, the conjugate contains at least one covalent bond between the carrier protein and the sugar for every 5 to 10 sugar repeat units; every 2 to 7 sugar repeat units contain at least one covalent bond between the carrier protein and the sugar; every 3 to 8 sugar repeat units contain at least one covalent bond between the carrier protein and the sugar; every 4 to 9 sugar repeat units contain at least one covalent bond between the carrier protein and the sugar; every 6 to 11 sugar repeat units contain at least one covalent bond between the carrier protein and the sugar; every 7 to 12 sugar repeat units contain at least one covalent bond between the carrier protein and the sugar; every 8 to 13 sugar repeat units contain at least one covalent bond between the carrier protein and the sugar; every 9 to 14 sugar repeat units contain at least one covalent bond between the carrier protein and the sugar; every 10 to 15 sugar repeat units contain at least one covalent bond between the carrier protein and the sugar; every 2 to 6 sugar repeat units contain at least one covalent bond between the carrier protein and the sugar. There are at least one covalent bond between the carrier protein and the sugar in every 3 to 7 sugar repeat units; in every 4 to 8 sugar repeat units; in every 6 to 10 sugar repeat units; in every 7 to 11 sugar repeat units; in every 8 to 12 sugar repeat units; in every 9 to 13 sugar repeat units; in every 10 to 14 sugar repeat units; in every 10 to 20 sugar repeat units; in every 4 to 25 sugar repeat units; or in every 2 to 25 sugar repeat units. In a common embodiment, the carrier protein is CRM. 197 .

[0258] In another embodiment, at least one bond between a carrier protein and a sugar occurs for every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 sugar repeat units of the polysaccharide. In one embodiment, the carrier protein is CRM. 197 Any integer within the range described above is considered an embodiment of this disclosure.

[0259] An important consideration during conjugation is the development of conditions that allow for the retention of potentially sensitive non-sugar substituted functional groups in each component, such as O-acyl groups, phosphate esters, or glycerophosphate side chains (which can form partial sugar epitopes).

[0260] In one embodiment, the serotype 33F glycoconjugate of the present invention comprises a sugar having a degree of O-acetylation of 10% to 100%. In some such embodiments, the sugar has a degree of O-acetylation of 50% to 100%. In other such embodiments, the sugar has a degree of O-acetylation of 75% to 100%. In still other embodiments, the sugar has a degree of O-acetylation greater than or equal to 70% (≥70%).

[0261] In a preferred embodiment, the serotype 33F glycoconjugate of the present invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM of acetate / salt per mM serotype 33F capsular polysaccharide. In a preferred embodiment, the glycoconjugate comprises at least 0.5, 0.6, or 0.7 mM of acetate / salt per mM serotype 33F capsular polysaccharide. In a preferred embodiment, the glycoconjugate comprises at least 0.6 mM of acetate / salt per mM serotype 33F capsular polysaccharide. In a preferred embodiment, the glycoconjugate comprises at least 0.7 mM of acetate / salt per mM serotype 33F capsular polysaccharide. In a preferred embodiment, the presence of an O-acetyl group is determined by ion HPLC analysis.

[0262] In a preferred embodiment, the ratio of acetate / salt mM per mM of serum-type 33F polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum-type 33F polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred embodiment, the ratio of acetate / salt mM per mM of serum-type 33F polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum-type 33F polysaccharide in the isolated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of acetate / salt mM per mM of serum-type 33F polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum-type 33F polysaccharide in the isolated polysaccharide is at least 0.9.

[0263] In a preferred embodiment, the ratio of acetate / salt mM per mM of serum-type 33F polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum-type 33F polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred embodiment, the ratio of acetate / salt mM per mM of serum-type 33F polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum-type 33F polysaccharide in the activated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of acetate / salt mM per mM of serum-type 33F polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum-type 33F polysaccharide in the activated polysaccharide is at least 0.9.

[0264] The serum-type 33F glycoconjugate and immunogenic composition of the present invention may contain free sugars that are not covalently conjugated to the carrier protein but are present in the glycoconjugate composition. The free sugars may be non-covalently associated with the glycoconjugate (i.e., non-covalently bound to, adsorbed to, or embedded in the glycoconjugate).

[0265] In some embodiments, the serotype 33F glycoconjugate of the present invention comprises less than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% free serotype 33F polysaccharides relative to the total amount of serotype 33F polysaccharides. Preferably, the serotype 33F glycoconjugate comprises less than 15% free sugar, more preferably less than 10% free sugar, and even more preferably less than 5% free sugar. In a preferred embodiment, the serotype 33F glycoconjugate comprises less than about 25% free serotype 33F polysaccharides relative to the total amount of serotype 33F polysaccharides. In a preferred embodiment, the serotype 33F glycoconjugate comprises less than about 20% free serotype 33F polysaccharides relative to the total amount of serotype 33F polysaccharides. In a preferred embodiment, the serotype 33F glycoconjugate comprises less than about 15% free serotype 33F polysaccharides relative to the total amount of serotype 33F polysaccharides.

[0266] In some preferred embodiments, the present invention provides a serum-type 33F glycoconjugate having one or more of the following characteristics (alone or in combination): the polysaccharide has a molecular weight of 50 kDa to 2,000 kDa; the glycoconjugate has a molecular weight of 500 kDa to 10,000 kDa; the carrier protein comprises 2 to 20 lysine residues covalently linked to the sugar; the sugar-to-carrier protein ratio (w / w) is 0.2 to 4.0; each 4, 10, 15, or 25 sugar repeat units of the glycoconjugate polysaccharide contains at least one covalent bond between the carrier protein and the polysaccharide; the sugar has a degree of O-acetylation of 75% to 100%; the conjugate contains less than about 15% free polysaccharide relative to the total polysaccharide; and the carrier protein is CRM. 197 .

[0267] The serum-type 33F glycoconjugate can also be classified according to its molecular size distribution (K). d Characterization was performed using size exclusion chromatography media (CL-4B). Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular weight distribution of conjugates, as described above.

[0268] In one embodiment, at least 15% of the serotype 33F glycoconjugate of the present invention has a Kc of less than or equal to 0.3 in a CL-4B column. d In one embodiment, at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, or 90% of the serotype 33F glycoconjugate of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d .

[0269] In a preferred embodiment, at least 35% of the serotype 33F glycoconjugate of the present invention has a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 33F glycoconjugate of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 33F glycoconjugate of the present invention has a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 70% of the serotype 33F glycoconjugates of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d .

[0270] In a preferred embodiment, 40% to 90% of the serum-type 33F glycoconjugates have a Kc of less than or equal to 0.3 in a CL-4B column. dIn a preferred embodiment, 50% to 90% of the serum-type 33F glycoconjugates have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 65% to 80% of the serum-type 33F glycoconjugates have a Kc of less than or equal to 0.3 in a CL-4B column. d .

[0271] 1.3.4 Glycoconjugates from Streptococcus pneumoniae serotype 15B

[0272] In one embodiment, the serum-type 15B glycoconjugate is obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridine tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled directly or via a spacer (connector) group to an amino group on a carrier protein. For example, the spacer can be cystamine or cysteine ​​to provide a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained by reacting with a maleimide-activated carrier protein (e.g., using GMBS) or with a halogenated acetylated carrier protein (e.g., using iodoacetylimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (optionally prepared by CDAP chemistry) is coupled with hexamethylenediamine or adipic dihydrazide (ADH), and the amino-derived sugar is chemically conjugated to the carrier protein via a carbodiimide (e.g., EDAC or EDC) via a carboxyl group on the protein carrier. Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO96 / 129094.

[0273] Other suitable techniques use carbodiimide, hydrazide, active ester, norbornene, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. The conjugation may involve a carbonyl linker, which can be formed by reacting the free hydroxyl group of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by a reaction with the protein to form a carbamate bond. This can involve reducing the anolyte to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0274] In a preferred embodiment, the serotype 15B glycoconjugate of the present invention is prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functionality from the ortho-diol in the individual hexasaccharide unit, and (2) reduction of the activated polysaccharide with the carrier protein to form the conjugate.

[0275] Preferably, prior to oxidation, the size of the serum type 15B polysaccharide is resized to the target molecular weight (MW) range. Advantageously, the size of the purified serum type 15B polysaccharide is reduced while retaining key structural features of the polysaccharide, such as the presence of an O-acetyl group. Preferably, the size of the purified serum type 15B polysaccharide is reduced by mechanical homogenization (see Section 1.2.6 above).

[0276] The oxidation step may involve a reaction with periodate. For the purposes of this invention, the term "periodate" includes both periodate and periodic acid; the term also includes metaperiodate (IO4). - ) and periodate (IO6) 5- And various salts of periodic acid (e.g., sodium periodate and potassium periodate). In a preferred embodiment, the periodate used for oxidizing serum type 15B capsular polysaccharide is metaperiodate. In a preferred embodiment, the periodate used for oxidizing serum type 15B capsular polysaccharide is sodium metaperiodate.

[0277] In a preferred embodiment, the polysaccharide reacts with an oxidant in amounts of 0.01 to 10.0, 0.05 to 5.0, 0.1 to 1.0, 0.5 to 1.0, 0.7 to 0.8, 0.05 to 0.5, or 0.1 to 0.3 molar equivalents. In a preferred embodiment, the polysaccharide reacts with an oxidant in amounts of approximately 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95 molar equivalents. In a preferred embodiment, the polysaccharide reacts with an oxidant in amounts of approximately 0.15 molar equivalents. In a preferred embodiment, the polysaccharide reacts with an oxidant in amounts of approximately 0.25 molar equivalents. In a preferred embodiment, the polysaccharide reacts with an oxidant in amounts of approximately 0.5 molar equivalents. In a preferred embodiment, the polysaccharide reacts with approximately 0.6 molar equivalents of an oxidizing agent. In a preferred embodiment, the polysaccharide reacts with approximately 0.7 molar equivalents of an oxidizing agent.

[0278] In a preferred embodiment, the reaction duration is 1 to 50 hours, 10 to 30 hours, 15 to 20 hours, 15 to 17 hours, or about 16 hours.

[0279] In a preferred embodiment, the reaction temperature is maintained between 15°C and 45°C, between 15°C and 30°C, and between 20°C and 25°C. In a preferred embodiment, the reaction temperature is maintained at approximately 23°C.

[0280] In a preferred embodiment, the oxidation reaction is carried out in a buffer selected from sodium phosphate, potassium phosphate, 2-(N-morpholine)ethanesulfonic acid (MES), or Bis-Tris. In a preferred embodiment, the buffer is potassium phosphate.

[0281] In a preferred embodiment, the buffer solution has a concentration of 1 mM to 500 mM, 1 mM to 300 mM, or 50 mM to 200 mM. In a preferred embodiment, the buffer solution has a concentration of approximately 100 mM.

[0282] In a preferred embodiment, the oxidation reaction is carried out at a pH of 4.0 to 8.0, 5.0 to 7.0, or 5.5 to 6.5. In a preferred embodiment, the pH is approximately 6.0.

[0283] In a preferred embodiment, the activated serum type 15B capsular polysaccharide is obtained by reacting 0.5 mg / mL to 5 mg / mL of isolated serum type 15B capsular polysaccharide with 0.2-0.3 molar equivalents of periodate at a temperature of 20°C to 25°C.

[0284] In a preferred embodiment, the activated serum-type 15B capsular polysaccharide is purified. The activated serum-type 15B capsular polysaccharide is purified according to methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis, or ultrafiltration / permeation. For example, the activated capsular polysaccharide is purified by concentration and permeation using an ultrafiltration device.

[0285] In a preferred embodiment, the degree of oxidation of the activated serotype 15B capsular polysaccharide is 2 to 20, 2 to 15, 2 to 10, 2 to 5, 5 to 20, 5 to 15, 5 to 10, 10 to 20, 10 to 15, or 15 to 20. In a preferred embodiment, the degree of oxidation of the activated serotype 15B capsular polysaccharide is 2 to 10, 4 to 8, 4 to 6, 6 to 8, 6 to 12, 8 to 12, 9 to 11, 10 to 16, 12 to 16, 14 to 18, 16 to 20, 16 to 18, or 18 to 20.

[0286] In a preferred embodiment, the activated serum-type 15B capsular polysaccharide has the following molecular weights: 5 kDa to 500 kDa, 50 kDa to 500 kDa, 50 kDa to 450 kDa, 100 kDa to 400 kDa, and 100 kDa to 350 kDa. In a preferred embodiment, the activated serum-type 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa. In a preferred embodiment, the activated serum-type 15B capsular polysaccharide has a molecular weight of 100 kDa to 300 kDa. In a preferred embodiment, the activated serum-type 15B capsular polysaccharide has a molecular weight of 100 kDa to 250 kDa.

[0287] In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM of acetate / salt per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.5, 0.6, or 0.7 mM of acetate / salt per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.6 mM of acetate / salt per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.7 mM of acetate / salt per mM of the serotype 15B capsular polysaccharide.

[0288] In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM of glycerol per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.5, 0.6, or 0.7 mM of glycerol per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.6 mM of glycerol per mM of the serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.7 mM of glycerol per mM of the serotype 15B capsular polysaccharide.

[0289] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 250 kDa such that each mM of the serotype 15B capsular polysaccharide contains at least 0.6 mM of acetate / salt.

[0290] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 250 kDa such that each mM of the serotype 15B capsular polysaccharide contains at least 0.6 mM of glycerol.

[0291] In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate / salt per mM of the serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of the serotype 15B capsular polysaccharide.

[0292] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 250 kDa such that each mM of the serotype 15B capsular polysaccharide contains at least 0.6 mM of acetate / salt and at least 0.6 mM of glycerol.

[0293] In one embodiment, the activated serum-type 15B capsular polysaccharide is lyophilized, optionally in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melitriose, dextran, mannitol, lactitol, and isomaltitol. In a preferred embodiment, the sugar is sucrose. The lyophilized activated capsular polysaccharide is then mixed with a solution containing a carrier protein.

[0294] In another embodiment, the activated serum-type 15B capsular polysaccharide is mixed with a carrier protein and optionally lyophilized in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melitriose, dextran, mannitol, lactitol, and isomaltitol. In a preferred embodiment, the sugar is sucrose. The co-lyophilized polysaccharide and carrier protein can then be resuspended in solution and reacted with a reducing agent.

[0295] The activated serum-type 15B capsular polysaccharide can be conjugated to a carrier protein via a method comprising the following steps:

[0296] (a) The activated serum-type 15B capsular polysaccharide was mixed with the carrier protein, and

[0297] (b) The mixture of activated serum type 15B capsular polysaccharide and carrier protein is reacted with a reducing agent to form a serum type 15B capsular polysaccharide-carrier protein conjugate.

[0298] The activated serum-type 15B capsular polysaccharide is conjugated to a protein carrier via reductive amination in dimethyl sulfoxide (DMSO), which is suitable for preserving the O-acetyl content of the polysaccharide, for example, by reductive amination in an aqueous phase that significantly reduces the O-acetylation level of the polysaccharide. In a preferred embodiment, steps (a) and (b) are performed in DMSO.

[0299] In a preferred embodiment, step (a) includes dissolving the lyophilized serum type 15B capsular polysaccharide in a solution containing a carrier protein and DMSO. In a preferred embodiment, step (a) includes dissolving the co-lyophilized serum type 15B capsular polysaccharide and carrier protein in DMSO.

[0300] When steps (a) and (b) are performed in an aqueous solution, steps (a) and (b) are performed in a buffer solution, preferably selected from PBS, MES, HEPES, Bistris, ADA, PIPES, MOPSO, BES, MOPS, DIPSO, MOBS, HEPPSO, POPSO, TEA, EPPS, Bicine, or HEPB, at a pH of 6.0 to 8.5, 7.0 to 8.0, or 7.0 to 7.5. In a preferred embodiment, the buffer solution is PBS. In a preferred embodiment, the pH is approximately 7.3.

[0301] In a preferred embodiment, the concentration of the activated serotype 15B capsular polysaccharide in step (b) is from 0.1 mg / mL to 10 mg / mL, from 0.5 mg / mL to 5 mg / mL, or from 0.5 mg / mL to 2 mg / mL. In a preferred embodiment, the concentration of the activated serotype 15B capsular polysaccharide in step (b) is approximately 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 mg / mL.

[0302] In a preferred embodiment, the initial input ratio (weight to weight) of activated serum type 15B capsular polysaccharide to carrier protein is 5:1 to 0.1:1, 2:1 to 0.1:1, 2:1 to 1:1, 1.5:1 to 1:1, 0.1:1 to 1:1, 0.3:1 to 1:1, or 0.6:1 to 1:1.

[0303] In a preferred embodiment, the initial input ratio of the activated serotype 15B capsular polysaccharide to the carrier protein is approximately 0.6:1 to 1:1. In another preferred embodiment, the initial input ratio of the activated serotype 15B capsular polysaccharide to the carrier protein is approximately 0.6:1 to 1.5:1. This initial input ratio is particularly suitable for obtaining low levels of free polysaccharides in glycoconjugates.

[0304] In a preferred embodiment, the initial input ratio of the activated serum-type 15B capsular polysaccharide to the carrier protein is approximately 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, or 2:1.

[0305] In one embodiment, the reducing agent is sodium cyanoborohydride, sodium triacetoxyborohydride, sodium borohydride, or zinc borohydride, wherein a Bronsted or Lewis acid, an aminoborane such as boranepyridine, 2-methylpyridineborane, 2,6-diborane-methanol, dimethylaminoborane, t-BuMeiPrN-BH3, benzylamine-BH3, or 5-ethyl-2-methylboranepyridine (PEMB) is present. In a preferred embodiment, the reducing agent is sodium cyanoborohydride. In a preferred embodiment, the reducing agent is sodium 2-methylpyridineborane.

[0306] In a preferred embodiment, the amount of reducing agent used in step (b) is approximately 0.1 to 10.0 molar equivalents, 0.5 to 5.0 molar equivalents, or 1.0 to 2.0 molar equivalents. In a preferred embodiment, the amount of reducing agent used in step (b) is approximately 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2.0 molar equivalents.

[0307] In a preferred embodiment, the duration of step (b) is 1 to 60 hours, 10 to 50 hours, 40 to 50 hours, or 42 to 46 hours. In a preferred embodiment, the duration of step (b) is approximately 44 hours.

[0308] In a preferred embodiment, the reaction temperature in step (b) is maintained between 10°C and 40°C, 15°C and 30°C, or 20°C and 26°C. In a preferred embodiment, the reaction temperature in step (b) is maintained at approximately 23°C.

[0309] In a preferred embodiment, the method for preparing a glycoconjugate comprising a Streptococcus pneumoniae serotype 15B capsular polysaccharide covalently linked to a carrier protein further includes the step of capping unreacted aldehydes by adding NaBH4 (step (c)).

[0310] In a preferred embodiment, the amount of NaBH4 used in step (c) is 0.1 to 10 molar equivalents, 0.5 to 5.0 molar equivalents, or 1.0 to 3.0 molar equivalents. In a preferred embodiment, the amount of NaBH4 used in step (c) is approximately 2 molar equivalents.

[0311] In a preferred embodiment, the duration of step (c) is 0.1 hours to 10 hours, 0.5 hours to 5 hours, or 2 hours to 4 hours. In a preferred embodiment, the duration of step (c) is approximately 3 hours.

[0312] In a preferred embodiment, the reaction temperature in step (c) is maintained between 15°C and 45°C, 15°C and 30°C, or 20°C and 26°C. In a preferred embodiment, the reaction temperature in step (c) is maintained at approximately 23°C.

[0313] In a preferred embodiment, the yield of the conjugation step exceeds 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%. In a preferred embodiment, the yield of the conjugation step (step b) exceeds 60%. In a preferred embodiment, the yield of the conjugation step (step b) exceeds 70%. The yield is (amount of serum-type 15B polysaccharide in the conjugate x 100) / amount of activated polysaccharide used in the conjugation step.

