Chimeric antigen receptors targeting gprc5d and uses thereof

Abstract

The present application relates to the field of cell therapy, further, the present application relates to the chimeric antigen receptor targeting G protein-coupled receptor C5 family subtype D (GPRC5D) and its preparation method and application, especially its use as anticancer drugs. The chimeric antigen receptor targeting G protein-coupled receptor C5 family subtype D (GPRC5D) comprises an extracellular antigen binding domain, and the extracellular antigen binding domain comprises a GPRC5D antibody light chain variable region and a GPRC5D antibody heavy chain variable region. The single-chain antibody (scFv) of the present application which recognizes tumor surface antigen GPRC5D is combined with a T cell activation domain, so that T cells express chimeric antigen receptors, thereby recognizing and binding to tumor surface antigens, inducing T cell activation, secreting cytokines and killing tumor cells. It has remarkable curative effect in the treatment of B lymphoma and acute lymphoblastic leukemia.

Description

[0001] The present application claims priority to the Chinese patent application No. 202110561829.9, filed on May 23, 2021, entitled "Chimeric antigen receptor targeting GPRC5D and uses thereof", the entire content of which is incorporated herein by reference. TECHNICAL FIELD

[0002] The present application relates to the field of cell therapy, and further, the present application relates to a chimeric antigen receptor targeting G protein-coupled receptor C5 family, subtype D (GPRC5D) and a preparation method and application thereof. BACKGROUND

[0003] Chimeric antigen receptor (CAR) T cell therapy is to combine single-chain antibody (scFv) recognizing tumor surface antigen with T cell activation domain, so that T cells express chimeric antigen receptor, thereby recognizing and binding to tumor surface antigen, inducing T cell activation, secreting cytokines and killing tumor cells. It has a significant effect in the treatment of B-cell lymphoma and acute lymphoblastic leukemia [1].

[0004] G protein-coupled receptor C5 family, subtype D (GPRC5D) is an orphan non-classical GPCR identified as early as 2001 [2]. GPCR family C group 5 receptors (GPRC5 receptors) have four subtypes, namely GPRC5A, GPRC5B, GPRC5C and GPRC5D, which are induced to express by retinoic acid, so they are also called retinoic acid-induced orphan G protein-coupled receptors (RAIGs) [3]. GPRC5D is highly expressed in plasma cells of multiple myeloma and is not expressed in normal tissues, only in hair follicle areas with immune privilege [4]. Studies have reported that high expression of GPRC5D is associated with poor prognosis of multiple myeloma [5]. CAR-T targeting GPRC5D shows good therapeutic effect in mouse multiple myeloma (MM) models. Since the expression of GPRC5D does not coincide with that of BCMA, GPRC5D CAR-T still has therapeutic effect on tumor recurrence models with loss of BCMA [4]. In GPRC5D-positive mouse MM models, GPRC5D / CD3 bispecific antibodies can recruit T cells and induce tumor regression [6].

[0005] GPRC5D is a surface antigen that is expected to be used for MM immunotherapy, but most of the current GPRC5D drugs are still in the clinical trial stage or research and development stage, and no cell drugs targeting GPRC5D have been marketed, therefore, it is necessary to develop GPRC5D cell drugs with higher activity and therapeutic effect for the treatment of related diseases and application.

[0006] References:

[0007] 1. Romero, D., Initial results with liso-cel. Nat Rev Clin Oncol, 2020. 17(11): 654-654.

[0008] 2. Brauner-Osborne, H., et al., Cloning and characterization of a human orphan family C G-protein coupled receptor GPRC5D. Biochim Biophys Acta, 2001. 1518(3): p. 237-48.

[0009] 3. Inoue, S., T. Nambu, and T. Shimomura, The RAIG family member, GPRC5D, is associated with hard-keratinized structures. Journal of Investigative Dermatology, 2004. 122(3): p. 565-573.

[0010] 4. Smith, E.L., et al., GPRC5D is a target for the immunotherapy of multiple myeloma with rationally designed CAR T cells. Science Translational Medicine, 2019. 11(485).

[0011] 5. Atamaniuk, J., et al., Overexpression of G protein-coupled receptor 5D in the bone marrow is associated with poor prognosis in patients with multiple myeloma. European Journal of Clinical Investigation, 2012. 42(9): p. 953-960.

[0012] 6. Pillarisetti, K., et al., A T-cell-redirecting bispecific G-protein-coupled receptor class 5 member D x CD3 antibody to treat multiple myeloma. Blood, 2020. 135(15): p. 1232-1243. SUMMARY

[0013] A first object of the present application is to provide a chimeric antigen receptor comprising an extracellular antigen binding domain comprising a GPRC5D antibody light chain variable region and a GPRC5D antibody heavy chain variable region, wherein the GPRC5D antibody light chain variable region comprises any one of the following group of sequences: SEQ ID No: 4, SEQ ID No: 6, SEQ ID No: 8, SEQ ID No: 10, SEQ ID No: 12, SEQ ID No: 39, SEQ ID No: 41 and SEQ ID No: 43;

[0014] the GPRC5D antibody heavy chain variable region comprises any one of the following group of sequences: SEQ ID No: 3, SEQ ID No: 5, SEQ ID No: 7, SEQ ID No: 9, SEQ ID No: 11, SEQ ID No: 38, SEQ ID No: 40 and SEQ ID No: 42.