[0314] In a preferred embodiment, the method for preparing a glycoconjugate comprising a Streptococcus pneumoniae serotype 15B capsular polysaccharide covalently linked to a carrier protein includes the following steps:

[0315] (a) The size of purified serum-type 15B polysaccharide was altered by high-pressure homogenization;

[0316] (b) Reaction of the altered serum-type 15B polysaccharide with an oxidizing agent;

[0317] (c) Mix the activated serum-type 15B polysaccharide with the carrier protein;

[0318] (d) Reacting the mixed activated serum type 15B polysaccharide and carrier protein with a reducing agent to form a serum type 15B polysaccharide-carrier protein conjugate; and

[0319] (e) Unreacted aldehydes are capped (quenched) by adding NaBH4.

[0320] In a preferred embodiment, the yield of the conjugation step (step d) of the above method exceeds 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%. In a preferred embodiment, the yield of the conjugation step (step d) exceeds 60%. In a preferred embodiment, the yield of the conjugation step (step d) exceeds 70%. The yield is (amount of serum-type 15B polysaccharide in the conjugate x 100) / amount of activated polysaccharide used in the conjugation step.

[0321] After the serum type 15B capsular polysaccharide is conjugated to the carrier protein, the polysaccharide-protein conjugate can be purified (enriched in quantity) using a number of techniques known to those skilled in the art. These techniques include dialysis, concentration / percolation, tangential flow filtration, precipitation / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and deep filtration.

[0322] In one embodiment, the carrier protein is as defined in Section 1.1. In one embodiment, the carrier protein is selected from the group consisting of: DT (diphtheria toxin), TT (tetanus toxoid), CRM. 197 Other DT mutants, PD (Haemophilus influenzae protein D), or their immunological functional equivalents. In one embodiment, the carrier protein is CRM. 197 .

[0323] In some embodiments, the serum-type 15B glycoconjugate of the present invention is conjugated to a carrier protein (e.g., CRM). 197It contains sugars having a molecular weight of 5 kDa to 1,500 kDa. In other such embodiments, the sugars have a molecular weight of 10 kDa to 1,500 kDa. In another such embodiment, the sugar has the following molecular weights: 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 50 kDa to 250 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa; 100 kDa to 1,000 kDa; 100 kDa to 750 kDa; 100 kDa to 500 kDa; 100 kDa to 250 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa; or 200 kDa to 400 kDa. Any integer within the above range is considered an embodiment of this disclosure. In some embodiments, the serotype 15B glycoconjugate of the present invention has a molecular weight of 50 kDa to 20,000 kDa. In some embodiments, the serotype 15B glycoconjugate of the present invention has a molecular weight of 1,000 kDa to 20,000 kDa. In preferred embodiments, the serotype 15B glycoconjugate of the present invention has the following molecular weights: 3,000 kDa to 20,000 kDa, 5,000 kDa to 10,000 kDa, 5,000 kDa to 20,000 kDa, 8,000 kDa to 20,000 kDa, 8,000 kDa to 16,000 kDa, or 10,000 kDa to 16,000 kDa.

[0324] In another embodiment, the serotype 15B glycoconjugate of the present invention has the following molecular weights: approximately 1,000 kDa, approximately 1,500 kDa, approximately 2,000 kDa, approximately 2,500 kDa, approximately 3,000 kDa, approximately 3,500 kDa, approximately 4,000 kDa, approximately 4,500 kDa, approximately 5,000 kDa, approximately 5,500 kDa, approximately 6,000 kDa, approximately 6,500 kDa, approximately 7,000 kDa, approximately 7,500 kDa, approximately 8,000 kDa, approximately 8,500 kDa, approximately 9,000 kDa, approximately 9,500 kDa, and approximately 10,000 kDa. Approximately 10,500 kDa, approximately 11,000 kDa, approximately 11,500 kDa, approximately 12,000 kDa, approximately 12,500 kDa, approximately 13,000 kDa, approximately 13,500 kDa, approximately 14,000 kDa, approximately 14,500 kDa, approximately 15,000 kDa, approximately 15,500 kDa, approximately 16,000 kDa, approximately 16,500 kDa, approximately 17,000 kDa, approximately 17,500 kDa, approximately 18,000 kDa, approximately 18,500 kDa, approximately 19,000 kDa, approximately 19,500 kDa, or approximately 20,000 kDa.

[0325] In another embodiment, the serotype 15B glycoconjugate of the present invention has a molecular weight of 1,000 kDa to 20,000 kDa; 1,000 kDa to 15,000 kDa; 1,000 kDa to 10,000 kDa; 1,000 kDa to 7,500 kDa; 1,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 3,000 kDa; 2,000 kDa. 0 kDa to 20,000 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa.

[0326] In another embodiment, the serotype 15B glycoconjugate of the present invention has the following molecular weights: 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 3,000 kDa to 4,000 kDa; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa.

[0327] In another embodiment, the serotype 15B glycoconjugate of the present invention has the following molecular weights: 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa; 5,000 kDa to 7,500 kDa; 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 12,500 kDa; 6,000 kDa to 10,000 kDa; or 6,000 kDa to 7,500 kDa.

[0328] The molecular weight of the glycoconjugate is measured using SEC-MALLS. Any integer within the above range is considered an embodiment of this disclosure. In one embodiment, the serotype 15B glycoconjugate is prepared using reductive amination.

[0329] The serotype 15B glycoconjugate of the present invention can also be characterized by the ratio of sugar to carrier protein (weight / weight). In a preferred embodiment, the ratio of serotype 15B capsular polysaccharide to carrier protein (weight / weight) is 0.5 to 3.0 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.0). In a preferred embodiment, the ratio of serotype 15B capsular polysaccharide to carrier protein in the conjugate is 0.4 to 2. In a preferred embodiment, the ratio of serum-type 15B capsular polysaccharide to carrier protein in the conjugate is 0.5 to 2.0, 0.5 to 1.5, 0.5 to 1.0, 1.0 to 1.5, or 1.0 to 2.0. In a preferred embodiment, the ratio of serum-type 15B capsular polysaccharide to carrier protein in the conjugate is 0.7 to 0.9.

[0330] The serum type 15B glycoconjugate and immunogenic composition of the present invention may contain free sugars that are not covalently conjugated to the carrier protein but are present in the glycoconjugate composition. The free sugars may be non-covalently associated with the glycoconjugate (i.e., non-covalently bound to, adsorbed to, or embedded in the glycoconjugate).

[0331] In a preferred embodiment, the serotype 15B glycoconjugate of the present invention comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 15% free serotype 15B capsular polysaccharide relative to the total amount of serotype 15B capsular polysaccharide. In a preferred embodiment, the serotype 15B glycoconjugate of the present invention comprises less than about 25% free serotype 15B capsular polysaccharide relative to the total amount of serotype 15B capsular polysaccharide. In a preferred embodiment, the serotype 15B glycoconjugate of the present invention comprises less than about 20% free serotype 15B capsular polysaccharide relative to the total amount of serotype 15B capsular polysaccharide. In a preferred embodiment, the serotype 15B glycoconjugate of the present invention comprises less than about 15% free serotype 15B capsular polysaccharide relative to the total amount of serotype 15B capsular polysaccharide.

[0332] The serum-type 15B glycoconjugate can also be classified according to its molecular size distribution (K). d Characterization was performed using size exclusion chromatography media (CL-4B). Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular weight distribution of conjugates, as described above.

[0333] In a preferred embodiment, at least 20% of the serotype 15B glycoconjugates of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 30% of the immunogenic conjugates have a Kc of less than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, at least 40% of the serotype 15B glycoconjugates of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 15 glycoconjugates of the present invention have a Kc of less than or equal to 0.3. d In a preferred embodiment, at least 60% of the serotype 15B glycoconjugates of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 70% of the serotype 15B glycoconjugates of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d .

[0334] In a preferred embodiment, 40% to 90% of the serum-type 15B glycoconjugates have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 50% to 90% of the serum-type 15B glycoconjugates have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 65% to 80% of the serum-type 15B glycoconjugates have a Kc of less than or equal to 0.3 in a CL-4B column. d .

[0335] In a preferred embodiment, the glycoconjugate of serotype 15B of the present invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM of acetate / salt per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the glycoconjugate comprises at least 0.5, 0.6, or 0.7 mM of acetate / salt per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the glycoconjugate comprises at least 0.6 mM of acetate / salt per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the glycoconjugate comprises at least 0.7 mM of acetate / salt per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the presence of an O-acetyl group is determined by ion HPLC analysis.

[0336] In a preferred embodiment, the ratio of acetate / salt mM per mM of serum type 15B capsular polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum type 15B capsular polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred embodiment, the ratio of acetate / salt mM per mM of serum type 15B capsular polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum type 15B capsular polysaccharide in the isolated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of acetate / salt mM per mM of serum type 15B capsular polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum type 15B capsular polysaccharide in the isolated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion HPLC analysis.

[0337] In a preferred embodiment, the ratio of acetate / salt mM per mM of serum type 15B capsular polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum type 15B capsular polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred embodiment, the ratio of acetate / salt mM per mM of serum type 15B capsular polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum type 15B capsular polysaccharide in the activated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of acetate / salt mM per mM of serum type 15B capsular polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum type 15B capsular polysaccharide in the activated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion HPLC analysis.

[0338] In a preferred embodiment, the serotype 15B glycoconjugate of the present invention contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM glycerol per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the serotype 15B glycoconjugate of the present invention contains at least 0.5, 0.6, or 0.7 mM glycerol per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the serotype 15B glycoconjugate of the present invention contains at least 0.6 mM glycerol per mM of serotype 15B capsular polysaccharide. In a preferred embodiment, the serotype 15B glycoconjugate of the present invention contains at least 0.7 mM glycerol per mM of serotype 15B capsular polysaccharide.

[0339] Another way to characterize the serotype 15B glycoconjugate of the present invention is by means of a carrier protein (e.g., CRM). 197The number of lysine residues conjugated with the sugar in the protein can be characterized as the range of conjugated lysine residues (degree of conjugation). Evidence of lysine modification of the carrier protein (due to covalent bonds with the polysaccharide) can be obtained by amino acid analysis using conventional methods known to those skilled in the art. The number of lysine residues recovered due to conjugation is related to the CRM used to generate the conjugated material. 197 The protein starting material ratio is lower.

[0340] In a preferred embodiment, the degree of conjugation of the glycoconjugate of serotype 15B of the present invention is 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In one embodiment, the degree of conjugation of the glycoconjugate of serotype 15B of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In a preferred embodiment, the degree of conjugation of the glycoconjugate of serotype 15B of the present invention is 2 to 5.

[0341] 1.3.5 Glycoconjugates from Streptococcus pneumoniae serotype 12F

[0342] In the glycoconjugates derived from Streptococcus pneumoniae serotype 12F of the present invention, the sugar is selected from the group consisting of polysaccharides and oligosaccharides, while the carrier protein is selected from any suitable carrier described herein or known to those skilled in the art. In some preferred embodiments, the sugar is a polysaccharide derived from Streptococcus pneumoniae serotype 12F.

[0343] In one embodiment, the glycoconjugate from Streptococcus pneumoniae serotype 12F is prepared using CDAP. The polysaccharide is activated with 1-cyano-4-dimethylaminopyridine tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide is then coupled directly or via a spacer (connector) group to a carrier protein (preferably CRM). 197 The amino group on the protein carrier. For example, the spacer can be cystamine or cysteine ​​to give a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained by reacting with a maleimide-activated carrier protein (e.g., using GMBS) or with a halogenated acetylated carrier protein (e.g., using iodoacetylimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (optionally prepared by CDAP chemistry) is coupled to hexamethylenediamine or adipic dihydrazide (ADH), and the amino-derived sugar is conjugated to the carrier protein (e.g., CRM) via a carbodiimide (e.g., EDAC or EDC) chemistry via the carboxyl group on the protein carrier.197 ).

[0344] Other suitable techniques use carbodiimide, hydrazide, active ester, norbornene, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. The conjugation may involve a carbonyl linker, which can be formed by reacting the free hydroxyl group of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by a reaction with the protein to form a carbamate bond. This can involve reducing the anolyte to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0345] In one embodiment, the capsular polysaccharide of serotype 12F Streptococcus pneumoniae is conjugated to a carrier protein via reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functionality from the ortho-diol in the individual hexasaccharide unit, and (2) reduction of the activated polysaccharide with the carrier protein to form a conjugate.

[0346] Prior to oxidation, the serum-type 12F polysaccharide is optionally hydrolyzed (reduced in size). Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be performed using acetic acid.

[0347] In one embodiment, the oxidant is periodate. The term "periodate" includes periodate and periodic acid (see below).

[0348] In a preferred embodiment, the oxidant is a 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) radical and N-chlorosuccinimide (NCS) as a co-oxidant. In this embodiment, the glycoconjugate derived from Streptococcus pneumoniae serotype 12F is prepared by using a 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) radical to oxidize the primary alcohol of a sugar to an aldehyde and using N-chlorosuccinimide (NCS) as a co-oxidant (hereinafter referred to as "TEMPO / NCS oxidation") as described in Example 7 and WO 2014 / 097099. Therefore, in one aspect, the glycoconjugate from Streptococcus pneumoniae serotype 12F can be obtained by a method comprising the following steps: a) reacting the 12F sugar with 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) and N-chlorosuccinimide (NCS) in an aqueous solvent to produce an activated sugar; and b) reacting the activated sugar with a carrier protein comprising one or more amine groups (hereinafter referred to as "TEMPO / NCS-reductive amination"). In one aspect, the glycoconjugate from Streptococcus pneumoniae serotype 12F is obtained by said method. In one embodiment, the oxidation degree of the activated 12F sugar ranges from 1 to 50, from 1 to 40, from 1 to 30, from 1 to 20, from 1 to 10, from 1 to 5, from 3 to 40, from 3 to 30, from 3 to 20, from 4 to 10, from 5 to 30, from 5 to 25, from 5 to 20, from 5 to 10, from 6 to 50, from 6 to 40, from 6 to 30, from 6 to 20, from 6 to 15, from 6 to 14, from 6 to 13, from 6 to 12, from... 6 to 11, from 6 to 10, from 7 to 40, from 7 to 30, from 7 to 20, from 7 to 15, from 7 to 14, from 7 to 13, from 7 to 12, from 7 to 11, from 7 to 10, from 8 to 40, from 8 to 30, from 8 to 20, from 8 to 15, from 8 to 14, from 8 to 13, from 8 to 13, from 8 to 12, from 8 to 11, from 8 to 10, from 9 to 40, from 9 to 30, from 9 to 20, from 9 to 15, from 10 to 40, from 10 to 30, from 10 to 20, or from 10 to 15. In another aspect, the degree of oxidation of the activated sugar is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40. Preferably, the carrier protein is CRM. 197 .

[0349] In one embodiment, prior to step a), the 12F sugar is hydrolyzed to a molecular weight range from 100 kDa to 400 kDa. For example, in one aspect, the molecular weight range is from 100 kDa to 350 kDa, from 100 kDa to 300 kDa, from 100 kDa to 250 kDa, from 100 kDa to 200 kDa, from 100 kDa to 150 kDa, from 200 kDa to 400 kDa, from 200 kDa to 350 kDa, from 200 kDa to 300 kDa, from 200 kDa to 250 kDa, from 300 kDa to 400 kDa, or from 300 kDa to 350 kDa.

[0350] In another aspect, the method further includes purifying the activated polysaccharide prior to step b). In another aspect, the method further includes adding a reducing agent after step b). In one aspect, the reducing agent is NaCNBH3. In another aspect, the method further includes adding NaBH4 after adding NaCNBH3. In another aspect, the method includes a purification step after adding NaBH4.

[0351] In another aspect, this disclosure provides glycoconjugates from Streptococcus pneumoniae serotype 12F that can be produced or obtained by the methods disclosed above. For example, in one aspect, this disclosure provides glycoconjugates from Streptococcus pneumoniae serotype 12F comprising a sugar conjugated to a carrier protein, which can be produced or obtained by a method comprising the steps of: a) reacting the sugar with 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) and N-chlorosuccinimide (NCS) in an aqueous solvent to produce an activated sugar; and b) reacting the activated sugar with a carrier protein comprising one or more amine groups.

[0352] In one embodiment, the glycoconjugate from Streptococcus pneumoniae serotype 12F of the present invention has a molecular weight of about 50 kDa to about 20,000 kDa. In another embodiment, the glycoconjugate has a molecular weight of about 200 kDa to about 10,000 kDa. In yet another embodiment, the glycoconjugate from Streptococcus pneumoniae serotype 12F has a molecular weight of about 500 kDa to about 5,000 kDa. In one embodiment, the glycoconjugate from Streptococcus pneumoniae serotype 12F has a molecular weight of about 1,000 kDa to about 3,000 kDa. In other embodiments, the glycoconjugate derived from Streptococcus pneumoniae serotype 12F has the following molecular weights: about 600 kDa to about 2,800 kDa; about 700 kDa to about 2,700 kDa; about 1,000 kDa to about 2,000 kDa; about 1,800 kDa to about 2,500 kDa; about 1,100 kDa to about 2,200 kDa; about 1,900 kDa to about 2,700 kDa; about 1,200 kDa to about 2,400 kDa; about 1,700 kDa to about 2,600 kDa; about 1,300 kDa to about 2,600 kDa; and about 1,600 kDa to about 3,000 kDa.

[0353] In another embodiment, the serotype 12F glycoconjugate of the present invention has the following molecular weights: 1,000 kDa to 20,000 kDa; 1,000 kDa to 15,000 kDa; 1,000 kDa to 10,000 kDa; 1,000 kDa to 7,500 kDa; 1,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 3,000 kDa; 2,0 00kDa to 20,000kDa; 2,000kDa to 15,000kDa; 2,000kDa to 12,500kDa; 2,000kDa to 10,000kDa; 2,000kDa to 7,500kDa; 2,000kDa to 6,000kDa; 2,000kDa to 5,000kDa; 2,000kDa to 4,000kDa; or 2,000kDa to 3,000kDa. Any integer within any of the above ranges is considered an embodiment of this disclosure. In some such embodiments, the carrier protein is CRM. 197 In some such embodiments, the serum-type 12F glycoconjugate is conjugated to the carrier protein via TEMPO / NCS-reductive amination.

[0354] Another way to characterize the serotype 12F glycoconjugate of the present invention is by means of a carrier protein (e.g., CRM).197 The number of lysine residues conjugated with sugars in a sugar can be characterized as the range of conjugated lysine residues (degree of conjugation).

[0355] In a preferred embodiment, the degree of conjugation of the serotype 12F glycoconjugate of the present invention is 2 to 20, 4 to 16, 4 to 15, 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In one embodiment, the degree of conjugation of the serotype 12F glycoconjugate of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20.

[0356] The number of lysine residues in the carrier protein conjugated to the sugar can also be expressed as a molar ratio. For example, in glycoconjugates (where CRM... 197 Four to 15 lysine residues are covalently linked to the sugar, and the lysine conjugates in the sugar conjugates are related to CRM. 197 The molar ratio is approximately 10:1 to approximately 40:1. In immunogenic compositions (where CRM) 197 Two to 20 lysine residues are covalently linked to the sugar, and the lysine conjugates in the sugar conjugates are related to CRM. 197 The molar ratio is from about 5:1 to about 50:1. In one embodiment, in the glycoconjugate from Streptococcus pneumoniae serotype 12F of the present invention, the molar ratio of conjugated lysine to carrier protein is from about 10:1 to about 25:1. In some such embodiments, the carrier protein is CRM. 197 In some implementations, the CRM 197 It may contain approximately 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 lysine residues covalently linked to the sugar. In some such embodiments, the serum-type 12F glycoconjugate is conjugated to the carrier protein via TEMPO / NCS-reductive amination.