[0015] In a particular embodiment of the application, the GPRC5D antibody heavy chain variable region sequence is SEQ ID No: 3 and the GPRC5D antibody light chain variable region sequence is SEQ ID No: 4, or the GPRC5D antibody heavy chain variable region sequence is SEQ ID No: 5 and the GPRC5D antibody light chain variable region sequence is SEQ ID No: 6, or the GPRC5D antibody heavy chain variable region sequence is SEQ ID No: 7 and the GPRC5D antibody light chain variable region sequence is SEQ ID No: 8, or the GPRC5D antibody heavy chain variable region sequence is SEQ ID No: 9 and the GPRC5D antibody light chain variable region sequence is SEQ ID No: 10, or the GPRC5D antibody heavy chain variable region sequence is SEQ ID No: 11 and the GPRC5D antibody light chain variable region sequence is SEQ ID No: 12, or the GPRC5D antibody heavy chain variable region sequence is SEQ ID No: 38 and the GPRC5D antibody light chain variable region sequence is SEQ ID No: 39, or the GPRC5D antibody heavy chain variable region sequence is SEQ ID No: 40 and the GPRC5D antibody light chain variable region sequence is SEQ ID No: 41, or the GPRC5D antibody heavy chain variable region sequence is SEQ ID No: 42 and the GPRC5D antibody light chain variable region sequence is SEQ ID No: 43.

[0016] In a particular embodiment of the application, the chimeric antigen receptor further comprises a transmembrane domain and an intracellular domain.

[0017] In a particular embodiment of the application, a linker is comprised between the GPRC5D antibody heavy chain variable region and the GPRC5D antibody light chain variable region, said linker being preferably a connecting peptide, the sequence of said connecting peptide being preferably (GGGGS)n, with n greater than or equal to 1, preferably 1, 2, 3, 4 or 5, more preferably n is 3;

[0018] Alternatively, the sequence of said linker is EGKSSGSGSESKVD, KESGSVSSEQLAQFRSLD, GGRRGGGS, LRQRDGERP, LRQKDGGGSERP or GSTSGSGKPGSGEGSTKG.

[0019] In a particular embodiment of the application, the extracellular antigen binding domain further comprises a leader peptide and a hinge region.

[0020] In one embodiment of the application, the leader peptide sequence is an IgGl heavy chain signal polypeptide, a granulocyte-macrophage colony-stimulating factor receptor 2 (GM-CSFR2) signal peptide, or a CD8a signal peptide, and / or the hinge region is CH2 and CH3 of CD8a, IgGl, or IgG4, CD4, CD28, or CD7.

[0021] In one embodiment of the application, the transmembrane domain is any one or more of the group consisting of alpha, beta, or delta chain of T cell receptor, CD3 epsilon, CD3 delta, CD4, CD5, CD8a, CD9, CD 16, CD22, CD27, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD 134, CD137, CD152, CD 154, and PD1, and / or the intracellular domain is any one or more of the group consisting of CARD11, CD2, CD7, CD27, CD28, CD30, CD40, CD54 (ICAM), CD83, CD134, CD137 (4-1BB), CD3 zeta, CD150 (SLAMF1), CD152 (CTLA4), CD223 (LAG3), CD270 (HVEM), CD273 (PD-L2), CD274 (PD-L1), CD278 (ICOS), DAP10, LAT, NKD2C, SLP76, TRIM, and ZAP70.

[0022] In one embodiment of the application, the chimeric antigen receptor comprises a leader peptide set forth in SEQ ID No: 44, a GPRC5D antibody light chain variable region, a linking peptide set forth in SEQ ID No: 45, a GPRC5D antibody heavy chain variable region, a hinge region set forth in SEQ ID No: 46, a CD8a transmembrane domain set forth in SEQ ID No: 47, a 4-1BB costimulatory signaling region set forth in SEQ ID No: 48, and a CD3 zeta signaling domain set forth in SEQ ID No: 49.

[0023] In certain embodiments, the intracellular domain of the chimeric antigen receptor described herein can comprise one or more costimulatory signaling domains, which can also be from a costimulatory molecule selected from the group consisting of CARD11, CD2, CD3 zeta, CD7, CD27, CD28, CD30, CD40, CD54 (ICAM), CD83, CD134 (OX40), CD137 (4-1BB), CD150 (SLAMF1), CD152 (CTLA4), CD223 (LAG3), CD270 (HVEM), CD273 (PD-L2), CD274 (PD-L1), CD278 (ICOS), DAP10, LAT, NKD2C SLP76, TRIM, and ZAP70.

[0024] In particular embodiments, the one or more costimulatory signaling domains are from a costimulatory molecule selected from the group consisting of CD28, CD134, and CD137.

[0025] In further embodiments, the one or more costimulatory signaling domains are from a costimulatory molecule selected from the group consisting of CD137 and CD3 zeta.

[0026] In further embodiments, the one or more costimulatory signaling domains are from CD28.

[0027] In particular embodiments, the one or more costimulatory signaling domains are from CD134.

[0028] In other embodiments, the one or more costimulatory signaling domains are from CD137.

[0029] The present application also provides use of the aforementioned chimeric antigen receptor for the preparation of a medicament or a pharmaceutical composition.