[0357] In one embodiment, the sugar-to-carrier protein ratio (w / w) in the glycoconjugate from Streptococcus pneumoniae serotype 12F is 0.2 to 4 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In another embodiment, the sugar-to-carrier protein ratio (w / w) in the glycoconjugate derived from Streptococcus pneumoniae serotype 12F is 1.1 to 1.7. In other embodiments, the sugar-to-carrier protein ratio (w / w) is 0.8 to 1.8 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, or about 1.8). In some such embodiments, the carrier protein is CRM. 197 In some such embodiments, the carrier protein is CRM. 197 In some such embodiments, the serum-type 12F glycoconjugate is conjugated to the carrier protein via TEMPO / NCS-reductive amination.

[0358] The frequency of lysine residues attached to the carrier protein by the glycan chain is another parameter characterizing the serum-type 12F glycoconjugate of this disclosure. For example, in one embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 100 sugar repeat units. In one embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 50 sugar repeat units. In one embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 25 sugar repeat units. In another embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 4 sugar repeat units. In another embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 10 sugar repeat units. In yet another embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 15 sugar repeat units. In a common embodiment, the carrier protein is CRM. 197 At least one CRM will appear for every 4, 10, 15, or 25 sugar repeating units of the polysaccharide. 197 Covalent bonds between polysaccharides.

[0359] In other embodiments, for every 5 to 10 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for every 2 to 7 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for every 3 to 8 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for every 4 to 9 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for every 6 to 11 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for every 7 to 12 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for every 8 to 13 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for every 9 to 14 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for every 10 to 15 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for every 2 to 6 ... For each 3 to 7 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for each 4 to 8 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for each 6 to 10 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for each 7 to 11 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for each 8 to 12 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for each 9 to 13 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for each 10 to 14 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for each 10 to 20 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar; for each 4 to 25 sugar repeat units, or for each 2 to 25 sugar repeat units, the conjugate contains at least one covalent bond between a carrier protein and a sugar. In a common implementation, the carrier protein is CRM. 197 .

[0360] In another embodiment, for every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 sugar repeating units of the polysaccharide, at least one CRM occurs. 197 The bond between the sugar and the protein. In some such embodiments, the serum-type 12F glycoconjugate is conjugated to the carrier protein via TEMPO / NCS-reductive amination.

[0361] In one embodiment, the glycoconjugate from *Streptococcus pneumoniae* serotype 12F of the present invention comprises at least one covalent bond between a carrier protein and a polysaccharide for every 25 sugar repeat units of the polysaccharide. In another embodiment, at least one covalent bond between a carrier protein and a polysaccharide occurs for every 4 sugar repeat units of the polysaccharide. In yet another embodiment, at least one covalent bond between a carrier protein and a polysaccharide occurs for every 10 sugar repeat units of the polysaccharide. In still another embodiment, at least one covalent bond between a carrier protein and a polysaccharide occurs for every 15 sugar repeat units of the polysaccharide. In some of these embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein via TEMPO / NCS-reductive amination.

[0362] The serum-type 12F glycoconjugate and immunogenic composition of the present invention may contain free sugars that are not covalently conjugated to the carrier protein but are present in the glycoconjugate composition. The free sugars may be non-covalently associated with the glycoconjugate (i.e., non-covalently bound to, adsorbed to, or embedded in the glycoconjugate).

[0363] In some embodiments, the serotype 12F glycoconjugate of the present invention comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% free serotype 12F polysaccharides relative to the total amount of serotype 12F polysaccharides. In one embodiment, the glycoconjugate from Streptococcus pneumoniae serotype 12F comprises less than about 50% free serotype 12F polysaccharides relative to the total amount of serotype 12F polysaccharides. In one embodiment, the glycoconjugate from Streptococcus pneumoniae serotype 12F comprises less than about 45% free serotype 12F polysaccharides relative to the total amount of serotype 12F polysaccharides. In another embodiment, the glycoconjugate comprises less than about 30% free serotype 12F polysaccharides relative to the total amount of serotype 12F polysaccharides. In another embodiment, the glycoconjugate from Streptococcus pneumoniae serotype 12F comprises less than about 20% free serotype 12F polysaccharides relative to the total amount of serotype 12F polysaccharides. In another embodiment, the glycoconjugate comprises less than about 10% free serotype 12F polysaccharides relative to the total amount of serotype 12F polysaccharides. In yet another embodiment, the glycoconjugate from Streptococcus pneumoniae serotype 12F comprises less than about 5% free serotype 12F polysaccharides relative to the total amount of serotype 12F polysaccharides. In some such embodiments, the serotype 12F glycoconjugate is conjugated to a carrier protein via TEMPO / NCS-reductive amination.

[0364] In some embodiments, the serum-type 12F glycoconjugate of the present invention comprises a sugar having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the sugar has a molecular weight of 50 kDa to 2,000 kDa. In still other such embodiments, the sugar has the following molecular weights: 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa. a; 100kDa to 1,000kDa; 100kDa to 750kDa; 100kDa to 500kDa; 200kDa to 2,000kDa; 200kDa to 1,750kDa; 200kDa to 1,500kDa; 200kDa to 1,250kDa; 200kDa to 1,000kDa; 200kDa to 750kDa; or 200kDa to 500kDa; or 200kDa to 400kDa. In some such embodiments, the serum-type 12F glycoconjugate is conjugated to the carrier protein via TEMPO / NCS-reductive amination.

[0365] The serum-type 12F glycoconjugate can also be classified according to its molecular size distribution (K). d Characterization was performed using size exclusion chromatography media (CL-4B). Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular weight distribution of conjugates, as described above.

[0366] In a preferred embodiment, at least 35% of the serotype 12F glycoconjugates of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 12F glycoconjugate of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 12F glycoconjugates of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 70% of the serotype 12F glycoconjugates of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d .

[0367] In a preferred embodiment, 40% to 90% of the serum-type 12F glycoconjugates have a Kd of less than or equal to 0.3 in the CL-4B column. In a preferred embodiment, 50% to 90% of the serum-type 12F glycoconjugates have a Kd of less than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, 65% to 80% of the serum-type 12F glycoconjugates have a Kc of less than or equal to 0.3 in a CL-4B column. d .

[0368] 1.3.6 Glycoconjugates from Streptococcus pneumoniae serotype 10A

[0369] In one embodiment, the serum-type 10A glycoconjugate is obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridine tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled directly or via a spacer (connector) group to an amino group on a carrier protein. For example, the spacer can be cystamine or cysteine ​​to provide a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained by reacting with a maleimide-activated carrier protein (e.g., using GMBS) or with a halogenated acetylated carrier protein (e.g., using iodoacetylimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (optionally prepared by CDAP chemistry) is coupled with hexamethylenediamine or adipic dihydrazide (ADH), and the amino-derived sugar is chemically conjugated to the carrier protein via a carbodiimide (e.g., EDAC or EDC) via a carboxyl group on the protein carrier. Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO96 / 129094.

[0370] Other suitable techniques use carbodiimide, hydrazide, active ester, norbornene, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. The conjugation may involve a carbonyl linker, which can be formed by reacting the free hydroxyl group of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by a reaction with the protein to form a carbamate bond. This can involve reducing the anolyte to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0371] In a preferred embodiment, the serum-type 10A glycoconjugate of the present invention is prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functionality from the ortho-diol in the individual hexasaccharide unit, and (2) reduction of the activated polysaccharide with the carrier protein to form the conjugate.

[0372] Prior to oxidation, the serum-type 10A polysaccharide is optionally hydrolyzed (reduced in size). Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be performed using acetic acid.

[0373] In one embodiment, serum-type polysaccharides are activated (oxidized) through a preservative process including the following steps:

[0374] (a) Reacting the isolated serum type 10A polysaccharide with an oxidizing agent;

[0375] (b) The oxidation reaction was quenched by adding a quencher, resulting in activated serum-type 10A polysaccharide.

[0376] In a preferred embodiment, the oxidant is periodate. For the purposes of this invention, the term "periodate" includes periodate and periodic acid, and also includes metaperiodate (IO4). - ) and periodate (IO6) 5- And various salts of periodic acid (e.g., sodium periodate and potassium periodate). In a preferred embodiment, the oxidizing agent is sodium periodate. In a preferred embodiment, the periodate used for oxidizing serum type 10A polysaccharide is metaperiodate. In a preferred embodiment, the periodate used for oxidizing serum type 10A polysaccharide is sodium metaperiodate.

[0377] In one embodiment, the quencher is selected from ortho-diols, 1,2-amino alcohols, amino acids, glutathione, sulfites, bisulfites, dithionites, metabisulfites, thiosulfates, phosphites, hypophosphites, or phosphoric acids.

[0378] In one embodiment, the quencher is a 1,2-amino alcohol of formula (I):

[0379]

[0380] Where R 1 Selected from H, methyl, ethyl, propyl, or isopropyl.

[0381] In one embodiment, the quencher is selected from sodium and potassium salts of sulfurous acid, bisulfite, dithionite, metabisulfite, thiosulfate, phosphite, hypophosphite, or phosphoric acid.

[0382] In one embodiment, the quencher is an amino acid. In such embodiments, the amino acid may be selected from serine, threonine, cysteine, cystine, methionine, proline, hydroxyproline, tryptophan, tyrosine, and histidine.

[0383] In one embodiment, the quencher is a sulfite such as bisulfite, dithionite, metabisulfite, or thiosulfate.

[0384] In one embodiment, the quencher is a compound containing two ortho-hydroxyl groups (ortho-diols), i.e., the two hydroxyl groups are covalently linked to two adjacent carbon atoms.

[0385] Preferably, the quencher is a compound of formula (II):

[0386]

[0387] Where R 1 and R 2 They are independently selected from H, methyl, ethyl, propyl, or isopropyl.

[0388] In a preferred embodiment, the quencher is glycerol, ethylene glycol, 1,2-propanediol, 1,2-butanediol, or 2,3-butanediol, or ascorbic acid. In a preferred embodiment, the quencher is 2,3-butanediol.

[0389] In a preferred embodiment, the isolated serum-type 10A polysaccharide is activated by a method comprising the following steps:

[0390] (a) Reaction of isolated serum type 10A polysaccharide with periodate;

[0391] (b) The oxidation reaction was quenched by the addition of 2,3-butanediol, resulting in the activation of serum-type 10A polysaccharide.

[0392] Following the oxidation step of the polysaccharide, the polysaccharide is considered activated and will be referred to below as "activated polysaccharide".

[0393] In a preferred embodiment, the activated serum-type 10A polysaccharide is purified. The activated serum-type 10A polysaccharide is purified according to methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis, or ultrafiltration / permeation. For example, the activated 10A polysaccharide is purified by concentration and permeation using an ultrafiltration device.

[0394] In a preferred embodiment, the oxidation degree of the activated serum-type 10A polysaccharide is 2 to 30, 2 to 25, 2 to 20, 2 to 15, 2 to 10, 2 to 5, 5 to 30, 5 to 25, 5 to 20, 5 to 15, 5 to 10, 10 to 30, 10 to 25, 10 to 20, 10 to 15, 15 to 30, 15 to 25, 15 to 20, 20 to 30, or 20 to 25. In a preferred embodiment, the oxidation degree of the activated serum-type 10A polysaccharide is 2 to 10, 4 to 8, 4 to 6, 6 to 8, 6 to 12, 8 to 14, 9 to 11, 10 to 16, 12 to 16, 14 to 18, 16 to 20, 16 to 18, 18 to 22, or 18 to 20.

[0395] In a preferred embodiment, the activated serum-type 10A polysaccharide has the following molecular weights: 50 kDa to 400 kDa, 50 kDa to 350 kDa, 50 kDa to 300 kDa, 50 kDa to 250 kDa, 50 kDa to 200 kDa, 100 kDa to 300 kDa, 100 kDa to 250 kDa, or 100 kDa to 200 kDa. In a preferred embodiment, the activated serum-type 10A polysaccharide has a molecular weight of 50 kDa to 300 kDa. In a preferred embodiment, the activated serum-type 10A polysaccharide has a molecular weight of 100 kDa to 200 kDa. In a preferred embodiment, the activated serum-type 10A polysaccharide has a molecular weight of 100 kDa to 200 kDa and an oxidation degree of 5 to 20, 5 to 15, 8 to 14, 8 to 12, or 9 to 11. In a preferred embodiment, the activated serum-type 10A polysaccharide has a molecular weight of 100 kDa to 200 kDa and an oxidation degree of 9 to 11.

[0396] The activated polysaccharide and / or the carrier protein may be lyophilized individually (isolated lyophilization) or together (co-lyophilization).

[0397] In one embodiment, the activated serum-type 10A polysaccharide is lyophilized, optionally in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melitriose, dextran, mannitol, lactitol, and isomaltitol. In a preferred embodiment, the sugar is sucrose. In one embodiment, the lyophilized activated polysaccharide is then mixed with a solution containing a carrier protein.

[0398] In another embodiment, the activated polysaccharide and the carrier protein are co-lyophilized. In such embodiments, the activated serum-type 10A polysaccharide is mixed with the carrier protein and optionally lyophilized in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melitriose, dextran, mannitol, lactitol, and isomaltitol. In a preferred embodiment, the sugar is sucrose. The co-lyophilized polysaccharide and carrier protein can then be resuspended in solution and reacted with a reducing agent.

[0399] The second step of the conjugation method is the reduction of the activated polysaccharide with the carrier protein to form a conjugate (reductive amination), wherein a reducing agent is used.

[0400] Activated serum-type 10A polysaccharide can be conjugated to a carrier protein via a method comprising the following steps:

[0401] (c) Mix the activated serum-type 10A polysaccharide with the carrier protein; and

[0402] (d) The mixed activated serum type 10A polysaccharide and carrier protein are reacted with a reducing agent to form a serum type 10A polysaccharide-carrier protein conjugate.

[0403] In one embodiment, the reduction reaction is carried out in an aqueous solvent; in another embodiment, the reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. The DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.

[0404] In one embodiment, the reducing agent is sodium cyanoborohydride, sodium triacetoxyborohydride, sodium borohydride, or zinc borohydride, wherein a Bronsted or Lewis acid, an aminoborane such as boranepyridine, 2-methylpyridineborane, 2,6-diborane-methanol, dimethylaminoborane, t-BuMeiPrN-BH3, benzylamine-BH3, or 5-ethyl-2-methylboranepyridine (PEMB) is present. In a preferred embodiment, the reducing agent is sodium cyanoborohydride.

[0405] At the end of the reduction reaction, unreacted aldehyde groups may remain in the conjugate, which can be capped using a suitable capping agent. In one embodiment, this capping agent is sodium borohydride (NaBH4).

[0406] After the serum-type 10A polysaccharide is conjugated to the carrier protein, the conjugate can be purified (enriched in quantity) using a variety of techniques known to those skilled in the art. These techniques include dialysis, concentration / percolation, tangential flow filtration precipitation / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and deep filtration.

[0407] In some embodiments, the serum-type 10A glycoconjugate of the present invention comprises a sugar having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the sugar has a molecular weight of 50 kDa to 2,000 kDa. In still other such embodiments, the sugar has the following molecular weights: 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa. a; 100 kDa to 1,000 kDa; 100 kDa to 750 kDa; 100 kDa to 500 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,750 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa; or 200 kDa to 400 kDa. In some such embodiments, the serum-type 10A glycoconjugate is prepared using reductive amination.

[0408] In some embodiments, the serum-type 10A glycoconjugate of the present invention has a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serum-type 10A glycoconjugate has a molecular weight of 50 kDa to 15,000 kDa. In other embodiments, the serum-type 10A glycoconjugate has the following molecular weights: 500 kDa to 15,000 kDa; 500 kDa to 10,000 kDa; 2,000 kDa to 10,000 kDa; or 3,000 kDa to 8,000 kDa. In other embodiments, the serum-type 10A glycoconjugate has a molecular weight of 1,000 kDa to 10,000 kDa. In other embodiments, the serum-type 10A glycoconjugate has a molecular weight of 1,000 kDa to 8,000 kDa. In other embodiments, the serum-type 10A glycoconjugate has a molecular weight of 2,000 kDa to 8,000 kDa or 3,000 kDa to 7,000 kDa.In another embodiment, the serum-type 10A glycoconjugate of the present invention has the following molecular weights: 200 kDa to 20,000 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,500 kDa; 500 kDa Up to 10,000 kDa; 500 kDa to 7,500 kDa; 500 kDa to 6,000 kDa; 500 kDa to 5,000 kDa; 500 kDa to 4,000 kDa; 500 kDa to 3,000 kDa; 500 kDa to 2,000 kDa; 500 kDa to 1,500 kDa; 500 kDa to 1,000 kDa; 750 kDa to 20,000 kDa; 750 kDa to 15,000 kDa; 750 kDa to 12,500 kDa; 750 kDa to 10,000 kDa a; 750kDa to 7,500kDa; 750kDa to 6,000kDa; 750kDa to 5,000kDa; 750kDa to 4,000kDa; 750kDa to 3,000kDa; 750kDa to 2,000kDa; 750kDa to 1,500kDa; 1,000kDa to 15,000kDa; 1,000kDa to 12,500kDa; 1,000kDa to 10,000kDa; 1,000kDa to 7,500kDa; 1,000kDa to 6,000kDa a; 1,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 2,500 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa.

[0409] In another embodiment, the serum-type 10A glycoconjugate of the present invention has the following molecular weights: 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa. In another embodiment, the serum-type 10A glycoconjugate of the present invention has the following molecular weights: 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa; or 5,000 kDa to 7,500 kDa. In another embodiment, the serum-type 10A glycoconjugate of the present invention has the following molecular weights: 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 10,000 kDa; or 6,000 kDa to 7,500 kDa. In another embodiment, the serum-type 10A glycoconjugate of the present invention has the following molecular weights: 7,000 kDa to 20,000 kDa; 7,000 kDa to 15,000 kDa; 7,000 kDa to 10,000 kDa; or 7,000 kDa to 8,000 kDa. In another embodiment, the serum-type 10A glycoconjugate of the present invention has the following molecular weights: 8,000 kDa to 20,000 kDa; 8,000 kDa to 15,000 kDa; or 8,000 kDa to 10,000 kDa.

[0410] Any integer within the range described above is considered an embodiment of this disclosure. The molecular weight of the glycoconjugate was measured using SEC-MALLS.

[0411] Another way to characterize the serum-type 10A glycoconjugate of the present invention is by means of a carrier protein (e.g., CRM). 197 The number of lysine residues conjugated with the sugar in the protein can be characterized as the range of conjugated lysine residues (degree of conjugation). Evidence of lysine modification of the carrier protein (due to covalent bonds with the polysaccharide) can be obtained by amino acid analysis using conventional methods known to those skilled in the art. The number of lysine residues recovered due to conjugation is related to the CRM used to generate the conjugated material. 197 The protein starting material ratio is lower.

[0412] In a preferred embodiment, the degree of conjugation of the glycoconjugate of serotype 10A of the present invention is 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In a preferred embodiment, the degree of conjugation of the glycoconjugate of serotype 10A of the present invention is 6 to 8. In a preferred embodiment, the carrier protein is CRM. 197 .

[0413] The serotype 10A glycoconjugates of the present invention can also be characterized by the sugar-to-carrier protein ratio (w / w). In some embodiments, the sugar-to-carrier protein ratio (w / w) is 0.5 to 3.0 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.0). In a preferred embodiment, the serotype 10A glycoconjugate contains 0.5 to 2.0, 0.5 to 1.5, 0.5 to 1.0, 1.0 to 1.5, or 1.0 to 2.0. In a preferred embodiment, the ratio of serum type 10A polysaccharide to carrier protein in the conjugate is 0.8 to 1.4. In a preferred embodiment, the ratio of serum type 10A capsular polysaccharide to carrier protein in the conjugate is 0.8 to 1.2 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, or about 1.2). In some such embodiments, the carrier protein is CRM. 197 .