[0030] In one specific embodiment of the present application, the medicament or pharmaceutical composition is for treating a tumor.

[0031] In one specific embodiment of the present application, the tumor comprises multiple myeloma.

[0032] The present application also provides a polynucleotide encoding the aforementioned chimeric antigen receptor.

[0033] In some specific embodiments, the polynucleotide encoding the CAR encompassed herein comprises an optimized Kozac sequence.

[0034] In other embodiments, the promoter operably linked to the polynucleotide encoding a CAR encompassed herein is selected from the group consisting of a cytomegalovirus immediate early gene promoter (CMV), an elongation factor 1 alpha promoter (EF1-alpha), a phosphoglycerate kinase-1 promoter (PGK), a ubiquitin-C promoter (UBQ-C), a cytomegalovirus enhancer / chicken beta-actin promoter (CAG), a polyoma enhancer / Herpes simplex thymidine kinase promoter (MCI), a beta actin promoter (beta-ACT), a simian virus 40 promoter (SV40), and a myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer binding site substituted (MND) promoter.

[0035] The present disclosure also provides a vector comprising the aforementioned polynucleotide.

[0036] In certain embodiments, the vector is an expression vector.

[0037] In additional embodiments, the vector is an episomal vector.

[0038] In particular embodiments, the vector is a viral vector.

[0039] In other embodiments, the vector is a retroviral vector.

[0040] In other embodiments, the vector is a lentiviral vector.

[0041] In additional embodiments, the lentiviral vector is selected from the group consisting essentially of a human immunodeficiency virus (HIV), a human immunodeficiency virus 1 (HIV-1), a human immunodeficiency virus 2 (HIV-2), a visna-maedi virus (VMV) virus, a caprine arthritis- encephalitis virus (CAEV), an equine infectious anemia virus (EIAV), a feline immunodeficiency virus (FIV), a bovine immunodeficiency virus (BIV), and a simian immunodeficiency virus (SIV).

[0042] In particular embodiments, the vector comprises a left (5') retroviral LTR, a Psi (Ψ) packaging signal, a central polypurine tract / DNA flap (cPPT / FLAP), a retroviral export element, a promoter operably linked to a polynucleotide encoding a CAR encompassed herein, and a right (3') retroviral LTR.

[0043] In certain embodiments, the promoter of the 5' LTR is replaced with a heterologous promoter.

[0044] In other embodiments, the heterologous promoter is a cytomegalovirus (CMV) promoter, a Rous Sarcoma Virus (RSV) promoter, or a Simian Virus 40 (SV40) promoter.

[0045] In particular embodiments, the 5' LTR or 3' LTR is a lentiviral LTR.

[0046] In particular embodiments, the 3' LTR comprises one or more modifications.

[0047] In some embodiments, the 3' LTR comprises one or more deletions.

[0048] In certain embodiments, the 3' LTR is a self-inactivating (SIN) LTR.

[0049] The present disclosure also provides an immune effector cell comprising the aforementioned polynucleotide or the aforementioned vector.

[0050] In one particular embodiment of the present disclosure, the immune effector cell is a T cell.

[0051] In various embodiments, an immune effector cell comprising a vector encompassed herein is provided. In various embodiments, the immune effector cell is transduced with a vector encompassed herein.

[0052] In other embodiments, the immune effector cell is selected from the group consisting of a T lymphocyte, a macrophage, and a natural killer (NK) cell.

[0053] In various embodiments, a method of generating an immune effector cell comprising a CAR encompassed herein is provided, comprising introducing a vector comprising a polynucleotide encoding the CAR into an immune effector cell.

[0054] In other embodiments, the immune effector cell is a PD1 gene knockout cell.

[0055] In certain embodiments, the sgRNA targeting PD1, Cas9 protein and double-stranded DNA containing GPRC5D CAR sequence are introduced into the T cells by electroporation to achieve precise insertion of CAR elements at the PD1 gene site of T cells, thereby obtaining GPRC5D non-viral PD1 site-specific integration CAR-T cells, improving the effect of targeted killing of tumors.

[0056] It should be noted that the sgRNA targeting other genes in the T cells can also be introduced into the T cells by the above method to obtain CAR-T cells targeting GPRC5D site-specific integration on other genes, thereby improving the effect of targeted killing of tumors.

[0057] The present application also provides a pharmaceutical composition comprising the aforementioned chimeric antigen receptor, polynucleotide, vector, or host cell.

[0058] In one embodiment of the present application, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

[0059] In one embodiment of the present application, the pharmaceutically acceptable excipient is one or more of citric acid, sodium hydroxide, sodium phosphate monobasic, sodium phosphate dibasic, mannitol, Tween 20, Tween 60, Tween 80, sodium chloride, and water for injection.

[0060] In one embodiment, the CAR comprises the amino acid sequence set forth in SEQ ID NO: 3 and SEQ ID NO: 4, or SEQ ID NO: 5 and SEQ ID NO: 6, or SEQ ID NO: 7 and SEQ ID NO: 8, or SEQ ID NO: 9 and SEQ ID NO: 10, or SEQ ID NO: 11 and SEQ ID NO: 12, or SEQ ID NO: 38 and SEQ ID NO: 39, or SEQ ID NO: 40 and SEQ ID NO: 41, or SEQ ID NO: 42 and SEQ ID NO: 43.