[0414] The serum type 10A glycoconjugate and immunogenic composition of the present invention may contain free sugars that are not covalently conjugated to the carrier protein but are present in the glycoconjugate composition. The free sugars may be non-covalently associated with the glycoconjugate (i.e., non-covalently bound to, adsorbed to, or embedded in the glycoconjugate).

[0415] In some embodiments, the serum-type 10A glycoconjugate of the present invention comprises, relative to the total amount of 10A sugar, less than about 50% free sugar, less than about 45% free sugar, less than about 40% free sugar, less than about 35% free sugar, less than about 30% free sugar, less than about 25% free sugar, less than about 20% free sugar, less than about 15% free sugar, less than about 10% free sugar, or less than about 5% free sugar. Preferably, the serum-type 10A glycoconjugate comprises less than 15% free sugar, more preferably less than 10% free sugar, and even more preferably less than 5% free sugar.

[0416] Serum-type 10A glycoconjugates can also be classified according to their molecular size distribution (K). d Characterization was performed using size exclusion chromatography media (CL-4B). Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular weight distribution of conjugates, as described above.

[0417] In a preferred embodiment, at least 30% of the serotype 10A glycoconjugates of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40% of the serotype 10A glycoconjugates of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 10A glycoconjugate of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serum-type 10A glycoconjugates have a Kc of less than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, 50% to 80% of the serotype 10A glycoconjugate of the present invention has a Kc of less than or equal to 0.3 in a CL-4B column. d .

[0418] 1.3.7 Glycoconjugates from Streptococcus pneumoniae serotype 11A

[0419] In one embodiment, the serum-type 11A glycoconjugate is obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridine tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled directly or via a spacer (connector) group to an amino group on a carrier protein. For example, the spacer can be cystamine or cysteine ​​to provide a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained by reacting with a maleimide-activated carrier protein (e.g., using GMBS) or with a halogenated acetylated carrier protein (e.g., using iodoacetylimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (optionally prepared by CDAP chemistry) is coupled with hexamethylenediamine or adipic dihydrazide (ADH), and the amino-derived sugar is chemically conjugated to the carrier protein via a carbodiimide (e.g., EDAC or EDC) via a carboxyl group on the protein carrier. Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO96 / 129094.

[0420] Other suitable techniques use carbodiimide, hydrazide, active ester, norbornene, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. The conjugation may involve a carbonyl linker, which can be formed by reacting the free hydroxyl group of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by a reaction with the protein to form a carbamate bond. This can involve reducing the anolyte to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0421] In a preferred embodiment, the serum-type 11A glycoconjugate of the present invention is prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functionality from the ortho-diol in the individual hexasaccharide unit, and (2) reduction of the activated polysaccharide with the carrier protein to form the conjugate.

[0422] Prior to oxidation, the serum-type 11A polysaccharide is optionally hydrolyzed to reduce its viscosity. Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be performed using acetic acid. Mechanical size alteration can be achieved using high-pressure homogenous shearing.

[0423] The oxidation step may involve a reaction with periodate. For the purposes of this invention, the term "periodate" includes periodate and periodic acid; the term also includes metaperiodate (IO4).- ) and periodate (IO6) 5- And various salts of periodic acid (e.g., sodium periodate and potassium periodate). In one embodiment, the capsular polysaccharide from serotype 11A of Streptococcus pneumoniae is oxidized in the presence of metaperiodate, preferably in the presence of sodium periodate (NaIO4). In another embodiment, the capsular polysaccharide from serotype 11A is oxidized in the presence of orthoperiodate, preferably in the presence of periodic acid.

[0424] Following the oxidation step, the polysaccharide is considered activated and will be referred to below as "activated polysaccharide". The activated polysaccharide may be purified or lyophilized (freeze-dried).

[0425] The activated polysaccharide and the carrier protein may be lyophilized separately (isolated lyophilized) or together (co-lyophilized). In one embodiment, the activated polysaccharide and the carrier protein are co-lyophilized. In another embodiment, the activated polysaccharide and the carrier protein are lyophilized separately.

[0426] In one embodiment, the freeze-drying is carried out in the presence of non-reducing sugars, which may include sucrose, trehalose, raffinose, stachyose, melitriose, dextran, mannitol, lactitol, and isomaltitol.

[0427] The second step of the conjugation method is the reduction of the activated polysaccharide with the carrier protein to form a conjugate (reductive amination), wherein a reducing agent is used. Suitable reducing agents include cyanoborohydrides, such as sodium cyanoborohydride, boranepyridine, or borohydride exchange resins. In one embodiment, the reducing agent is sodium cyanoborohydride.

[0428] In one embodiment, the reduction reaction is carried out in an aqueous solvent; in another embodiment, the reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. The DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.

[0429] In one embodiment, 0.1 to 3.0, 0.15 to 2.0, 0.2 to 2.0, or 0.5 to 1.5 molar equivalents of sodium cyanoborohydride are used in the reduction reaction. In another embodiment, approximately 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.9, or 3.0 molar equivalents of sodium cyanoborohydride are used in the reduction reaction.

[0430] In one embodiment, the reducing agent is sodium triacetoxyborohydride; in another embodiment, 1.0 to 6.0 molar equivalents of sodium triacetoxyborohydride, 2.0 to 5.0 molar equivalents of sodium triacetoxyborohydride, or about 3.0 molar equivalents of sodium triacetoxyborohydride are used in the reduction reaction.

[0431] At the end of the reduction reaction, unreacted aldehyde groups may remain in the conjugate, which can be capped using a suitable capping agent. In one embodiment, this capping agent is sodium borohydride (NaBH4). In one embodiment, capping is achieved by mixing the reduction reaction with 0.5 to 5.0 molar equivalents of NaBH4, for example, about 1, 1.5, 2, 2.5, or 3 molar equivalents of NaBH4.

[0432] Following conjugation (reduction and optional end-capping), the glycoconjugate can be purified. The glycoconjugate can be purified by percolation and / or ion exchange chromatography and / or size exclusion chromatography. In one embodiment, the glycoconjugate is purified by percolation or ion exchange chromatography or size exclusion chromatography.

[0433] In one embodiment, the glycoconjugate is sterile filtered.

[0434] In some embodiments, the serum-type 11A glycoconjugate of the present invention is conjugated to a carrier protein (e.g., CRM). 197The sugar comprises a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the sugar has a molecular weight of 50 kDa to 2,000 kDa. In yet another such embodiment, the sugar has the following molecular weights: 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 50 kDa to 400 kDa; 50 kDa to 300 kDa; 50 kDa to 200 kDa; 50 kDa to 100 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa. ; 100kDa to 1,000kDa; 100kDa to 750kDa; 100kDa to 500kDa; 100kDa to 400kDa; 100kDa to 300kDa; 100kDa to 200kDa; 200kDa to 2,000kDa; 200kDa to 1,750kDa; 200kDa to 1,500kDa; 200kDa to 1,250kDa; 200kDa to 1,000kDa; 200kDa to 750kDa; or 200kDa to 500kDa; 200kDa to 400kDa or 200kDa to 300kDa.

[0435] In some embodiments, the serotype 11A glycoconjugate of the present invention has a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serotype 11A glycoconjugate has a molecular weight of 50 kDa to 15,000 kDa. In other embodiments, the serotype 11A glycoconjugate has a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 11A glycoconjugate has a molecular weight of 200 kDa to 10,000 kDa. In other embodiments, the serotype 11A glycoconjugate has a molecular weight of 1,000 kDa to 8,000 kDa or 2,000 kDa to 8,000 kDa.

[0436] In another embodiment, the serum-type 11A glycoconjugate of the present invention has the following molecular weights: 200 kDa to 20,000 kDa; 200 kDa to 17,500 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 17,500 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,500 kDa; 500kDa to 10,000kDa; 500kDa to 7,500kDa; 500kDa to 6,000kDa; 500kDa to 5,000kDa; 500kDa to 4,000kDa; 500kDa to 3,000kDa; 500kDa to 2,000kDa; 500kDa to 1,500kDa; 500kDa to 1,000kDa; 700kDa to 20,000kDa; 700kDa to 17,500kDa; 700kDa to 15,000kDa; 700kDa to 12,500kDa; 700kDa to 10,000kDa; 700kDa to 7 ... kDa to 6,000 kDa; 700 kDa to 5,000 kDa; 700 kDa to 4,500 kDa; 700 kDa to 4,000 kDa; 700 kDa to 3,500 kDa; 700 kDa to 3,000 kDa; 700 kDa to 2,000 kDa; 700 kDa to 1,500 kDa; 1,000 kDa to 20,000 kDa; 1,000 kDa to 17,500 kDa; 1,000 kDa to 15,000 kDa; 1,000 kDa to 12,500 kDa; 1,000 kDa to 10,000 kDa; 1,000 kDa to 7,500 kDa; 1,000 kDa to 6,000 kDa 1,000 kDa; 1,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 2,500 kDa; 2,000 kDa to 20,000 kDa; 2,000 kDa to 17,500 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa.

[0437] In another embodiment, the serum-type 11A glycoconjugate of the present invention has the following molecular weights: 3,000 kDa to 20,000 kDa; 3,000 kDa to 17,500 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,0 4,000 kDa to 20,000 kDa; 4,000 kDa to 17,500 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa. In another embodiment, the serum-type 11A glycoconjugate of the present invention has the following molecular weights: 5,000 kDa to 20,000 kDa; 5,000 kDa to 17,500 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa or 5,000 kDa to 7,500 kDa.

[0438] In one embodiment, the serotype 11A glycoconjugate is prepared using reductive amination.

[0439] In a preferred embodiment, the serotype 11A glycoconjugate of the present invention comprises at least 0.3, 0.5, 0.6, 1.0, 1.4, 1.8, 2.2, 2.6, 3.0, 3.4, 3.8, 4.2, 4.6, or 5 mM of acetate / salt per mM of serotype 11A polysaccharide. In a preferred embodiment, the serotype 11A glycoconjugate comprises at least 1.8, 2.2, or 2.6 mM of acetate / salt per mM of serotype 11A polysaccharide. In one embodiment, the glycoconjugate comprises at least 0.6 mM of acetate / salt per mM of serotype 11A polysaccharide. In a preferred embodiment, the serotype 11A glycoconjugate of the present invention comprises at least 0.6, 1, 1.4, 1.8, 2.2, 2.6, 3, 3.4, 3.8, 4.2, or 4.6 mM of acetate / salt per mM of serotype 11A polysaccharide, and less than about 5 mM of acetate / salt. In one embodiment, the serotype 11A glycoconjugate of the present invention comprises at least 0.6, 1.0, 1.4, 1.8, 2.2, 2.6, or 3.0 mM of acetate / salt per mM of serotype 11A polysaccharide, and less than about 3.4 mM of acetate / salt. In one embodiment, the serotype 11A glycoconjugate of the present invention comprises at least 0.6, 1, 1.4, 1.8, 2.2, 2.6, or about 3.0 mM of acetate / salt per mM of serotype 11A polysaccharide, and less than about 3.3 mM of acetate / salt. All of the above figures are considered as implementations of this disclosure.

[0440] In a preferred embodiment, the ratio of acetate / salt mM per mM of serum type 11A capsular polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum type 11A capsular polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred embodiment, the ratio of acetate / salt mM per mM of serum type 11A capsular polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum type 11A capsular polysaccharide in the isolated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of acetate / salt mM per mM of serum type 11A capsular polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum type 11A capsular polysaccharide in the isolated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion HPLC analysis.

[0441] In a preferred embodiment, the ratio of acetate / salt mM per mM of serum type 11A capsular polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum type 11A capsular polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In a preferred embodiment, the ratio of acetate / salt mM per mM of serum type 11A capsular polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum type 11A capsular polysaccharide in the activated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of acetate / salt mM per mM of serum type 11A capsular polysaccharide in the glycoconjugate to the ratio of acetate / salt mM per mM of serum type 11A capsular polysaccharide in the activated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion HPLC analysis.

[0442] In a preferred embodiment, the serotype 11A glycoconjugate of the present invention contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 mM of glycerol per mM of serotype 11A polysaccharide. In a preferred embodiment, the serotype 11A glycoconjugate of the present invention contains at least 0.2, 0.3, or 0.4 mM of glycerol per mM of serotype 11A polysaccharide. In a preferred embodiment, the serotype 11A glycoconjugate of the present invention contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, or 0.9 mM of glycerol per mM of serotype 11A polysaccharide and less than about 1.0 mM of glycerol. In a preferred embodiment, the serotype 11A glycoconjugate of the present invention contains at least 0.3, 0.4, 0.5, 0.6, or 0.7 mM of glycerol per mM of serotype 11A polysaccharide, and less than about 0.8 mM of glycerol. Any of the above figures are considered embodiments of this disclosure.

[0443] Another way to characterize the serum-type 11A glycoconjugate of the present invention is by means of a carrier protein (e.g., CRM). 197 The number of lysine residues conjugated with sugars in a sugar can be characterized as the range of conjugated lysine residues (degree of conjugation).

[0444] Evidence of lysine modification of the carrier protein (due to covalent bonds with the polysaccharide) can be obtained through amino acid analysis using conventional methods known to those skilled in the art. The number of lysine residues recovered due to conjugation is related to the CRM used to generate the conjugated material. 197 The protein starting material ratio is lower.

[0445] In a preferred embodiment, the degree of conjugation of the glycoconjugate of serotype 11A of the present invention is 1 to 15, 1 to 13, 1 to 10, 1 to 8, 1 to 6, 1 to 5, 1 to 4, 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In one embodiment, the degree of conjugation of the glycoconjugate of serotype 11A of the present invention is about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In a preferred embodiment, the degree of conjugation of the glycoconjugate of serotype 11A of the present invention is 1 to 6 or 2 to 5. In some such embodiments, the carrier protein is CRM. 197 .

[0446] The serotype 11A glycoconjugate of the present invention can also be characterized by the sugar-to-carrier protein ratio (w / w). In some embodiments, the sugar-to-carrier protein ratio (w / w) is 0.2 to 4 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In other embodiments, the sugar-to-carrier protein ratio (w / w) is 0.7 to 2.5, 0.8 to 2.0, 0.7 to 2.0, 0.8 to 1.5, 0.7 to 1.5, 0.7 to 1.4, 0.8 to 1.4, 0.7 to 1.45, or 0.8 to 1.45. In yet another embodiment, the sugar-to-carrier protein ratio (w / w) is 0.8 to 1.6 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, or about 1.6). In some such embodiments, the carrier protein is CRM. 197 In one embodiment, the serotype 11A glycoconjugate is prepared using reductive amination.

[0447] The serotype 11A glycoconjugate and immunogenic composition of the present invention may contain free sugars that are not covalently conjugated to the carrier protein but are present in the glycoconjugate composition. The free sugars may be non-covalently associated with the glycoconjugate (i.e., non-covalently bound to, adsorbed to, or embedded in the glycoconjugate).

[0448] In some embodiments, the serotype 11A glycoconjugate of the present invention comprises less than about 50% free serotype 11A capsular polysaccharide, less than about 45% free sugar, less than about 40% free sugar, less than about 35% free sugar, less than about 30% free sugar, less than about 25% free sugar, less than about 20% free sugar, less than about 15% free sugar, less than about 10% free sugar, or less than about 5% free serotype 11A capsular polysaccharide relative to the total amount of serotype 11A capsular polysaccharide. Preferably, the serotype 11A glycoconjugate comprises less than 15% free sugar, more preferably less than 10% free sugar, and even more preferably less than 5% free sugar.

[0449] Serum-type 11A glycoconjugates can also be categorized by their molecular size distribution (K). d Characterization was performed using size exclusion chromatography media (CL-4B). Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular weight distribution of conjugates, as described above.

[0450] In a preferred embodiment, at least 30% of the serotype 11A glycoconjugates of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 11A glycoconjugate of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 11A glycoconjugates of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 65% of the serotype 11A glycoconjugates of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d .

[0451] 1.3.8 Glycoconjugates from Streptococcus pneumoniae serotype 8

[0452] In one embodiment, the serum-type 8-glycoconjugate is obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridine tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled directly or via a spacer (connector) group to an amino group on a carrier protein. For example, the spacer can be cystamine or cysteine ​​to provide a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained by reacting with a maleimide-activated carrier protein (e.g., using GMBS) or with a halogenated acetylated carrier protein (e.g., using iodoacetylimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (optionally prepared by CDAP chemistry) is coupled with hexamethylenediamine or adipic dihydrazide (ADH), and the amino-derived sugar is chemically conjugated to the carrier protein via a carbodiimide (e.g., EDAC or EDC) via a carboxyl group on the protein carrier. Such conjugates are described, for example, in WO93 / 15760, WO 95 / 08348 and WO96 / 129094.

[0453] Other suitable techniques use carbodiimide, hydrazide, active ester, norbornene, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. The conjugation may involve a carbonyl linker, which can be formed by reacting the free hydroxyl group of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by a reaction with the protein to form a carbamate bond. This can involve reducing the anolyte to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0454] In a preferred embodiment, the serotype 8 glycoconjugate of the present invention is prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functionality from the ortho-diol in the individual hexasaccharide unit, and (2) reduction of the activated polysaccharide with the carrier protein to form the conjugate.

[0455] Prior to oxidation, the serum-type 8 polysaccharide is optionally hydrolyzed to reduce its viscosity. Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be performed using acetic acid.

[0456] The oxidation step may involve a reaction with periodate. For the purposes of this invention, the term "periodate" includes both periodate and periodic acid; the term also includes metaperiodate (IO4). - ) and periodate (IO6)5- And various salts of periodic acid (e.g., sodium periodate and potassium periodate). In one embodiment, the capsular polysaccharide from Streptococcus pneumoniae serotype 8 is oxidized in the presence of metaperiodate, preferably in the presence of sodium periodate (NaIO4). In another embodiment, the capsular polysaccharide from serotype 8 is oxidized in the presence of orthoperiodate, preferably in the presence of periodic acid.

[0457] Following the oxidation step, the polysaccharide is considered activated and will be referred to below as "activated polysaccharide". The activated polysaccharide may be purified or lyophilized (freeze-dried).

[0458] The activated polysaccharide and the carrier protein may be lyophilized separately (isolated lyophilization) or together (co-lyophilization). In one embodiment, the activated polysaccharide and the carrier protein are co-lyophilized. In another embodiment, the activated polysaccharide and the carrier protein are lyophilized separately.

[0459] In one embodiment, the freeze-drying occurs in the presence of non-reducing sugars, which may include sucrose, trehalose, raffinose, stachyose, melitriose, dextran, mannitol, lactitol, and isomaltitol.

[0460] The second step of the conjugation method is the reduction of the activated polysaccharide with the carrier protein to form a conjugate (reductive amination), wherein a reducing agent is used. Suitable reducing agents include cyanoborohydrides, such as sodium cyanoborohydride, boranepyridine, or borohydride exchange resins. In one embodiment, the reducing agent is sodium cyanoborohydride.

[0461] In one embodiment, the reduction reaction is carried out in an aqueous solvent; in another embodiment, the reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. The DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.

[0462] In one embodiment, the reduction reaction uses 0.1 to 3.0, 0.15 to 2.0, 0.2 to 1.0, or 0.25 to 0.5 molar equivalents of sodium cyanoborohydride. In another embodiment, the reduction reaction uses approximately 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.9, or 3.0 molar equivalents of sodium cyanoborohydride.

[0463] In one embodiment, the reducing agent is sodium triacetoxyborohydride. In another embodiment, the reduction reaction uses 1.0 to 6.0 molar equivalents of sodium triacetoxyborohydride, 2.0 to 5.0 molar equivalents of sodium triacetoxyborohydride, or about 3.0 molar equivalents of sodium triacetoxyborohydride.

[0464] At the end of the reduction reaction, unreacted aldehyde groups may remain in the conjugate, which can be capped using a suitable capping agent. In one embodiment, this capping agent is sodium borohydride (NaBH4). In one embodiment, capping is achieved by mixing the reduction reaction with 0.5 to 5.0 molar equivalents of NaBH4, for example, about 1.0, 1.5, 2.0, 2.5, or 3.0 molar equivalents of NaBH4.

[0465] Following conjugation (reduction and optional end-capping), the glycoconjugate can be purified. The glycoconjugate can be purified by percolation and / or ion exchange chromatography and / or size exclusion chromatography. In one embodiment, the glycoconjugate is purified by percolation or ion exchange chromatography or size exclusion chromatography.

[0466] In one embodiment, the glycoconjugate is sterile filtered.

[0467] In some embodiments, the serum-type 8-glycoconjugate of the present invention is conjugated to a carrier protein (e.g., CRM). 197 The sugar comprises a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the sugar has a molecular weight of 50 kDa to 2,000 kDa. In yet another such embodiment, the sugar has the following molecular weights: 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa. a; 100 kDa to 1,000 kDa; 100 kDa to 750 kDa; 100 kDa to 500 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,750 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa; or 200 kDa to 400 kDa. In one embodiment, the serotype 8-glycoconjugate is prepared using reductive amination.

[0468] In some embodiments, the serotype 8 glycoconjugate of the present invention has a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serotype 8 glycoconjugate has a molecular weight of 50 kDa to 15,000 kDa. In other embodiments, the serotype 8 glycoconjugate has a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 8 glycoconjugate has a molecular weight of 200 kDa to 10,000 kDa. In other embodiments, the serotype 8 glycoconjugate has a molecular weight of 1,000 kDa to 8,000 kDa or 2,000 kDa to 8,000 kDa.

[0469] In another embodiment, the serotype 8 glycoconjugate of the present invention has the following molecular weights: 200 kDa to 20,000 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,500 kDa; 500 kDa Up to 10,000 kDa; 500 kDa to 7,500 kDa; 500 kDa to 6,000 kDa; 500 kDa to 5,000 kDa; 500 kDa to 4,000 kDa; 500 kDa to 3,000 kDa; 500 kDa to 2,000 kDa; 500 kDa to 1,500 kDa; 500 kDa to 1,000 kDa; 750 kDa to 20,000 kDa; 750 kDa to 15,000 kDa; 750 kDa to 12,500 kDa; 750 kDa to 10,000 kDa a; 750kDa to 7,500kDa; 750kDa to 6,000kDa; 750kDa to 5,000kDa; 750kDa to 4,000kDa; 750kDa to 3,000kDa; 750kDa to 2,000kDa; 750kDa to 1,500kDa; 1,000kDa to 15,000kDa; 1,000kDa to 12,500kDa; 1,000kDa to 10,000kDa; 1,000kDa to 7,500kDa; 1,000kDa to 6,000kDa a; 1,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 2,500 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa.

[0470] In another embodiment, the serotype 8 glycoconjugate of the present invention has the following molecular weights: 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa. In another embodiment, the serotype 8 glycoconjugate of the present invention has the following molecular weights: 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa; or 5,000 kDa to 7,500 kDa. In another embodiment, the serotype 8 glycoconjugate of the present invention has the following molecular weights: 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 10,000 kDa; or 6,000 kDa to 7,500 kDa.

[0471] In another embodiment, the serotype 8 glycoconjugate of the present invention has the following molecular weights: 7,000 kDa to 20,000 kDa; 7,000 kDa to 15,000 kDa; 7,000 kDa to 10,000 kDa; or 7,000 kDa to 8,000 kDa. In another embodiment, the serotype 8 glycoconjugate of the present invention has the following molecular weights: 8,000 kDa to 20,000 kDa; 8,000 kDa to 15,000 kDa; or 8,000 kDa to 10,000 kDa.

[0472] In one embodiment, the serotype 8 glycoconjugate is prepared using reductive amination.

[0473] Another way to characterize the serotype 8 glycoconjugate of the present invention is by means of a carrier protein (e.g., CRM). 197 The number of lysine residues conjugated with sugars in a sugar can be characterized as the range of conjugated lysine residues (degree of conjugation).

[0474] Evidence of lysine modification of the carrier protein (due to covalent bonding with the polysaccharide) can be obtained through amino acid analysis using conventional methods known to those skilled in the art. In common embodiments, the carrier protein is covalently conjugated to the active polysaccharide via an amide bond of one or more ε-amino groups of the lysine residues on the carrier protein. In some such embodiments, the carrier protein contains 2 to 20 lysine residues covalently conjugated to the sugar. In other such embodiments, the carrier protein contains 4 to 16 or 6 to 14 lysine residues covalently conjugated to the sugar.

[0475] In a preferred embodiment, the degree of conjugation of the serotype 8 glycoconjugate of the present invention is 2 to 20, 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In one embodiment, the degree of conjugation of the serotype 8 glycoconjugate of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In a preferred embodiment, the degree of conjugation of the serotype 8 glycoconjugate of the present invention is 4 to 16 or 6 to 14. In some such embodiments, the carrier protein is CRM. 197 .

[0476] In a preferred embodiment, the carrier protein comprises CRM. 197 It contains 39 lysine residues. In some such embodiments, the CRM 197 It may contain 4 to 16 or 6 to 14 lysine residues covalently linked to the sugar. Another way to express this parameter is approximately 10% to approximately 41%, or approximately 15% to approximately 36% of the CRM. 197 Lysine is covalently linked to the sugar. In another such embodiment, the CRM... 197 It may contain 2 to 20 lysine residues among 39 lysine residues covalently linked to the sugar. Another way to express this parameter is approximately 5% to approximately 50% of the CRM. 197 Lysine is covalently linked to the sugar. In some such embodiments, the CRM 197 It may contain approximately 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 lysine residues covalently linked to the sugar.

[0477] The serotype 8 glycoconjugate of the present invention can also be characterized by the sugar-to-carrier protein ratio (w / w). In some embodiments, the sugar-to-carrier protein ratio (w / w) is from 0.2 to 4.0 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In other embodiments, the sugar-to-carrier protein ratio (w / w) is 0.7 to 2.5. In still other embodiments, the sugar-to-carrier protein ratio (w / w) is 0.8 to 1.5 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, or about 1.5). In some such embodiments, the carrier protein is CRM. 197 In one embodiment, the serotype 8 glycoconjugate is prepared using reductive amination.

[0478] The serotype 8 glycoconjugate and immunogenic composition of the present invention may contain free sugars that are not covalently conjugated to the carrier protein but are present in the glycoconjugate composition. The free sugars may be non-covalently associated with the glycoconjugate (i.e., non-covalently bound to, adsorbed to, or embedded in the glycoconjugate).

[0479] In some embodiments, the serotype 8 glycoconjugate of the present invention comprises, relative to the total amount of serotype 8 sugar, less than about 50% free sugar, less than about 45% free sugar, less than about 40% free sugar, less than about 35% free sugar, less than about 30% free sugar, less than about 25% free sugar, less than about 20% free sugar, less than about 15% free sugar, less than about 10% free sugar, or less than about 5% free sugar. Preferably, the serotype 8 glycoconjugate comprises less than 15% free sugar, more preferably less than 10% free sugar, and even more preferably less than 5% free sugar.

[0480] The serum type 8 glycoconjugate can also be classified according to its molecular size distribution (K). dCharacterization was performed using size exclusion chromatography (SEC) media (CL-4B). SEC was used to determine the relative molecular size distribution of the conjugates. The molecular size distribution of the conjugates was described using size exclusion chromatography (SEC) in a gravity-fed column. Large molecules elute from the pores of the media much faster than small molecules. A fraction collector was used to collect the column elute. The fractions were colorimetrically analyzed using a sugar assay. To determine K... d The column was calibrated to establish the fractions representing complete molecular expulsion (V0) (Kd = 0), and the fractions representing maximum retention (V). i ), (K d =1). The grade (V) of the specified sample attribute is achieved. e ) through expression K d＝ (V e -V0) / (V i -V0) and K d Related.

[0481] In a preferred embodiment, at least 40% of the serotype 8 glycoconjugates of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 8 glycoconjugate of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 8 glycoconjugates of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 70% of the serotype 8 glycoconjugates of the present invention have a Kc of less than or equal to 0.3 in a CL-4B column. d .

[0482] In a preferred embodiment, 40% to 90% of the serum type 8 glycoconjugates have a Kc of less than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, 50% to 90% of the serum type 8 glycoconjugates have a Kc of less than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, 65% to 80% of the serum type 8 glycoconjugates have a Kc of less than or equal to 0.3 in the CL-4B column. d .

[0483] 1.4 Combinations of the sugar conjugates of the present invention

[0484] In one embodiment, the immunogenic composition of the present invention comprises any glycoconjugate disclosed herein.

[0485] In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate selected from the group consisting of: glycoconjugates from Streptococcus pneumoniae serotype 15B (as described in Section 1.3.4 above), glycoconjugates from Streptococcus pneumoniae serotype 22F (as described in Section 1.3.2 above), glycoconjugates from Streptococcus pneumoniae serotype 33F (as described in Section 1.3.3 above), glycoconjugates from Streptococcus pneumoniae serotype 12F (as described in Section 1.3.5 above), glycoconjugates from Streptococcus pneumoniae serotype 10A (as described in Section 1.3.6 above), glycoconjugates from Streptococcus pneumoniae serotype 11A (as described in Section 1.3.7 above), and glycoconjugates from Streptococcus pneumoniae serotype 8 (as described in Section 1.3.8 above).

[0486] In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate from Streptococcus pneumoniae serotype 15B, as described in Section 1.3.4 above. In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate from Streptococcus pneumoniae serotype 22F, as disclosed in Section 1.3.2 above. In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate from Streptococcus pneumoniae serotype 33F, as disclosed in Section 1.3.3 above. In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate from Streptococcus pneumoniae serotype 12F, as disclosed in Section 1.3.5 above. In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate from Streptococcus pneumoniae serotype 10A, as disclosed in Section 1.3.6 above. In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate from Streptococcus pneumoniae serotype 11A, as disclosed in Section 1.3.7 above. In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 8, such as those disclosed in section 1.3.8 above.

[0487] In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate for each of two Streptococcus pneumoniae serotypes selected from the group consisting of: 15B and 22F, 15B and 33F, 15B and 12F, 15B and 10A, 15B and 11A, 15B and 8, 22F and 33F, 22F and 12F, 22F and 10A, 22F and 11A, 22F and 8, 33F and 12F, 33F and 10A, 33F and 11A, 33F and 8, 12F and 10A, 12F and 11A, 12F and 8, 10A and 11A, 10A and 8, and 11A and 8.

[0488] In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate for each of the following three Streptococcus pneumoniae serotypes:

[0489] 15B, 22F, and 33F

[0490] 15B and 22F and 12F,

[0491] 15B and 22F and 10A,

[0492] 15B and 22F and 11A,

[0493] 15B and 22F and 8,

[0494] 15B and 33F and 12F

[0495] 15B and 33F and 10A,

[0496] 15B and 33F and 11A,

[0497] 15B and 33F and 8,

[0498] 15B, 12F, and 10A

[0499] 15B, 12F, and 11A

[0500] 15B and 12F and 8,

[0501] 15B, 10A, and 11A

[0502] 15B and 10A and 8,

[0503] 15B and 11A and 8,

[0504] 22F and 33F and 12F

[0505] 22F and 33F and 10A,

[0506] 22F and 33F and 11A,

[0507] 22F and 33F and 8,

[0508] 22F and 12F and 10A,

[0509] 22F and 12F and 11A,

[0510] 22F and 12F and 8,

[0511] 22F and 10A and 11A

[0512] 22F and 10A and 8,

[0513] 22F and 11A and 8,

[0514] 33F and 12F and 10A,

[0515] 33F and 12F and 11A,

[0516] 33F and 12F and 8,

[0517] 33F and 10A and 11A,

[0518] 33F and 10A and 8,

[0519] 33F and 11A and 8,

[0520] 12F and 10A and 11A

[0521] 12F and 10A and 8,

[0522] 12F and 11A and 8 or

[0523] 10A, 11A, and 8.

[0524] In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate for each of the following four Streptococcus pneumoniae serotypes:

[0525] 15B and 22F and 33F and 12F,

[0526] 15B, 22F, 33F, and 10A

[0527] 15B and 22F and 33F and 11A,

[0528] 15B and 22F and 33F and 8,

[0529] 15B and 22F and 12F and 10A,

[0530] 15B and 22F and 12F and 11A,

[0531] 15B and 22F and 12F and 8,

[0532] 15B and 22F and 10A and 11A

[0533] 15B and 22F and 10A and 8,

[0534] 15B and 22F and 11A and 8,

[0535] 15B and 33F and 12F and 10A,

[0536] 15B and 33F and 12F and 11A,

[0537] 15B and 33F and 12F and 8,

[0538] 15B and 33F and 10A and 11A,

[0539] 15B and 33F and 10A and 8,

[0540] 15B and 33F and 11A and 8,

[0541] 15B and 12F and 10A and 11A

[0542] 15B and 12F and 10A and 8,

[0543] 15B and 12F and 11A and 8,

[0544] 15B and 10A and 11A and 8,

[0545] 22F and 33F and 12F and 10A,

[0546] 22F and 33F and 12F and 11A,

[0547] 22F and 33F and 12F and 8,

[0548] 22F and 33F and 10A and 11A,

[0549] 22F and 33F and 10A and 8,

[0550] 22F and 33F and 11A and 8,

[0551] 22F and 12F and 10A and 11A,

[0552] 22F and 12F and 10A and 8,

[0553] 22F and 12F and 11A and 8,

[0554] 22F and 10A and 11A and 8,

[0555] 33F and 12F and 10A and 11A,

[0556] 33F and 12F and 10A and 8,

[0557] 33F and 12F and 11A and 8,

[0558] 33F and 10A and 11A and 8 or

[0559] 12F, 10A, 11A, and 8.

[0560] In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate for each of the following five Streptococcus pneumoniae serotypes:

[0561] 15B and 22F and 33F and 12F and 10A,

[0562] 15B and 22F and 33F and 12F and 11A,

[0563] 15B and 22F and 33F and 12F and 8,

[0564] 15B and 22F and 33F and 10A and 11A,

[0565] 15B and 22F and 33F and 10A and 8,

[0566] 15B and 22F and 33F and 11A and 8,

[0567] 15B and 22F and 12F and 10A and 11A,

[0568] 15B and 22F and 12F and 10A and 8,

[0569] 15B and 22F and 12F and 11A and 8,

[0570] 15B and 22F and 10A and 11A and 8,

[0571] 15B and 33F and 12F and 10A and 11A,

[0572] 15B and 33F and 12F and 10A and 8,

[0573] 15B and 33F and 12F and 11A and 8,

[0574] 15B and 33F and 10A and 11A and 8,

[0575] 15B and 12F and 10A and 11A and 8,

[0576] 22F and 33F and 12F and 10A and 11A,

[0577] 22F and 33F and 12F and 10A and 8,

[0578] 22F and 33F and 12F and 11A and 8,

[0579] 22F and 33F and 10A and 11A and 8,

[0580] 22F and 12F and 10A and 11A and 8 or

[0581] 33F and 12F and 10A and 11A and 8.

[0582] In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate for each of the following six Streptococcus pneumoniae serotypes:

[0583] 15B and 22F and 33F and 12F and 10A and 11A,

[0584] 15B and 22F and 33F and 12F and 10A and 8,

[0585] 15B and 22F and 33F and 12F and 11A and 8,

[0586] 15B and 22F and 33F and 10A and 11A and 8,

[0587] 15B and 22F and 12F and 10A and 11A and 8,

[0588] 15B and 33F and 12F and 10A and 11A and 8 or

[0589] 22F and 33F and 12F and 10A and 11A and 8.

[0590] In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate for each of the following seven Streptococcus pneumoniae serotypes: 15B and 22F and 33F and 12F and 10A and 11A and 8.

[0591] In one embodiment, any immunogenic composition defined in this section that is a glycoconjugate of Streptococcus pneumoniae serotypes 15B, 22F, 33F, 12F, 10A, 11A and / or 8 is as disclosed in sections 1.3.2 to 1.3.8 above.

[0592] In one embodiment, any of the above-described immunogenic compositions further comprises glycoconjugates (such as the glycoconjugates described in Section 1.3.1 above) derived from Streptococcus pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F.

[0593] In one embodiment, any of the above-described immunogenic compositions further comprises glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 5, and 7F (as described in section 1.3.1 above).

[0594] In one embodiment, any of the above-described immunogenic compositions further comprises glycoconjugates derived from Streptococcus pneumoniae serotypes 6A and 19A (as described in Section 1.3.1 above).

[0595] In one embodiment, any of the above-described immunogenic compositions further comprises a glycoconjugate derived from Streptococcus pneumoniae serotype 3 (such as the glycoconjugate described in section 1.3.1 above).

[0596] Preferably, all glycoconjugates of the above-described immunogenic composition are independently conjugated to the carrier protein.

[0597] In any embodiment of the above-described immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 22F is conjugated to CRM.197 In any embodiment of the above-described immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 33F is conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 15B is conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 12F is conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 10A is conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 11A is conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 8 is conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugates derived from Streptococcus pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F are conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 5, and 7F are conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugates derived from Streptococcus pneumoniae serotypes 6A and 19A are conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 3 is conjugated to CRM. 197 .

[0598] In one embodiment, all glycoconjugates of any of the above-described immunogenic compositions are independently conjugated to CRM. 197 .

[0599] In one embodiment, any of the above-described immunogenic compositions containing glycoconjugates of Streptococcus pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F are independently conjugated to PD.

[0600] In one embodiment, any of the above-described immunogenic compositions contains a glycoconjugate derived from Streptococcus pneumoniae serotype 18C conjugated to TT.

[0601] In one embodiment, any of the above-described immunogenic compositions contains a glycoconjugate derived from Streptococcus pneumoniae serotype 19F conjugate to DT.

[0602] In one embodiment, the glycoconjugates of any of the above-described immunogenic compositions derived from Streptococcus pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F are independently conjugated to PD, the glycoconjugate derived from Streptococcus pneumoniae serotype 18C is conjugated to TT, and the glycoconjugate derived from Streptococcus pneumoniae serotype 19F is conjugated to DT.

[0603] In one embodiment, the immunogenic composition comprises 8 to 20 different Streptococcus pneumoniae serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 12, 13, 14, 15, 16, 17, 18, 19, or 20 different serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 16 or 20 different serotypes.

[0604] In one embodiment, the immunogenic composition is a composition of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20-valent pneumococcal conjugates. In one embodiment, the immunogenic composition is a composition of 14, 15, 16, 17, 18, or 19-valent pneumococcal conjugates. In one embodiment, the immunogenic composition is a composition of 16-valent pneumococcal conjugates. In one embodiment, the immunogenic composition is a composition of 19-valent pneumococcal conjugates.

[0605] 1. In one embodiment, the immunogenic composition of the present invention comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 15B, as disclosed in section 1.3.4 above.

[0606] 2. In another embodiment, the immunogenic composition of the present invention, in addition to point 1 above, further comprises at least one glycoconjugate from Streptococcus pneumoniae serotype 22F, such as those disclosed in section 1.3.2 above.

[0607] 3. In another embodiment, the immunogenic composition of the present invention, in addition to point 1 or 2 above, further comprises at least one glycoconjugate from Streptococcus pneumoniae serotype 33F, such as those disclosed in section 1.3.3 above.

[0608] 4. In another embodiment, the immunogenic composition of the present invention, in addition to points 1, 2 or 3 above, further comprises at least one glycoconjugate from Streptococcus pneumoniae serotype 12F, such as those disclosed in section 1.3.5 above.

[0609] 5. In another embodiment, the immunogenic composition of the present invention, in addition to points 1, 2, 3 or 4 above, further comprises at least one glycoconjugate from Streptococcus pneumoniae serotype 10A, such as those disclosed in section 1.3.6 above.