[0061] In various embodiments, a polynucleotide encoding a CAR encompassed herein is provided.

[0062] In various particular embodiments, a polynucleotide encoding a CAR is provided, wherein the polynucleotide sequence is set forth in SEQ ID NO: 50 and SEQ ID NO: 51, or SEQ ID NO: 52 and SEQ ID NO: 53, or SEQ ID NO: 54 and SEQ ID NO: 55, or SEQ ID NO: 56 and SEQ ID NO: 57, or SEQ ID NO: 58 and SEQ ID NO: 59, or SEQ ID NO: 60 and SEQ ID NO: 61, or SEQ ID NO: 62 and SEQ ID NO: 63, or SEQ ID NO: 64 and SEQ ID NO: 65.

[0063] In various certain embodiments, a vector is provided comprising a polynucleotide encoding a CAR encompassed herein or as set forth in SEQ ID NO: 50 and SEQ ID NO: 51, or SEQ ID NO: 52 and SEQ ID NO: 53, or SEQ ID NO: 54 and SEQ ID NO: 55, or SEQ ID NO: 56 and SEQ ID NO: 57, or SEQ ID NO: 58 and SEQ ID NO: 59, or SEQ ID NO: 60 and SEQ ID NO: 61, or SEQ ID NO: 62 and SEQ ID NO: 63, or SEQ ID NO: 64 and SEQ ID NO: 65.

[0064] In various embodiments, a method of treating a B-cell related condition in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of a composition comprising a GPRC5D CAR T cell encompassed herein and optionally a pharmaceutically acceptable excipient. In other embodiments, the B-cell related condition is multiple myeloma, non-Hodgkin's lymphoma, B-cell proliferation of uncertain malignant potential, lymphomatoid granulomatosis, post-transplant lymphoproliferative disorder, immunoregulatory disorder, rheumatoid arthritis, myasthenia gravis, idiopathic thrombocytopenic purpura, antiphospholipid syndrome, Chagas' disease, Grave's disease, Wegener's granulomatosis, Takayasu arteritis, Sjogren's syndrome, pemphigus vulgaris, scleroderma, multiple sclerosis, antiphospholipid syndrome, ANCA-associated vasculitis, Goodpasture's disease, Kawasaki disease, autoimmune hemolytic anemia, and rapidly progressive glomerulonephritis, heavy chain disease, primary or immunocyte-related amyloidosis, or monoclonal gammopathy of undetermined significance.

[0065] In other embodiments, the B-cell related condition is a B-cell malignancy.

[0066] In certain embodiments, the B-cell malignancy is multiple myeloma (MM) or non-Hodgkin's lymphoma (NHL).

[0067] In certain embodiments, the MM is selected from the group consisting of overt multiple myeloma, smoldering multiple myeloma, plasma cell leukemia, non-secretory myeloma, IgD myeloma, osteosclerotic myeloma, solitary plasmacytoma of bone, and extramedullary plasmacytoma.

[0068] In some embodiments, the NHL is selected from the group consisting of Burkitt lymphoma, chronic lymphocytic leukemia / small lymphocytic lymphoma (CLL / SLL), diffuse large B-cell lymphoma, follicular lymphoma, immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, and mantle cell lymphoma.

[0069] In particular embodiments, the B-cell related condition is a plasma cell malignancy.

[0070] In other embodiments, the B-cell related condition is an autoimmune disease.

[0071] In additional embodiments, the autoimmune disease is systemic lupus erythematosus.

[0072] In certain embodiments, the B-cell related condition is rheumatoid arthritis.

[0073] In particular embodiments, the B-cell related condition is idiopathic thrombocytopenic purpura or myasthenia gravis or autoimmune hemolytic anemia. BRIEF DESCRIPTION OF DRAWINGS

[0074] Figure 1 Figure 1 is a schematic diagram of a chimeric antigen receptor targeting the GPRC5D target in Example 4 of the present application;

[0075] Figure 2 is a graph of T cell positivity rate of chimeric antigen receptor T cells targeting the GPRC5D target in Example 7 of the present application;

[0076] Figure 3 Figure 3 is a graph of in vitro anti-tumor effect of murine chimeric antigen receptor T cells targeting the GPRC5D target in Example 8 of the present application;

[0077] Figure 4 Figure 4 is a graph of in vitro anti-tumor effect of humanized chimeric antigen receptor T cells targeting the GPRC5D target in Example 9 of the present application;

[0078] Figure 5 Figure 5 is a graph of in vitro expansion rate and survival rate results of chimeric antigen receptor T cells targeting the GPRC5D target and positive control PD1-GPRC5D-CART (BMK) in Example 10 of the present application;

[0079] Figure 6 Figure 6 is a flow cytometry graph of CAR positivity rate of chimeric antigen receptor T cells targeting the GPRC5D target and positive control PD1-GPRC5D-CART (BMK) in Example 10 of the present application;

[0080] Figure 7This is a graph showing the cell killing rate results of LDH killing of GPRC5D chimeric antigen receptor T cells and positive control PD1-GPRC5D-CART (BMK) in Example 10 of the present invention.

[0081] Figure 8 This is a graph showing the cell killing rate results of Luciferase targeting GPRC5D chimeric antigen receptor T cells and positive control PD1-GPRC5D-CART (BMK) in Example 10 of the present invention.

[0082] Figure 9 This is a graph showing the release of cytokines targeting GPRC5D chimeric antigen receptor T cells and the positive control PD1-GPRC5D-CART (BMK) in Example 10 of the present invention. Detailed Implementation

[0083] Example 1. Preparation of human GPRC5D expression vector and stable cell line

[0084] The base sequence (NM_018654.1) encoding the CDS region of the human GPRC5D gene was obtained from the NCBI database. PCR primers 1 (SEQ ID NO:1) and 2 (SEQ ID NO:2) were designed. Multiple myeloma cell lines MM.1S (purchased from Nanjing Institute of Model Animals), which highly express GPRC5D, and cDNA from NCI-H929 (ATCC) were selected as templates for PCR amplification. The PCR products and vector were treated with restriction endonucleases, ligated with T4 ligase, and transfected into *E. coli* DH5α. Single clones were selected for sequencing. Sequence accuracy was verified by sequencing. Strains expressing the target plasmid were successfully constructed, cultured in culture medium, and plasmid DNA was extracted using a kit (purchased from Tiangen Biotech Co., Ltd.). 293T cells in good logarithmic growth phase were selected and co-transfected with three plasmids (psPAX2, pMD2.G, and pLVX-huGPRC5D-IRES-ZSGreen1) using PEI transfection reagent. Virus solutions were collected at 48 and 72 hours post-transfection, filtered through a 0.45 μM syringe filter, and used to infect target cells at an MOI of 10. The medium was changed 48 hours after infection. The constructed cell lines were analyzed by flow cytometry to detect hGPRC5D expression, confirming successful construction of a stable hGPRC5D expression cell line.

[0085] Example 2. Preparation and screening of monoclonal antibodies

[0086] The mice are immunized using the hGPRC5D stably expressed cell line, and the mouse is taken from the corner of the eye. The mouse serum titer is detected by flow cytometry. The mouse with the highest titer and the titer tending to be stable for two consecutive times is selected for a one-time impact immunization before intraperitoneal injection to construct an antibody library. The method of reference (Krebber, A., Bornhauser, S., Burmester, J., Honegger, A., Willuda, J., Bosshard, H. R., and Pluckthun, A. (1997). Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a reengineered phage display system. Journal of immunological methods 201, 35-55.) is used to construct a mouse immunized phage library. In short, the mouse is treated, the spleen is gently crushed, and the cells are collected. The total RNA of the cells is extracted after lysis with cell lysis solution, and the cDNA is obtained by reverse transcription. The variable region genes of the antibodies are amplified using mouse-specific antibody heavy chain variable region primers and light chain variable region primers, and are cloned into a phage display vector. The constructed phage display library is sequenced by NGS, the library capacity is counted by limiting dilution method, and the clonal positive rate is detected by PCR to evaluate the diversity and effectiveness of the antibody library. The phage is prepared from the qualified phage display library, and the pretreated phage supernatant is enriched by hGPRC5D stably expressed cells. After washing away the unbound phage with DPBS, the phage bound to the cells is eluted with 0.1M HCl-glycine, and then neutralized with Tris-HCl. The phage is used to infect the logarithmic growth phase of E. coli to prepare phage for the next round of selection. The E. coli monoclonal infected by the phage selected to terminate the selection is inoculated in a 96-well plate, and the single-chain antibody (scFv) is prepared by IPTG induction. The binding of scFv to the GPRC5D high expression cell line is detected by flow cytometry. Through the binding activity analysis, HTS0370, HTS0372, HTS0373, HTS0374 and HTS0375 scFv single-chain antibodies are selected for subsequent research. After sequence determination, the VHand VLsequences and CDR sequences of the five antibodies are as follows.

[0087]

[0088]

[0089] Antibody heavy chain CDR sequences HCDR1 HCDR2 HCDR3 HTS0370 SEQ ID NO: 13 SEQ ID NO: 14 SEQ ID NO: 15 HTS0372 SEQ ID NO: 16 SEQ ID NO: 17 SEQ ID NO: 18 HTS0373 SEQ ID NO: 19 SEQ ID NO: 20 SEQ ID NO: 21 HTS0374 SEQ ID NO: 22 SEQ ID NO: 23 SEQ ID NO: 24 HTS0375 SEQ ID NO: 25 SEQ ID NO: 26 SEQ ID NO: 27

[0090] Antibody light chain CDR sequences LCDR1 LCDR2 LCDR3 HTS0370 SEQ ID NO: 28 YAS SEQ ID NO: 29 HTS0372 SEQ ID NO: 30 SAS SEQ ID NO: 31 HTS0373 SEQ ID NO: 32 AAS SEQ ID NO: 33 HTS0374 SEQ ID NO: 34 ATS SEQ ID NO: 35 HTS0375 SEQ ID NO: 36 SAS SEQ ID NO: 37