[0610] 6. In another embodiment, the immunogenic composition of the present invention, in addition to points 1, 2, 3, 4 or 5 above, further comprises at least one glycoconjugate from Streptococcus pneumoniae serotype 11A, such as those disclosed in section 1.3.7 above.

[0611] 7. In another embodiment, the immunogenic composition of the present invention, in addition to points 1, 2, 3, 4, 5 or 6 above, further comprises at least one glycoconjugate derived from Streptococcus pneumoniae serotype 8, such as those disclosed in section 1.3.8 above.

[0612] 8. In another embodiment, the immunogenic composition of the present invention, in addition to points 1, 2, 3, 4, 5, 6 or 7 above, further comprises glycoconjugates from Streptococcus pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, such as the glycoconjugates in section 1.3.1 above.

[0613] 9. In another embodiment, the immunogenic composition of the present invention, in addition to points 1, 2, 3, 4, 5, 6, 7 or 8 above, further comprises glycoconjugates from Streptococcus pneumoniae serotypes 1, 5, and 7F, such as the glycoconjugates described in section 1.3.1 above.

[0614] 10. In another embodiment, the immunogenic composition of the present invention, in addition to points 1, 2, 3, 4, 5, 6, 7, 8 or 9 above, further comprises glycoconjugates from Streptococcus pneumoniae serotypes 6A and 19A, such as the glycoconjugates described in section 1.3.1 above.

[0615] 11. In another embodiment, the immunogenic composition of the present invention, in addition to points 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 above, further comprises a glycoconjugate from Streptococcus pneumoniae serotype 3, such as the glycoconjugate in section 1.3.1 above.

[0616] In one embodiment, the immunogenic composition of the present invention comprises glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0617] In one embodiment, the immunogenic composition of the present invention comprises glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0618] In one embodiment, the immunogenic composition of the present invention comprises conjugated pneumococcal sugars from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.

[0619] In one embodiment, the immunogenic composition of the present invention comprises conjugated pneumococcal sugars from serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.

[0620] In one embodiment, the glycoconjugate of the immunogenic composition of the present invention comprises glycoconjugates derived from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F. In another embodiment, the glycoconjugate of the immunogenic composition of the present invention comprises glycoconjugates derived from serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F. In yet another embodiment, the glycoconjugate of the immunogenic composition of the present invention comprises glycoconjugates derived from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F. In one embodiment, the glycoconjugate of the immunogenic composition of the present invention comprises glycoconjugates from 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.

[0621] Preferably, all glycoconjugates of the immunogenic composition of the present invention (e.g., any of points 1-11 above) are independently conjugated to the carrier protein.

[0622] In one embodiment, the glycoconjugates from Streptococcus pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F at any of points 8-11 above are independently conjugated to PD.

[0623] In one embodiment, the glycoconjugate from Streptococcus pneumoniae serotype 18C at any of points 8-11 above is conjugated to TT.

[0624] In one embodiment, the glycoconjugate from Streptococcus pneumoniae serotype 19F at any of points 8-11 above is conjugated to DT.

[0625] In any of the embodiments described in points 8-11 above, glycoconjugates from Streptococcus pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F are independently conjugated to PD, glycoconjugates from Streptococcus pneumoniae serotype 18C are conjugated to TT and glycoconjugates from Streptococcus pneumoniae serotype 19F are conjugated to DT.

[0626] In any of the embodiments described in points 1-11 above, the glycoconjugate from Streptococcus pneumoniae serotype 22F is conjugated to CRM. 197 In any of the embodiments described in points 2-11 above, the glycoconjugate from Streptococcus pneumoniae serotype 33F is conjugated to CRM. 197 In any of the embodiments described in points 3-11 above, the glycoconjugate from Streptococcus pneumoniae serotype 15B is conjugated to CRM. 197 In any of the embodiments described in points 4-11 above, the glycoconjugate from Streptococcus pneumoniae serotype 12F is conjugated to CRM. 197 In any of the embodiments described in points 5-11 above, the glycoconjugate from Streptococcus pneumoniae serotype 10A is conjugated to CRM. 197 In any of the embodiments described in points 6-11 above, the glycoconjugate from Streptococcus pneumoniae serotype 11A is conjugated to CRM. 197 In any of the embodiments described in points 7-11 above, the glycoconjugate from Streptococcus pneumoniae serotype 8 is conjugated to CRM. 197 In any of the embodiments described in points 8-11 above, glycoconjugates from Streptococcus pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F are conjugated to CRM. 197 In any of the embodiments described in points 9-11 above, glycoconjugates from Streptococcus pneumoniae serotypes 1, 5, and 7F are conjugated to CRM. 197 In any of the embodiments described in points 10-11 above, glycoconjugates from Streptococcus pneumoniae serotypes 6A and 19A are conjugated to CRM. 197 In the embodiment described in point 11 above, a glycoconjugate derived from Streptococcus pneumoniae serotype 3 is conjugated to CRM. 197 .

[0627] In one embodiment, the glycoconjugates of the immunogenic compositions described in points 1-11 above are independently conjugated to CRM. 197 .

[0628] In one embodiment, the immunogenic composition of the present invention comprises 12-20 different serotypes of Streptococcus pneumoniae. In one embodiment, the immunogenic composition of the present invention comprises glycoconjugates from 12, 13, 14, 15, 16, 17, 18, 19, or 20 different serotypes. In one embodiment, the immunogenic composition of the present invention comprises glycoconjugates from 16 or 20 different serotypes.

[0629] In one embodiment, the immunogenic compositions described in points 1 to 11 are compositions of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20-valent pneumococcal conjugates. In one embodiment, the immunogenic compositions described in points 1 to 11 are compositions of 15, 16, 17, 18, or 19-valent pneumococcal conjugates. In one embodiment, the immunogenic compositions described in points 1 to 11 are compositions of 16-valent pneumococcal conjugates. In one embodiment, the immunogenic compositions described in points 1 to 11 are compositions of 19-valent pneumococcal conjugates.

[0630] After the capsular polysaccharide is conjugated to the carrier protein, the glycoconjugate is purified (enriching the amount of the polysaccharide-protein conjugate) using various techniques. These techniques include concentration / percolation, precipitation / elution, column chromatography, and deep filtration (see, for example, U.S. Patent Application Publication No. 2007 / 0184072 or WO 2008 / 079653). After the individual glycoconjugates are purified, they are mixed to formulate the immunogenic composition of the present invention.

[0631] 1.5 Other combinations of the sugar conjugates of the present invention

[0632] In any embodiment of the immunogenic composition defined in Section 1.4 above, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 9V is included.

[0633] In embodiments of any immunogenic composition defined in Section 1.4 above, at least one glycoconjugate is included for each of two Streptococcus pneumoniae serotypes selected from the group consisting of: 9V and 4, 9V and 6B, 9V and 14, 9V and 18C, 9V and 19F, and 9V and 23F.

[0634] In any embodiment of the immunogenic composition defined in Section 1.4 above, at least one glycoconjugate of each of the following seven Streptococcus pneumoniae serotypes: 9V, 4, 6B, 14, 18C, 19F and 23F is included.

[0635] In any embodiment of the immunogenic composition defined in Section 1.4 above, at least one glycoconjugate of each of the following eight Streptococcus pneumoniae serotypes is included:

[0636] 9V and 1 and 4 and 6B and 14 and 18C and 19F and 23F,

[0637] 9V and 4 and 5 and 6B and 14 and 18C and 19F and 23F, or

[0638] 9V and 4 and 6B and 7F and 14 and 18C and 19F and 23F.

[0639] In any embodiment of the immunogenic composition defined in Section 1.4 above, at least one glycoconjugate of each of the following ten Streptococcus pneumoniae serotypes: 9V, 1, 5, 4, 6B, 7F, 14, 18C, 19F and 23F.

[0640] In any embodiment of the immunogenic composition defined in Section 1.4 above, at least one glycoconjugate of each of the following eleven Streptococcus pneumoniae serotypes is included:

[0641] 9V and 1 and 4 and 5 and 6A and 6B and 7F and 14 and 18C and 19F and 23F or

[0642] 9V and 1 and 4 and 5 and 6B and 7F and 14 and 18C and 19A and 19F and 23F.

[0643] In any embodiment of the immunogenic composition defined in Section 1.4 above, at least one glycoconjugate of each of the following twelve Streptococcus pneumoniae serotypes: 9V, 1, 4, 5, 6A, 6B, 7F, 14, 18C, 19A, 19F, and 23F.

[0644] In any embodiment of the immunogenic composition defined in Section 1.4 above, at least one glycoconjugate of each of the following thirteen Streptococcus pneumoniae serotypes is included: 9V, 1, 3, 4, 5, 6A, 6B, 7F, 14, 18C, 19A, 19F, and 23F.

[0645] In embodiments of any immunogenic composition defined in Section 1.4 above, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 2 is further included.

[0646] In embodiments of any immunogenic composition defined in Section 1.4 above, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 17F is further included.

[0647] In embodiments of any immunogenic composition defined in Section 1.4 above, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 20 is further included.

[0648] In embodiments of any immunogenic composition defined in Section 1.4 above, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 15C is further included.

[0649] In embodiments of any immunogenic composition defined in Section 1.4 above, at least one glycoconjugate derived from Streptococcus pneumoniae serotype 9N is also included.

[0650] Preferably, all glycoconjugates of the above-described immunogenic composition are independently conjugated to the carrier protein.

[0651] In any embodiment of the above-described immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 9V is conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugates derived from Streptococcus pneumoniae serotypes 4, 6B, 14, 18C, 19F, and 23F are conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 5, and 7F are conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugates derived from Streptococcus pneumoniae serotypes 6A and 19A are conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 3 is conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 2 is conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 17F is conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 20 is conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 15C is conjugated to CRM. 197 In any embodiment of the above-described immunogenic composition, the glycoconjugate derived from Streptococcus pneumoniae serotype 9N is conjugated to CRM. 197 .

[0652] In one embodiment, all the glycoconjugates of the above-mentioned immunogenic composition are independently conjugated to CRM. 197 .

[0653] In another embodiment, any of the above-described immunogenic compositions containing a glycoconjugate derived from Streptococcus pneumoniae serotype 9V is independently conjugated to PD.

[0654] In one embodiment, any of the above-described immunogenic compositions containing glycoconjugates of Streptococcus pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F are independently conjugated to PD.

[0655] In one embodiment, any of the above-described immunogenic compositions contains a glycoconjugate derived from Streptococcus pneumoniae serotype 18C conjugated to TT.

[0656] In one embodiment, any of the above-described immunogenic compositions contains a glycoconjugate derived from Streptococcus pneumoniae serotype 19F conjugate to DT.

[0657] In one embodiment, glycoconjugates of any of the above-described immunogenic compositions derived from Streptococcus pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F are independently conjugated to PD, glycoconjugates derived from Streptococcus pneumoniae serotype 18C are conjugated to TT and glycoconjugates derived from Streptococcus pneumoniae serotype 19F are conjugated to DT.

[0658] In one embodiment, the immunogenic composition comprises 7 to 25 different Streptococcus pneumoniae serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 different serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 16 or 20 different serotypes.

[0659] In one embodiment, the immunogenic composition is a composition of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20-valent pneumococcal conjugates. In one embodiment, the immunogenic composition is a composition of 14, 15, 16, 17, 18, or 19-valent pneumococcal conjugates. In one embodiment, the immunogenic composition is a composition of 16-valent pneumococcal conjugates. In one embodiment, the immunogenic composition is a composition of 19-valent pneumococcal conjugates. In one embodiment, the immunogenic composition is a composition of 20-valent pneumococcal conjugates.

[0660] After the capsular polysaccharide is conjugated to the carrier protein, the glycoconjugate is purified (enriching the amount of the polysaccharide-protein conjugate) using various techniques. These techniques include concentration / percolation, precipitation / elution, column chromatography, and deep filtration (see, for example, U.S. Patent Application Publication No. 2007 / 0184072 or WO 2008 / 079653). After the individual glycoconjugates are purified, they are mixed to formulate the immunogenic composition of the present invention.

[0661] 1.6 Specific Combinations of Sugar Conjugates of the Invention

[0662] In any embodiment of the immunogenic composition defined in Section 1.4 or 1.5 above, there is no capsular sugar derived from Streptococcus pneumoniae serotype 9N.

[0663] In any embodiment of the immunogenic composition defined in Section 1.4 or 1.5 above, there is no capsular sugar derived from Streptococcus pneumoniae serotype 9A.

[0664] In any embodiment of the immunogenic composition defined in Section 1.4 or 1.5 above, there is no capsular sugar derived from Streptococcus pneumoniae serotype 9L.

[0665] In any embodiment of the immunogenic composition defined in Section 1.4 or 1.5 above, there is no capsular sugar derived from Streptococcus pneumoniae serotypes 9N and 9A.

[0666] In any embodiment of the immunogenic composition defined in Section 1.4 or 1.5 above, there is no capsular sugar derived from Streptococcus pneumoniae serotypes 9N and 9L.

[0667] In any embodiment of the immunogenic composition defined in Section 1.4 or 1.5 above, there is no capsular sugar derived from Streptococcus pneumoniae serotypes 9A and 9L.

[0668] In any embodiment of the immunogenic composition defined in Section 1.4 or 1.5 above, capsular sugars derived from Streptococcus pneumoniae serotypes 9N, 9A, and 9L are not included.

[0669] 2. Dosage of the immunogenic composition

[0670] The amount of glycoconjugate in each dose is chosen such that it induces a protective immune response in typical vaccine recipients without significant adverse side effects. This amount will vary depending on the specific immunogen used and how it is presented.

[0671] 2.1 Amount of glycoconjugate

[0672] The amount of a specific glycoconjugate in an immunogenic composition can be calculated based on the total polysaccharide content of that conjugate (conjugated and unconjugated). For example, a glycoconjugate with 20% free polysaccharide will have approximately 80 μg of conjugated polysaccharide and approximately 20 μg of unconjugated polysaccharide in a 100 μg polysaccharide dose. The amount of glycoconjugate can vary depending on the pneumococcal serotype. The sugar concentration can be determined by uronic acid assay.

[0673] The “immunogenic amount” of different polysaccharide components in the immunogenic composition may vary, and each may contain approximately 1 μg, approximately 2 μg, approximately 3 μg, approximately 4 μg, approximately 5 μg, approximately 6 μg, approximately 7 μg, approximately 8 μg, approximately 9 μg, approximately 10 μg, approximately 15 μg, approximately 20 μg, approximately 30 μg, approximately 40 μg, approximately 50 μg, approximately 60 μg, approximately 70 μg, approximately 80 μg, approximately 90 μg, or approximately 100 μg of any specific polysaccharide antigen.

[0674] Generally, each dose will contain 0.1 μg to 100 μg of polysaccharide for a given serotype, particularly 0.5 μg to 20 μg, more particularly 1.0 μg to 10 μg, and more particularly 2.0 μg to 5.0 μg. Any integer within any of the foregoing ranges is considered an embodiment of this disclosure.

[0675] In one embodiment, each dose contains about 1.0 μg, about 1.2 μg, about 1.4 μg, about 1.6 μg, about 1.8 μg, about 2.0 μg, about 2.2 μg, about 2.4 μg, about 2.6 μg, about 2.8 μg, about 3.0 μg, about 3.2 μg, about 3.4 μg, about 3.6 μg, about 3.8 μg, about 4.0 μg, about 4.2 μg, about 4.4 μg, about 4.6 μg, about 4.8 μg, about 5.0 μg, about 5.2 μg, about 5.4 μg, about 5.6 μg, about 5.8 μg, or about 6.0 μg of polysaccharide for each specific glycoconjugate.

[0676] In one embodiment, each dose of the glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and / or 33F comprises approximately 1.1 μg, approximately 1.2 μg, approximately 1.3 μg, approximately 1.4 μg, approximately 1.5 μg, approximately 1.6 μg, approximately 1.7 μg, approximately 1.8 μg, approximately 1.9 μg, approximately 2.0 μg, approximately 2.1 μg, approximately 2.2 μg, approximately 2.3 μg, approximately 2.4 μg, approximately 2.5 μg, approximately 2.6 μg, approximately 2.7 μg, approximately 2.8 μg, approximately 2.9 μg, or approximately 3.0 μg of polysaccharide.

[0677] In one embodiment, each dose of the glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and / or 33F comprises approximately 1.1 μg, approximately 1.2 μg, approximately 1.3 μg, approximately 1.4 μg, approximately 1.5 μg, approximately 1.6 μg, approximately 1.7 μg, approximately 1.8 μg, approximately 1.9 μg, approximately 2.0 μg, approximately 2.1 μg, approximately 2.2 μg, approximately 2.3 μg, approximately 2.4 μg, approximately 2.5 μg, approximately 2.6 μg, approximately 2.7 μg, approximately 2.8 μg, approximately 2.9 μg, or approximately 3.0 μg of polysaccharide.

[0678] In one embodiment, each dose of the glycoconjugate derived from Streptococcus pneumoniae serotype 6B contains approximately 2.0 μg, approximately 2.2 μg, approximately 2.4 μg, approximately 2.6 μg, approximately 2.8 μg, approximately 3.0 μg, approximately 3.2 μg, approximately 3.4 μg, approximately 3.6 μg, approximately 3.8 μg, approximately 4.0 μg, approximately 4.2 μg, approximately 4.4 μg, approximately 4.6 μg, approximately 4.8 μg, approximately 5.0 μg, approximately 5.2 μg, approximately 5.4 μg, approximately 5.6 μg, approximately 5.8 μg, or approximately 6.0 μg of polysaccharide.

[0679] In one embodiment, each dose of each glycoconjugate from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F contains about 1.5 μg to about 3.0 μg of polysaccharide, and the glycoconjugate from Streptococcus pneumoniae serotype 6B contains about 3.0 μg to about 6.0 μg of polysaccharide.

[0680] In one embodiment, each dose contains about 2.0 μg to about 2.5 μg of polysaccharide for each glycoconjugate from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and for the glycoconjugate from Streptococcus pneumoniae serotype 6B, it contains about 4.0 μg to about 4.8 μg of polysaccharide.

[0681] In one embodiment, each dose contains approximately 2.2 μg of polysaccharide for each glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and approximately 4.4 μg of polysaccharide for the glycoconjugate derived from Streptococcus pneumoniae serotype 6B.

[0682] In one embodiment, each dose contains about 1.5 μg to about 3.0 μg of polysaccharide for each glycoconjugate from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and for the glycoconjugate from Streptococcus pneumoniae serotype 6B, it contains about 3 μg to about 6 μg of polysaccharide.

[0683] In one embodiment, each dose contains about 2.0 μg to about 2.5 μg of polysaccharide for each glycoconjugate from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and for the glycoconjugate from Streptococcus pneumoniae serotype 6B, it contains about 4.0 μg to about 4.8 μg of polysaccharide.

[0684] In one embodiment, each dose contains approximately 2.2 μg of polysaccharide for each glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and approximately 4.4 μg of polysaccharide for the glycoconjugate derived from Streptococcus pneumoniae serotype 6B.

[0685] In one embodiment, each dose contains about 1.5 μg to about 3.0 μg of polysaccharide for each glycoconjugate from Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and for the glycoconjugate from Streptococcus pneumoniae serotype 6B, it contains about 3.0 μg to about 6.0 μg of polysaccharide.

[0686] In one embodiment, each dose contains about 2.0 μg to about 2.5 μg of polysaccharide for each glycoconjugate from Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and for the glycoconjugate from Streptococcus pneumoniae serotype 6B, it contains about 4.0 μg to about 4.8 μg of polysaccharide.

[0687] In one embodiment, each dose contains approximately 2.2 μg of polysaccharide for each glycoconjugate derived from Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and approximately 4.4 μg of polysaccharide for the glycoconjugate derived from Streptococcus pneumoniae serotype 6B.