[0091] Example 3. Humanization of murine GPRC5D antibodies

[0092] According to the CDR grafting method, murine antibodies HTS0370 and HTS0375 were humanized, i.e. the VH and VK base sequences of HTS0370 and HTS0375 antibodies were analyzed using the IMGT / V-QUEST tool (http: / / www.imgt.org / IMGT_vquest / input) to determine the CDR regions of the light and heavy chains of the antibodies. The amino acid sequences of HTS0370 and HTS0375 antibodies were analyzed using the IgBlast tool (https: / / www.ncbi.nlm.nih.gov / igblast / ) to obtain the human germline VH and VK sequences with the highest homology to the two antibodies. The CDRs of HTS0370 and HTS0375 antibodies were grafted into the framework regions of the selected VH and VK human germline sequences, which are the humanized antibody sequences. The humanized heavy chain sequences of HTS0370 and HTS0375 were synthesized in whole genes and cloned into vectors containing the IgG1 heavy chain constant region base sequence by homologous recombination, obtaining humanized antibody heavy chain expression plasmids; the humanized light chain sequences of HTS0370 and HTS0375 were synthesized in whole genes and cloned into expression vectors by homologous recombination, and plasmids were prepared by conventional methods. Mammalian cells in the logarithmic growth phase were inoculated into cell culture bottles for culture, and the humanized light chain plasmid and humanized heavy chain were co-transfected with PEI, the supernatant of the transfected cells was collected, centrifuged and filtered using a filter, the antibody was purified using Protein A medium and the antibody was replaced into PBS pH 7.2 buffer by dialysis. The binding of the obtained humanized antibodies to GPRC5D overexpression cell lines and endogenous expression cells was detected by flow cytometry. The high-activity humanized antibodies HTS0370Z22 and HTS0370Z23 of HTS0370 and the high-activity humanized antibody HTS0375Z56 of HTS0375 were screened, and the antibody VH and VL sequences are as follows.

[0093] Antibody name VH amino acid sequence VL amino acid sequence HTS0370Z22 SEQ ID NO: 38 SEQ ID NO: 39 HTS0370Z23 SEQ ID NO: 40 SEQ ID NO: 41 HTS0375Z56 SEQ ID NO: 42 SEQ ID NO: 43

[0094] Antibody name VH nucleotide sequence VL nucleotide sequence HTS0370Z22 SEQ ID NO: 60 SEQ ID NO: 61 HTS0370Z23 SEQ ID NO: 62 SEQ ID NO: 63 HTS0375Z56 SEQ ID NO: 64 SEQ ID NO: 65

[0095] Example 4. Construction of a chimeric antigen receptor vector targeting the GPRC5D target

[0096] Chimeric antigen expression vectors were constructed for high-activity mouse GPRC5D antibodies and corresponding humanized antibodies. The leader peptide (Leader, SEQ ID NO: 44), GPRC5D antibody light chain variable region, linker peptide (Linker, SEQ ID NO: 45), GPRC5D antibody heavy chain variable region, hinge region (Hinge, SEQ ID NO: 46), CD8a transmembrane domain (TM, SEQ ID NO: 47), 4-1BB costimulatory signaling region (SEQ ID NO: 48), and CD3 zeta signaling domain (SEQ ID NO: 49) were all synthesized. The above sequences were sequentially connected to obtain a chimeric antigen receptor expression cassette, which was named 0370 chimeric antigen receptor expression cassette, 0372 chimeric antigen receptor expression cassette, 0373 chimeric antigen receptor expression cassette, 0374 chimeric antigen receptor expression cassette, 0375 chimeric antigen receptor expression cassette, 0370Z22 chimeric antigen receptor expression cassette, 0370Z23 chimeric antigen receptor expression cassette, and 0375Z56 chimeric antigen receptor expression cassette, respectively. The structure of the expression cassette is shown in Figure 1 The Kozak sequence (sequence gccacc) was introduced at the front end of each expression cassette. After the sequence of the chimeric antigen receptor expression cassette was synthesized, it was connected to the empty vector pCDH-EF1-MSC-copGFP (purchased from Changsha Youbao Biotechnology Co., Ltd.) through XbaI / SalI enzyme digestion sites to obtain a chimeric antigen receptor expression vector. After verification by sequencing, the plasmid was extracted using a plasmid extraction kit (Beijing Tiangen Biochemical Technology Co., Ltd. Endotoxin-free plasmid extraction kit) to obtain plasmids pCDH-EF1-CAR-GPRC5D-0370-copGFP,

[0097] pCDH-EF1-CAR-GPRC5D-0372-copGFP, pCDH-EF1-CAR-GPRC5D-0373-copGFP,

[0098] pCDH-EF1-CAR-GPRC5D-0374-copGFP, pCDH-EF1-CAR-GPRC5D-0375-copGFP,

[0099] pCDH-EF1-CAR-GPRC5D-0370Z22-copGFP,

[0100] pCDH-EF1-CAR-GPRC5D-0370Z23-copGFP,

[0101] pCDH-EF1-CAR-GPRC5D-0375Z56-copGFP, which were ready for infection. The plasmid extraction method was performed according to the instructions.

[0102] Example 5. Preparation and concentration of virus of chimeric antigen receptor targeting GPRC5D target

[0103] Transfect cells by PEI method. 24 hours before transfection, trypsinize 293T cells, 4E6 of 293T cells are plated in a 10 cm cell culture dish, and the cells are cultured in DMEM medium containing 10% FBS, not more than 24 hours, when the cells reach 60-80% density, transfection can be performed.

[0104] The specific steps are as follows:

[0105] (1) Place the plasmid, PEI, and DMEM medium at room temperature for 5 min;

[0106] (2) Take 450 μL of DMEM in a 1.5 mL EP tube, then add 50 μL of PEI (1 μg / μL) and mix well, and stand at room temperature for 5 min;

[0107] (3) Take 10 μg of the plasmid of interest (pCDH-EF1-CAR-GPRC5D-0370-copGFP,

[0108] pCDH-EF1-CAR-GPRC5D-0372-copGFP,

[0109] pCDH-EF1-CAR-GPRC5D-0373-copGFP,

[0110] pCDH-EF1-CAR-GPRC5D-0374-copGFP,

[0111] pCDH-EF1-CAR-GPRC5D-0375-copGFP,

[0112] pCDH-EF1-CAR-GPRC5D-0370Z22-copGFP,

[0113] pCDH-EF1-CAR-GPRC5D-0370Z23-copGFP,

[0114] or pCDH-EF1-CAR-GPRC5D-0375Z56-copGFP), 10 μg psPAX2, 5 μg pMD2.G, add DMEM to 500 μL, mix well, and stand at room temperature for 5 min;

[0115] (4) Add the PEI-DMEM solution prepared in step (2) to the plasmid-containing DMEM obtained in step (3), mix well, and stand at room temperature for 20 min; obtain the DNA / PEI mixture;

[0116] (5) Slowly drop 1 mL of DNA / PEI mixture into the 293T cell culture dish, mix gently, and incubate in a 37°C incubator for 6-8 hours;

[0117] (6) Discard the original culture medium and replace it with fresh culture medium. Place in a 37°C incubator for continued incubation;

[0118] (7) After 48 hours of culture medium replacement, collect the culture medium. Then add 10 mL of fresh culture medium to each dish for continued culture. After 24 hours, collect the supernatant again and mix it with the supernatant collected at 48 hours;

[0119] (8) Centrifuge at 4000g for 10 min at 4°C to remove cell debris;

[0120] (9) Filter the obtained supernatant with a 0.45 μm filter;

[0121] (10) Perform tangential flow filtration on the filtered supernatant;

[0122] (11) Transfer the tangential flow filtered virus supernatant into an ultracentrifuge tube and centrifuge at 25000 rpm for 2 hours. Resuspend the virus precipitate obtained after ultracentrifugation with serum-free culture medium and gently blow until completely dissolved to obtain virus liquid;

[0123] (12) Aliquot the virus liquid and store it in a -80°C refrigerator.

[0124] Digest and count 293T cells, prepare a cell suspension with DMEM culture medium containing 10% FBS, adjust the cell density to 4E5 / mL, and add 0.5 mL of cell suspension to each well of a 24-well culture plate. After 8 hours of cell adhesion culture, infect 1 μL, 10 μL, 20 μL, 30 μL, and 50 μL of virus liquid diluted 100 times. After 24 hours, replace the liquid, and after 48 hours, detect the 293T cell positive rate by flow cytometry. After calculation, the virus titer is 1E8 TU.

[0125] Example 6. Preparation of chimeric antigen receptor T cells targeting GPRC5D target

[0126] Collect about 25 mL of peripheral blood using an anticoagulant tube, add it to the lymphocyte separation medium at a volume ratio of 1:1, and perform gradient centrifugation for 25 min. After centrifugation, take the white membrane layer cells, wash them twice with DPBS, and obtain human peripheral blood mononuclear cells PBMC. Resuspend PBMC, adjust the density to 1E5 / μL, and add CD4 / CD8 magnetic beads 10 μL each to 50 μL of cell suspension. Separate CD4 + CD8 +T cells, add AIM-V complete medium containing 10% FBS (purchased from Gibco) for culture, activate PBMC with anti-human CD3 / CD28 antibody (purchased from Meitain Biotechnology Co., Ltd.), and IL-2 concentration is 200 IU / mL. After 24 hours of activation, replace the liquid, and continue to culture with complete medium. After 48 hours of culture, adjust the T cell density to 1E6 / mL, infect with a virus liquid at a MOI of 10, and replace the liquid after 24 hours to obtain T cells expressing chimeric antigen receptors targeting human GPRC5D antigen.

[0127] Example 7. Detection of chimeric antigen receptor CAR targeting GPRC5D target positive expression rate

[0128] During the culture process, T cells 72 hours after virus infection were taken, centrifuged, resuspended and adjusted to a cell density of 1E6 / mL, anti-Fab antibody was diluted at a ratio of 1:100, incubated on ice for 30 min, then washed once with DPBS, resuspended and detected by flow cytometry to detect the positive rate of CAR-GPRC5D. The results show that CAR is highly expressed on the surface of T cells, and the results are shown in Figure 2.