[0688] In one embodiment, each dose contains about 1.5 μg to about 3.0 μg of polysaccharide for each glycoconjugate from Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and for the glycoconjugate from Streptococcus pneumoniae serotype 6B, it contains about 3.0 μg to about 6.0 μg of polysaccharide.

[0689] In one embodiment, each dose contains about 2.0 μg to about 2.5 μg of polysaccharide for each glycoconjugate from Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and for the glycoconjugate from Streptococcus pneumoniae serotype 6B, it contains about 4.0 μg to about 4.8 μg of polysaccharide.

[0690] In one embodiment, each dose of the glycoconjugates derived from Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F contains approximately 2.2 μg of polysaccharide, and the glycoconjugate derived from Streptococcus pneumoniae serotype 6B contains approximately 4.4 μg of polysaccharide.

[0691] 2.2 Amount of carrier

[0692] Generally, each dose will contain 10 μg to 150 μg of carrier protein, particularly 15 μg to 100 μg of carrier protein, more particularly 25 μg to 75 μg of carrier protein, and more particularly 40 μg to 60 μg of carrier protein. In one embodiment, the carrier protein is CRM. 197 .

[0693] In one embodiment, each dose comprises approximately 25 μg, approximately 26 μg, approximately 27 μg, approximately 28 μg, approximately 29 μg, approximately 30 μg, approximately 31 μg, approximately 32 μg, approximately 33 μg, approximately 34 μg, approximately 35 μg, approximately 36 μg, approximately 37 μg, approximately 38 μg, approximately 39 μg, approximately 40 μg, approximately 41 μg, approximately 42 μg, approximately 43 μg, approximately 44 μg, approximately 45 μg, approximately 46 μg, approximately 47 μg, approximately 48 μg, approximately 49 μg, Approximately 50 μg, approximately 51 μg, approximately 52 μg, approximately 53 μg, approximately 54 μg, approximately 55 μg, approximately 56 μg, approximately 57 μg, approximately 58 μg, approximately 59 μg, approximately 60 μg, approximately 61 μg, approximately 62 μg, approximately 63 μg, approximately 64 μg, approximately 65 μg, approximately 66 μg, approximately 67 μg, approximately 68 μg, approximately 69 μg, approximately 70 μg, approximately 71 μg, approximately 72 μg, approximately 73 μg, approximately 74 μg, or approximately 75 μg of carrier protein. In one embodiment, the carrier protein is CRM. 197 .

[0694] 3. Other antigens

[0695] The immunogenic compositions of the present invention comprise conjugated Streptococcus pneumoniae glycoantigens (glycoconjugates). They may also include antigens from other pathogens, particularly bacteria and / or viruses. Preferred additional antigens are selected from: diphtheria toxoid (D), tetanus toxoid (T), pertussis antigen (P) which is generally noncellular (Pa), hepatitis B virus (HBV) surface antigen (HBsAg), hepatitis A virus (HAV) antigen, conjugated Haemophilus influenzae type b capsular sugar (Hib), and inactivated poliovirus vaccine (IPV).

[0696] In one embodiment, the immunogenic composition of the present invention comprises DT-Pa. In one embodiment, the immunogenic composition of the present invention comprises DT-Pa-Hib, DT-Pa-IPV, or DT-Pa-HBsAg. In one embodiment, the immunogenic composition of the present invention comprises DT-Pa-HBsAg-IPV or DT-Pa-HBsAg-Hib. In one embodiment, the immunogenic composition of the present invention comprises DT-Pa-HBsAg-IPV-Hib.

[0697] Pertussis antigen: Bordetella pertussis causes pertussis. The pertussis antigen in the vaccine is cellular (in the form of intact cells or inactivated Bordetella pertussis cells) or acellular. The preparation of cellular pertussis antigens is well documented (e.g., it can be obtained by heat inactivation of phase I cultures of Bordetella pertussis). However, the present invention preferably uses acellular antigens. When using acellular antigens, it is preferred to use one, two, or (preferably) three or fewer antigens: (1) detoxified pertussis toxin (pertussis toxoid, or PT); (2) filamentous hemagglutinin (FHA); (3) Bordetella pertussis adhesin (also known as a 69 kDa outer membrane protein). FHA and Bordetella pertussis adhesin can be treated with formaldehyde before use according to the present invention. PT is preferably detoxified by treatment with formaldehyde and / or glutaraldehyde. Acellular pertussis antigens are preferably adsorbed onto one or more aluminum salt adjuvants. Alternatively, they can be added in an unadsorbed state. When Bordetella pertussis adhesin is added, it is preferably already adsorbed onto the aluminum hydroxide adjuvant. PT and FHA can be adsorbed onto either aluminum hydroxide or aluminum phosphate adjuvant. Most preferably, PT, FHA, and Bordetella pertussis adhesin are all adsorbed onto the aluminum hydroxide.

[0698] Inactivated Poliovirus Vaccine: Poliovirus causes poliomyelitis. A preferred embodiment of the invention uses IPV instead of an oral poliovirus vaccine. Before administration to a patient, the poliovirus must be inactivated, which can be achieved by treatment with formaldehyde. Polio can be caused by one of three types of poliovirus. These three types are similar and cause the same symptoms, but they are antigenically different, and infection with one type does not protect against infection with the others. Therefore, in this invention, three poliovirus antigens are preferably used: poliovirus type 1 (e.g., Mahoney strain), poliovirus type 2 (e.g., MEF-1 strain), and poliovirus type 3 (e.g., Saukett strain). The virus is preferably cultured, purified, and inactivated separately, and then recombined to provide a large quantity of trivalent mixtures for use in this invention.

[0699] Diphtheria toxoid: Corynebacterium diphtheriae causes diphtheria. Diphtheria toxoids can be treated (e.g., with formalin or formaldehyde) to remove toxicity while retaining the ability to induce specific antitoxin antibodies after injection. These diphtheria toxoids are used in diphtheria vaccines. Preferred diphtheria toxoids are those prepared by formaldehyde treatment. Diphtheria toxoids can be obtained by growing Corynebacterium diphtheriae in a growth medium, followed by formaldehyde treatment, ultrafiltration, and precipitation. The toxoid-treated material can then be processed by methods including sterile filtration and / or dialysis. Preferredly, diphtheria toxoids are adsorbed onto aluminum hydroxide adjuvant.

[0700] Tetanus toxoid: Clostridium tetani causes tetanus. Tetanus toxoid can be processed to provide a protective toxoid. This toxoid is used in tetanus vaccines. Preferred tetanus toxoids are those prepared by formaldehyde treatment. Tetanus toxoid can be obtained by growing Clostridium tetani in a growth medium, followed by formaldehyde treatment, ultrafiltration, and precipitation. The material can then be processed by methods including sterile filtration and / or dialysis.

[0701] Hepatitis A virus antigen: Hepatitis A virus (HAV) is a known substance that causes viral hepatitis. The preferred HAV component is based on inactivated virus, and inactivation can be achieved through formalin treatment.

[0702] Hepatitis B virus (HBV) is a known substance that causes viral hepatitis. The main component of its capsid is a protein known as the HBV surface antigen (or more commonly HBsAg), which is typically a 226-amino acid polypeptide with a molecular weight of ~24 kDa. All existing hepatitis B vaccines contain HBsAg, and when this antigen is administered to regularly vaccinated individuals, it stimulates the production of anti-HBsAg antibodies that prevent HBV infection.

[0703] For vaccine preparation, HBsAg has been prepared in two ways: by purifying a specific form of antigen from the plasma of chronic hepatitis B carriers or by expressing the protein via recombinant DNA methods (e.g., recombinant expression in yeast cells). Unlike natural HBsAg (i.e., the plasma-purified product), yeast-expressed HBsAg is typically non-glycosylated, and this is the most preferred form of HBsAg used in this invention.

[0704] Conjugated Haemophilus influenzae type b antigen: Haemophilus influenzae type b (Hib) causes bacterial meningitis. Hib vaccines are typically based on capsular sugar antigens, the preparation of which is well documented. Hib sugars can conjugate to carrier proteins to enhance their immunogenicity, especially in children. Typical carrier proteins include tetanus toxoid, diphtheria toxoid, and CRM. 197 The conjugate contains Haemophilus influenzae protein D and an outer membrane protein complex derived from group B meningococcus. The sugar moiety of the conjugate may comprise a fragment of full-length phosphoproteosidelan (PRP, such as that prepared from Hib bacteria) and / or a fragment of full-length PRP. The Hib conjugate may or may not adsorb to the aluminum salt adjuvant.

[0705] In one embodiment, the immunogenic composition of the present invention further comprises conjugated meningococcal serogroup Y capsule (MenY) and / or conjugated meningococcal serogroup C capsule (MenC).

[0706] In one embodiment, the immunogenic composition of the present invention further comprises conjugated meningococcal serogroup A capsule (MenA), conjugated meningococcal serogroup W135 capsule (MenW135), conjugated meningococcal serogroup Y capsule (MenY), and / or conjugated meningococcal serogroup C capsule (MenC).

[0707] In one embodiment, the immunogenic composition of the present invention further comprises conjugated meningococcal serological group W135 capsule (MenW135), conjugated meningococcal serological group Y capsule (MenY), and / or conjugated meningococcal serological group C capsule (MenC).

[0708] 4. Adjuvants

[0709] In some embodiments, the immunogenic compositions disclosed herein may further comprise at least one, two, or three adjuvants. The term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. The antigen may primarily serve as a delivery system, primarily as an immunomodulator, or possess both of these strong characteristics. Suitable adjuvants include those applicable to mammals, including humans.

[0710] Known examples of adjuvants suitable for human delivery systems include, but are not limited to: aluminum (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide), calcium phosphate, liposomes, oil-in-water emulsions such as MF59 (4.3% w / v squalene, 0.5% w / v polysorbate 80 (Tween 80), 0.5% w / v sorbitan trioleate (Span 85)), water-in-oil emulsions such as Montanide, and poly(D,L-lactide-co-glycolic acid) (PLG) microparticles or nanoparticles.

[0711] In one embodiment, the immunogenic compositions disclosed herein comprise an aluminum salt (aluminum) as an adjuvant (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide). In a preferred embodiment, the immunogenic compositions disclosed herein comprise aluminum phosphate or aluminum hydroxide as an adjuvant. In one embodiment, the immunogenic compositions disclosed herein comprise elemental aluminum in the form of aluminum phosphate at a concentration of 0.1 mg / mL to 1 mg / mL or 0.2 mg / mL to 0.3 mg / mL. In one embodiment, the immunogenic compositions disclosed herein comprise elemental aluminum in the form of aluminum phosphate at a concentration of approximately 0.25 mg / mL.

[0712] Known examples of adjuvants suitable for human immunomodulation include, but are not limited to, saponin extracts from the bark of the Aquilla tree (QS21, Quil A), TLR4 agonists such as MPL (monosolipin A), 3DMPL (3-O-deacetylated MPL) or GLA-AQ, LT / CT mutants, cytokines such as various interleukins (e.g., IL-2, IL-12) or GM-CS, and similar.

[0713] Known examples of suitable immunomodulatory adjuvants for human use (with delivery and immunomodulatory characteristics) include, but are not limited to, ISCOMS (see example...). (1998) J. Leukocyte Biol. 64:713; WO 90 / 03184, WO 96 / 11711, WO 00 / 48630, WO 98 / 36772, WO 00 / 41720, WO 2006 / 134423 and WO2007 / 026190) or GLA-EM, which is a combination of TLR4 agonist and oil-in-water emulsion.

[0714] For veterinary applications (including but not limited to animal testing), Freund's complete adjuvant (CFA), Freund's incomplete adjuvant (IFA), Emulsigen, N-acetyl-murayl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-murayl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N-acetyl-murayl-L-alanyl-D-isoglutamine acyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycerol-3-hydroxyphosphoyloxy)-ethylamine (CGP 19835A, referred to as MTP-PE), and RIBI, which contain three components extracted from bacteria: monophosphate lipid A, trehalose dimethicone ester, and cell wall skeleton (MPL+TDM+CWS, in 2% squalene / Tween 80 emulsion), can be used.

[0715] Other exemplary adjuvants for enhancing the efficacy of the pneumococcal vaccines disclosed herein include, but are not limited to: (1) oil-in-water emulsion formulations (with or without other specific immunostimulants such as muramyl peptides (see below) or bacterial cell wall components), such as (a) SAF, containing 10% squalane, 0.4% Tween 80, 5% Pranic-blocked polymer L121, and thr-MDP (microfluidized into a submicron emulsion or vortexed to produce an emulsion with a larger particle size), and (b) RIBI. TMThe adjuvant system (RAS) (Ribi Immunochem, Hamilton, MT) contains 2% squalene, 0.2% Tween 80, and one or more bacterial cell wall components such as lipid monophosphate A (MPL), trehalose dimethicone (TDM), and cell wall skeleton (CWS), preferably MPL+CWS (DETOX). TM (2) Saponin adjuvants, such as QS21, STIMULON. TM (Cambridge Bioscience, Worcester, MA), (Isconova, Sweden), or (Commonwealth Serum Laboratories, Australia), or particles produced therefrom such as ISCOM (immunostimulatory complexes), which may lack additional detergents (e.g., WO 00 / 07621); (3) Freund's complete adjuvant (CFA) and Freund's incomplete adjuvant (IFA); (4) cytokines such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 (e.g., WO 99 / 44636)), interferons (e.g., gamma interferon), macrophage colony-stimulating factor (M-CSF), tumor necrosis factor (TNF), etc.; (5) monophospholipid A (MPL) or 3-O-deacetylated MPL (3dMPL) (see, for example, GB-2220221, EP0689454), optionally substantially lacking aluminum when used with pneumococcal sugar (see, for example, WO (6) Combinations of 3dMPL with, for example, QS21 and / or oil-in-water emulsions (see, for example, EP0835318, EP0735898, EP0761231); (7) Polyoxyethylene ethers or polyoxyethylene esters (see, for example, WO 99 / 52549); (8) Polyoxyethylene sorbitan ester surfactants combined with octylbenzyl alcohol (e.g., WO 01 / 21207) or polyoxyethylene alkyl ethers or ester surfactants combined with at least one additional nonionic surfactant such as octylbenzyl alcohol (e.g., WO 01 / 21152); (9) Saponins and immunostimulatory oligonucleotides (e.g., CpG oligonucleotides) (e.g., WO 00 / 62800); (10) Immunostimulants and metal salt particles (see, for example, WO 00 / 23105); (11) Saponins and oil-in-water emulsions (e.g., WO 00 / 56358); (99 / 11241); (12) saponins (e.g., QS21) + 3dMPL + IM2 (optional + sterol) (e.g., WO 98 / 57659); (13) other substances that enhance the efficacy of the composition as immunostimulants. Muramino peptides include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25-acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutamine-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycerol-3-hydroxyphosphoyloxy)-ethylamine (MTP-PE), etc.

[0716] In embodiments of the invention, the immunogenic compositions disclosed herein comprise CpG oligonucleotides as adjuvants. As used herein, CpG oligonucleotides refer to immunostimulatory CpG oligodeoxynucleotides (CpG ODNs), and thus these terms are used interchangeably unless otherwise stated. Immunostimulatory CpG oligodeoxynucleotides contain one or more immunostimulatory CpG motifs, which are unmethylated cytosine-guanine dinucleotides, optionally in certain preferred base configurations. The methylation state of the CpG immunostimulatory motif generally refers to the cytosine residue in the dinucleotide. An immunostimulatory oligonucleotide containing at least one unmethylated CpG dinucleotide is an oligonucleotide containing a 5' unmethylated cytosine linked to a 3' guanine via a phosphate bond, and which activates the immune system by binding to Toll-like receptor 9 (TLR-9). In another embodiment, the immunostimulatory oligonucleotide may contain one or more methylated CpG dinucleotides, which will activate the immune system via TLR9 but are not as potent as the unmethylated CpG motif. CpG immunostimulatory oligonucleotides may contain one or more palindromic structures (which may in turn contain CpG dinucleotides). CpG oligonucleotides have been described in numerous granted patents, published patent applications, and other publications, including U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068.

[0717] In embodiments of the present invention, the immunogenic compositions disclosed herein comprise any CpG oligonucleotide described in line 22 of page 3 to line 36 of page 12 of WO 2010 / 125480.

[0718] Different classes of CpG immunostimulatory oligonucleotides have been identified. These are referred to as classes A, B, C, and P, and are described in more detail on page 3, line 22 to page 12, line 36 of WO2010 / 125480. The method of the present invention relates to the use of these different classes of CpG immunostimulatory oligonucleotides.

[0719] In embodiments of the present invention, the immunogenic compositions disclosed herein comprise class A CpG oligonucleotides. Preferably, the class A CpG oligonucleotides of the present invention have the following nucleic acid sequence: 5'GGGGACGACGTCGTGGGGGGG 3' (SEQ ID NO: 1). Some non-limiting examples of class A oligonucleotides include: 5'G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G*G*G*G*G*G 3' (SEQ ID NO: 2); wherein "*" refers to a phosphate thioester bond and "_" refers to a phosphodiester bond.

[0720] In embodiments of the invention, the immunogenic compositions disclosed herein comprise class B CpG oligonucleotides. In one embodiment, the CpG oligonucleotide used in the invention is a class B CpG oligonucleotide represented by at least the following formula: 5'X1X2CGX3X4 3', wherein X1, X2, X3, and X4 are nucleotides. In one embodiment, X2 is adenine, guanine, or thymine. In another embodiment, X3 is cytosine, adenine, or thymine.

[0721] The class B CpG oligonucleotide sequences of this invention are those broadly described above and disclosed in WO 96 / 02555, WO 98 / 18810 and U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116 and 6,339,068. Exemplary sequences include, but are not limited to, those co-disclosed in these applications and patents.

[0722] In one embodiment, the "Class B" CpG oligonucleotide of the present invention has the following nucleic acid sequence:

[0723] 5'TCGTCGTTTTTCGGTGCTTT 3' (SEQ ID NO:3), or

[0724] 5'TCGTCGTTTTTCGGTCGTTTT 3' (SEQ ID NO:4), or

[0725] 5'TCGTCGTTTTGTCGTTTTGTCGTT 3'(SEQ ID NO:5), or

[0726] 5'TCGTCGTTTCGTCGTTTTGTCGTT 3'(SEQ ID NO:6), or

[0727] 5'TCGTCGTTTTGTCGTTTTTTTCGA3' (SEQ ID NO:7).

[0728] In any of these sequences, all bonds may be thiophosphate bonds. In another embodiment, in any of these sequences, one or more bonds may be phosphodiesters, preferably between the "C" and "G" of the CpG motif, thereby producing a semi-soft CpG oligonucleotide. In any of these sequences, ethyl-uridine or halogen may substitute for 5'T; examples of halogen substitution include, but are not limited to, bromo-uridine or iodo-uridine substitution.

[0729] Some non-limiting examples of class B oligonucleotides include:

[0730] 5'T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3'(SEQ ID NO:8), or

[0731] 5'T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T 3'(SEQ ID NO:9), or

[0732] 5'T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'(SEQ ID NO:10), or

[0733] 5'T*C*G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'(SEQ ID NO:11), or

[0734] 5'T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*T*T*T*C*G*A 3' (SEQ ID NO: 12).

[0735] The asterisk (*) represents a thiophosphate bond.

[0736] In embodiments of the present invention, the immunogenic compositions disclosed herein comprise class C CpG oligonucleotides. In one embodiment, the "class C" CpG oligonucleotides of the present invention have the following nucleic acid sequence:

[0737] 5'TCGCGTCGTTCGGCGCGCGCCG 3' (SEQ ID NO:13), or

[0738] 5'TCGTCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO:14), or

[0739] 5'TCGGACGTTCGGCGCGCGCCG 3' (SEQ ID NO:15), or

[0740] 5'TCGGACGTTCGGCGCGCCG 3' (SEQ ID NO:16), or

[0741] 5'TCGCGTCGTTCGGCGCGCCG 3' (SEQ ID NO:17), or

[0742] 5'TCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO:18), or

[0743] 5'TCGACGTTCGGCGCGCCG 3' (SEQ ID NO:19), or

[0744] 5'TCGCGTCGTTCGGCGCCG 3' (SEQ ID NO:20), or

[0745] 5'TCGCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO:21), or

[0746] 5'TCGTCGTTTTCGGCGCGCGCCG 3' (SEQ ID NO:22), or

[0747] 5'TCGTCGTTTTCGGCGGCCGCCG 3' (SEQ ID NO:23), or

[0748] 5'TCGTCGTTTTACGGCGCCGTGCCG 3' (SEQ ID NO:24), or

[0749] 5'TCGTCGTTTCGGCGCGCGCCGT 3' (SEQ ID NO: 25).

[0750] In any of these sequences, all bonds can be thiophosphate bonds. In another embodiment, in any of these sequences, one or more bonds can be phosphodiesters, preferably between the “C” and “G” of the CpG motif, thereby producing a semi-soft CpG oligonucleotide.

[0751] Some non-limiting examples of class C oligonucleotides include:

[0752] 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3'(SEQ ID NO:26), or

[0753] 5'T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3'(SEQ ID NO:27), or

[0754] 5'T*C_G*G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3'(SEQ ID NO:28), or

[0755] 5'T*C_G*G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3'(SEQ ID NO:29), or

[0756] 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3'(SEQ ID NO:30), or

[0757] 5'T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3'(SEQ ID NO:31), or

[0758] 5'T*C_G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3'(SEQ ID NO:32), or

[0759] 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*C*G 3'(SEQ ID NO:33), or

[0760] 5'T*C_G*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3'(SEQ ID NO:34), or

[0761] 5'T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G 3'(SEQ ID NO:35), or

[0762] 5'T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*G*C*C*G*C*C*G 3'(SEQ ID NO:36), or

[0763] 5'T*C*G*T*C_G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G 3'(SEQ ID NO:37), or

[0764] 5'T*C_G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3' (SEQ ID NO: 38).

[0765] The asterisk (*) indicates a thiophosphate bond and the underscore (_) indicates a phosphate diester bond.

[0766] In any of these sequences, ethyl-uridine or halogen may replace 5'T; examples of halogen substitution include, but are not limited to, bromo-uridine or iodo-uridine substitution.

[0767] In embodiments of the present invention, the immunogenic compositions disclosed herein comprise class P CpG oligonucleotides. In one embodiment, the CpG oligonucleotide used in the present invention is a class P CpG oligonucleotide containing a 5' TLR activation domain and at least two palindromic regions, one palindromic region being a 5' palindromic region of at least 6 nucleotides in length and linked to a 3' palindromic region of at least 8 nucleotides in length (directly linked or linked via a spacer), wherein the oligonucleotide comprises at least one YpR dinucleotide. In one embodiment, the oligonucleotide is not T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*G*C*G (SEQ ID NO: 27). In one embodiment, the class P CpG oligonucleotide comprises at least one unmethylated CpG dinucleotide. In another embodiment, the TLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT, or TTTT. In another embodiment, the TLR activation domain is located within a 5' palindromic region. In another embodiment, the TLR activation domain is located immediately adjacent to a 5' palindromic region at its 5' end.

[0768] In one embodiment, the “P-class” CpG oligonucleotide of the present invention has the following nucleic acid sequence: 5'TCGTCGACGATCGGCGCGCGCCG 3' (SEQ ID NO:39).

[0769] In the sequence, all bonds may be thiophosphate bonds. In another embodiment, one or more bonds may be phosphodiesters, preferably between the "C" and "G" of the CpG motif, thus producing a semi-soft CpG oligonucleotide. In any of these sequences, ethyl-uridine or halogen may substitute for 5'T; examples of halogen substitution include, but are not limited to, bromo-uridine or iodo-uridine substitution.

[0770] Non-restrictive examples of class P oligonucleotides include:

[0771] 5'T*C_G*T*C_G*A*C_G*A*T*C_G*G*C*G*C_G*C*G*C*C*G 3' (SEQ ID NO: 40).

[0772] The asterisk (*) indicates a thiophosphate bond, while the underscore (_) indicates a phosphate diester bond.

[0773] In one embodiment, the oligonucleotide comprises at least one phosphate thioester bond. In another embodiment, all bonds between the nucleotides of the oligonucleotide are phosphate thioester bonds. In another embodiment, the oligonucleotide comprises at least one phosphodiester-like bond. In another embodiment, the phosphodiester-like bond is a phosphodiester bond. In another embodiment, a lipophilic group is conjugated to the oligonucleotide. In one embodiment, the lipophilic group is cholesterol.

[0774] In one embodiment, all nucleotides in the CpG oligonucleotides disclosed herein are bonded by phosphodiester bonds (“soft” oligonucleotides, as disclosed in WO 2007 / 026190). In another embodiment, the CpG oligonucleotides of the present invention confer resistance to degradation (e.g., stability). “Stable oligonucleotides” refer to oligonucleotides that are relatively resistant to in vivo degradation (e.g., degradation by exonucleases or endonucleases). Stabilization of nucleic acids can be achieved through backbone modification. Oligonucleotides with phosphothioester bonds provide maximum activity and protection against degradation by intracellular exonucleases or endonucleases.

[0775] The immunostimulatory oligonucleotide may have a chimeric backbone having a combination of phosphodiester and thiophosphate bonds. For the purposes of this invention, a chimeric backbone refers to a partially stable backbone in which at least one bond between nucleotides is a phosphodiester or phosphodiester-like bond, and at least another bond between nucleotides is a stable nucleotide bond, wherein the at least one phosphodiester or phosphodiester-like bond is different from the at least one stable bond. When the phosphodiester bond is preferably located within a CpG motif, such molecules are called “semi-soft,” as described in WO 2007 / 026190.

[0776] Other modified oligonucleotides include phosphodiester, thiophosphate, methylphosphate, methylthiophosphate, dithiophosphate, and / or combinations of p-ethoxy bonds.

[0777] Hybrid framework-modified ODNs can be synthesized as described in WO 2007 / 026190.

[0778] The size of the CpG oligonucleotide (i.e., the number of nucleotide residues along its length) can also contribute to its stimulatory activity. To promote cellular uptake, the CpG oligonucleotides of the present invention preferably have a minimum length of 6 nucleotide residues. Any oligonucleotide larger than 6 nucleotides (even several kb long) can induce an immune response in the presence of sufficient immunostimulatory motifs because longer oligonucleotides degrade intracellularly. In some embodiments, the CpG oligonucleotide is 6 to 100 nucleotides long, preferably 8 to 30 nucleotides. In an important embodiment, the nucleic acids and oligonucleotides of the present invention are not plasmids or expression vectors.

[0779] In one embodiment, the CpG oligonucleotides disclosed herein contain substitutions or modifications, such as those described in paragraphs 134 to 147 of WO 2007 / 026190, in the bases and / or sugars.

[0780] In one embodiment, the CpG oligonucleotide of the present invention is chemically modified. Examples of chemical modifications are known to those skilled in the art and are described, for example, in Uhlmann et al. (1990) Chem. Rev. 90:543; S. Agrawal, Ed., Humana Press, Totowa, USA 1993; Crooke et al. (1996) Annu. Rev. Pharmacol. Toxicol. 36:107-129; and Hunziker et al. (1995) Mod. Synth. Methods 7:331-417. The oligonucleotide of the present invention may have one or more modifications, wherein each modification is located at a bridge between specific phosphodiester nucleotides and / or at a specific β-D-ribose unit and / or at a specific native nucleotide base position (compared to an oligonucleotide of the same sequence composed of native DNA or RNA).

[0781] In some embodiments of the present invention, the CpG-containing nucleic acid can be easily mixed with an immunogenic vector according to methods known to those skilled in the art (see, for example, WO 03 / 024480).

[0782] In specific embodiments of the invention, any immunogenic composition disclosed herein comprises 2 μg to 100 mg of CpG oligonucleotides, preferably 0.1 mg to 50 mg of CpG oligonucleotides, preferably 0.2 mg to 10 mg of CpG oligonucleotides, preferably 0.3 mg to 5 mg of CpG oligonucleotides, more preferably 0.5 mg to 2 mg of CpG oligonucleotides, and more preferably 0.75 mg to 1.5 mg of CpG oligonucleotides. In a preferred embodiment, any immunogenic composition disclosed herein comprises approximately 1 mg of CpG oligonucleotides.

[0783] 5. Preparations

[0784] The immunogenic compositions of the present invention can be formulated in liquid form (i.e., solution or suspension) or lyophilized form. Liquid formulations can be advantageously administered directly from their packaged form and are therefore ideal for injection without the need for reconstitution in an aqueous medium (as is required for the lyophilized compositions of the present invention).

[0785] The formulations of the immunogenic compositions of the present invention can be achieved using methods known in the art. For example, each pneumococcal conjugate can be formulated with a physiologically acceptable carrier to prepare the composition. Examples of such carriers include, but are not limited to, water, buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol), and dextran solutions.

[0786] This disclosure provides for such immunogenic compositions comprising any combination of the glycoconjugates disclosed herein, as well as pharmaceutically acceptable excipients, carriers, or diluents.

[0787] In one embodiment, the immunogenic composition of the present invention is in liquid form, preferably in an aqueous liquid form.

[0788] The immunogenic compositions disclosed herein may include one or more of the following: buffer solutions, salts, divalent cations, nonionic detergents, cryoprotectants such as sugars, and antioxidants such as free radical scavengers or chelating agents, or any combination thereof.

[0789] In one embodiment, the immunogenic composition of the present invention comprises a buffer. In one embodiment, the buffer has a pKa of about 3.5 to about 7.5. In some embodiments, the buffer is a phosphate, succinate, histidine, or citrate. In some embodiments, the buffer is a succinate with a final concentration of 1 mM to 10 mM. In a particular embodiment, the final concentration of the succinate buffer is about 5 mM.

[0790] In one embodiment, the immunogenic composition of the present invention comprises a salt. In some embodiments, the salt is selected from the group consisting of magnesium chloride, potassium chloride, sodium chloride, and combinations thereof. In a particular embodiment, the salt is sodium chloride. In a particular embodiment, the immunogenic composition of the present invention comprises 150 mM sodium chloride.

[0791] In one embodiment, the immunogenic composition of the present invention comprises a surfactant. In one embodiment, the surfactant is selected from the group consisting of polysorbate 20 (TWEEN). TM 20) Polysorbate 40 (TWEEN) TM 40) Polysorbate 60 (TWEEN)TM 60), Polysorbate 65 (TWEEN) TM 65), Polysorbate 80 (TWEEN) TM 80), Polysorbate 85 (TWEEN) TM 85) TRITON TM N-101, TRITON TM X-100, Octylbenzyl alcohol 40, Nonylbenzyl alcohol-9, Triethanolamine, Triethanolamine polypeptide oleate, Polyoxyethylene-660 hydroxystearate (PEG-15, Solutol H 15), Polyoxyethylene-35-ricinoleate ( The surfactant is polysorbate 80. In some embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.0001% to 10% by weight (w / w) of polysorbate 80. In some embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.001% to 1% by weight (w / w) of polysorbate 80. In some embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.01% to 1% by weight (w / w) of polysorbate 80. In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% (w / w) of polysorbate 80. In another embodiment, the final concentration of polysorbate 80 in the formulation is 1% (w / w) of polysorbate 80.

[0792] In some embodiments, the immunogenic composition of the present invention has a pH of 5.5 to 7.5, more preferably 5.6 to 7.0, and even more preferably 5.8 to 6.0.

[0793] In one embodiment, the invention provides a container filled with any of the immunogenic compositions disclosed herein. In one embodiment, the container is selected from the group consisting of vials, syringes, flasks, fermenters, bioreactors, bags, cans, ampoules, boxes, and disposable pens. In some embodiments, the container is siliconized.

[0794] In one embodiment, the container of the present invention is made of glass, metal (e.g., steel, stainless steel, aluminum, etc.) and / or polymer (e.g., thermoplastic, elastomer, thermoplastic elastomer). In one embodiment, the container of the present invention is made of glass.

[0795] In one embodiment, the present invention provides a syringe filled with any of the immunogenic compositions disclosed herein. In some embodiments, the syringe is siliconized and / or made of glass.

[0796] The immunogenic composition of the present invention is typically used in injection at a volume of 0.1 mL to 2 mL, more preferably 0.2 mL to 1 mL, and even more preferably about 0.5 mL.

[0797] Therefore, the containers or injections defined above are filled with any immunogenic composition as defined herein in a volume of 0.1 mL to 2 mL, more preferably 0.2 mL to 1 mL, and even more preferably about 0.5 mL.

[0798] 6. Uses of the immunogenic composition of the present invention

[0799] In one embodiment, the immunogenic compositions disclosed herein are used for pharmaceutical purposes.

[0800] The immunogenic compositions described herein can be used in various therapeutic or preventative approaches to prevent, treat, or alleviate bacterial infections, diseases, or symptoms in a subject. Specifically, the immunogenic compositions described herein can be used to prevent, treat, or alleviate Streptococcus pneumoniae infections, diseases, or symptoms in a subject.

[0801] Therefore, in one aspect, the present invention provides a method for preventing, treating or alleviating an infection, disease or symptom associated with Streptococcus pneumoniae in a subject, comprising administering to the subject an immunologically effective amount of the immunogenic composition of the present invention.

[0802] In some such implementations, the infection, disease, or symptom is selected from the group consisting of: pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, empyema, conjunctivitis, osteomyelitis, purulent arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess.

[0803] In one embodiment, the present invention provides a method for inducing an immune response against Streptococcus pneumoniae in a subject, comprising administering an immunologically effective amount of the immunogenic composition of the present invention to the subject.

[0804] In one embodiment, the immunogenic composition disclosed herein is used as a vaccine. In such embodiments, the immunogenic composition as described herein can be used to prevent infection in a Streptococcus pneumoniae subject. Thus, in one aspect, the present invention provides a method for preventing Streptococcus pneumoniae infection in a subject, comprising administering to the subject an immunologically effective amount of the immunogenic composition of the present invention. In some such embo...

Claims

1. An immunogenic composition comprising a component derived from Streptococcus pneumoniae (… S. pneumoniae A glycoconjugate of serotype 11A, wherein the serotype 11A glycoconjugate comprises a serotype 11A capsular polysaccharide with a molecular weight of 100 kDa to 400 kDa, wherein the serotype 11A glycoconjugate has a molecular weight of 500 kDa to 17500 kDa, wherein the serotype 11A glycoconjugate comprises at least 0.6 mM glycerol per mM serotype 11A capsular polysaccharide and less than 1.0 mM glycerol per mM serotype 11A capsular polysaccharide, wherein the weight ratio of serotype 11A capsular polysaccharide to carrier protein in the serotype 11A glycoconjugate is 0.5 to 1.5, and wherein the carrier protein of the serotype 11A glycoconjugate is CRM. 197 Furthermore, the serum-type 11A glycoconjugate is prepared using reductive amination in an aqueous solvent.

2. The immunogenic composition of claim 1, wherein the weight ratio of serotype 11 A capsular polysaccharide to carrier protein in the serotype 11 A saccharide conjugate is 0.8 to 1.

45.

3. The immunogenic composition of claim 1, wherein the serotype 11 A saccharide conjugate comprises at least 1.8 mM acetate per mM serotype 11 A capsular polysaccharide.

4. The immunogenic composition of claim 1, wherein the serotype 11 A saccharide conjugate comprises at least 2.6 mM acetate per mM serotype 11 A capsular polysaccharide, and less than 3.3 mM acetate per mM serotype 11 A polysaccharide.

5. The immunogenic composition of claim 1, wherein the serotype 11 A saccharide conjugate has a degree of conjugation of 1 to 15.

6. The immunogenic composition of claim 1, wherein the serotype 11 A saccharide conjugate has a degree of conjugation of 2 to 5.

7. The immunogenic composition of claim 1, further comprising a saccharide conjugate from S. pneumoniae serotype 22F.

8. The immunogenic composition of claim 7, further comprising a saccharide conjugate from S. pneumoniae serotype 15B.

9. The immunogenic composition of claim 8, further comprising a saccharide conjugate from S. pneumoniae serotype 33F.

10. The immunogenic composition of claim 9, further comprising a saccharide conjugate from S. pneumoniae serotype 12F.

11. The immunogenic composition of claim 10, further comprising a saccharide conjugate from S. pneumoniae serotype 10A.

12. The immunogenic composition of claim 11, further comprising a saccharide conjugate from S. pneumoniae serotype 8.

13. The immunogenic composition of claim 12, further comprising saccharide conjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F.

14. The immunogenic composition of claim 13, further comprising saccharide conjugates from S. pneumoniae serotypes 1, 5, and 7F.

15. The immunogenic composition of claim 14, further comprising saccharide conjugates from S. pneumoniae serotypes 6A and 19A.

16. The immunogenic composition of claim 15, further comprising at least one saccharide conjugate from S. pneumoniae serotype 3.

17. The immunogenic composition of claim 1, which is a combination of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 valent S. pneumoniae conjugate.

18. The immunogenic composition of claim 17, which is a combination of 20 valent S. pneumoniae conjugate.

19. The immunogenic composition of claim 18, wherein the capsular polysaccharide of the saccharide conjugate is independently conjugated to CRM 197 .

20. The immunogenic composition of claim 17, wherein the capsular polysaccharide of all saccharide conjugates is independently conjugated to CRM 197 .

21. The immunogenic composition of claim 19, wherein each dose comprises 1 to 10 pg of capsular polysaccharide of each serotype.

22. The immunogenic composition of claim 21, wherein each dose comprises 10 pg to 150 pg of carrier protein.

23. The immunogenic composition of claim 21, wherein each dose comprises 25 pg, 26 pg, 27 pg, 28 pg, 29 pg, 30 pg, 31 pg, 32 pg, 33 pg, 34 pg, 35 pg, 36 pg, 37 pg, 38 pg, 39 pg, 40 pg, 41 pg, 42 pg, 43 pg, 44 pg, 45 pg, 46 pg, 47 pg, 48 pg, 49 pg, 50 pg, 51 pg, 52 pg, 53 pg, 54 pg, 55 pg, 56 pg, 57 pg, 58 pg, 59 pg, 60 pg, 61 pg, 62 pg, 63 pg, 64 pg, 65 pg, 66 pg, 67 pg, 68 pg, 69 pg, 70 pg, 71 pg, 72 pg, 73 pg, 74 pg, or 75 pg of carrier protein.

24. The immunogenic composition of claim 19, wherein the immunogenic composition further comprises at least one adjuvant.

25. The immunogenic composition of claim 22, wherein the immunogenic composition further comprises at least one adjuvant selected from the group consisting of aluminum phosphate, aluminum sulfate, and aluminum hydroxide.

26. The immunogenic composition of claim 25, wherein the immunogenic composition comprises one or more of the following: a buffer, a salt, a divalent cation, a non-ionic detergent, a sugar, a free radical scavenger, and a chelator.

27. The immunogenic composition of claim 25, comprising a buffer.

28. The immunogenic composition of claim 25, comprising a salt.

29. The immunogenic composition of claim 25, comprising a surfactant.

30. Use of the immunogenic composition of claim 1 or 18 in the manufacture of a medicament for preventing S. pneumoniae serotype 11A infection in a subject.

31. Use of the immunogenic composition of claim 1 or 18 in the manufacture of a vaccine for preventing S. pneumoniae serotype 11A infection in a subject.

32. Use of the immunogenic composition of claim 1 or 18 in the manufacture of a medicament for protecting a human susceptible to S. pneumoniae serotype 11A infection by administering the immunogenic composition via a systemic or mucosal route.

Images