[0129] Example 8. Anti-tumor effect of murine chimeric antigen receptor T cells targeting GPRC5D target in vitro

[0130] T cells expressing murine GPRC5D chimeric antigen receptor 72 hours after infection and GPRC5D-positive myeloma cells NCI-H929 were taken, counted and adjusted to a cell density of 1E6 / mL, and co-cultured at an effector target ratio of 5:1, i.e. T cells 1x10 6 , NCI-H929 2x10 5 , and control cells were CD4 + CD8 + T cells without virus infection, denoted as Ctrl cells. The mixed cultured cells were labeled with antibody APC-conjugated Human BCMA Antibody at 0 hours, 24 hours and 48 hours (0h, 24h and 48h), respectively, and the proportion of NCI-H929 cells in total cells was detected by flow cytometry. After 48 hours, the target cells in the HTS0370, HTS0372, HTS0373, HTS0374 and HTS0375 experimental groups were reduced to 4.00%, 1.64%, 2.93%, 5.56% and 4.40%, respectively, and the anti-tumor effect of murine chimeric antigen receptor T cells in vitro was significant, and the results are shown in Figure 3 .

[0131] Example 9. Anti-tumor effect of humanized chimeric antigen receptor T cells targeting GPRC5D target in vitro

[0132] T cells expressing the humanized GPRC5D chimeric antigen receptor and GPRC5D-positive myeloma cells NCI-H929 were collected 72 hours post-infection, counted, and their density was adjusted to 1E6 / mL. They were co-cultured at an effector-to-target ratio of 1:2, i.e., 1 x 10^6 T cells. 6 NCI-H929 2x10 6 The control cells were CD4 cells that had not been treated with the virus. + CD8 + T cells, denoted as Ctrl cells, were used to label co-cultured cells with APC-conjugated Human BCMA Antibody at 0, 24, 48, and 72 hours. The proportion of NCI-H929 cells in the total cell count was analyzed by flow cytometry. At 72 hours, the percentages of target cells in the HTS0370, HTS0370Z22, HTS0370Z23, and HTS0375Z56 experimental groups decreased to 5.33%, 6.95%, 9.85%, and 6.89%, respectively. Humanized chimeric antigen receptor T cells showed significant anti-tumor effects in vitro, with the humanized sequences HTS0370Z22 and HTS0375Z56 exhibiting the best performance. (See attached figures). Figure 4 .

[0133] Example 10. Preparation and functional evaluation of non-viral PD1-targeted GPRC5D chimeric antigen receptor T cells.

[0134] In this embodiment, non-viral PD1-targeted chimeric antigen receptor T cells targeting GPRC5D were prepared by electroporation. (PD1-GPRC5D-CART(Z22) used the single-chain antibody sequence HTS0370Z22 provided in Example 3 of this invention; PD1-GPRC5D-CART(BMK) used the antibody sequence (VL amino acid sequence SEQ ID NO: 66; VH amino acid sequence SEQ ID NO: 67) from US20210393689A1 as a positive control). Buffer was prepared and T cells were resuspended according to the Lonza electroporation kit (V4XP-3024) instructions. PD1-targeting sgRNA (targeting sequence SEQ ID NO: 68), Cas9 protein, and a DNA template containing GPRC5D-targeting chimeric antigen receptor elements were co-incubated before electroporation. After electroporation, the cells were placed in an incubator for further culture. The in vitro amplification rate and viability of PD1-GPRC5D-CART (BMK) and PD1-GPRC5D-CART (Z22) were measured on days 1, 3, 5, and 7 after electroporation. Figure 5). The cells were collected on the 7th day after electroporation, and the CAR positive rates of PD1-GPRC5D-CART(BMK) and PD1-GPRC5D-CART(Z22) were detected by flow cytometry Figure 6 Figure 6 The results showed that the integration rates of CAR elements in PD1-GPRC5D-CART(BMK) and PD1-GPRC5D-CART(Z22) were 5.08% and 7.09%, respectively. PD1-GPRC5D-CART(BMK), PD1-GPRC5D-CART(Z22) and untreated T cells (Untreated T) on the 7th day after electroporation were co-cultured with tumor target cells K562-GPCR5D overexpressing GPRC5D at an effector target ratio of 1:9, 1:3 and 1:1, respectively, and the cell killing rate was calculated according to the LDH killing detection kit (CytoTox 96® Non-Radioactive Cytotoxicity Assay, Promega, G1780) according to the instructions Figure 7 Figure 7 The results showed that PD1-GPRC5D-CART(BMK) and PD1-GPRC5D-CART(Z22) both showed significant killing effect compared with untreated T cells, and the anti-tumor effect of PD1-GPRC5D-CART(Z22) was better than that of the positive control PD1-GPRC5D-CART(BMK). PD1-GPRC5D-CART(BMK) and PD1-GPRC5D-CART(Z22) on the 7th day after electroporation were co-cultured with tumor target cells K562-GPCR5D overexpressing GPRC5D at an effector target ratio of 1:9 and 1:3, respectively, and the cell killing rate was calculated according to the Luciferase killing detection kit (Bright-Glo® Luciferase Assay System, Promega, E2620) according to the instructions TM Figure 8 Figure 8 ​​​​​The results show that both PD1-GPRC5D-CART(BMK) and PD1-GPRC5D-CART(Z22) exhibit significant killing effect, and the anti-tumor effect of PD1-GPRC5D-CART(Z22) is better than that of the positive control PD1-GPRC5D-CART(BMK). The PD1-GPRC5D-CART(BMK), PD1-GPRC5D-CART(Z22) and untreated T cells (Untreated T) on the 7th day after electroporation were co-cultured with tumor target cells K562-GPCR5D overexpressing GPRC5D at an effector target ratio of 1:1, and the cell supernatant was collected and the release amount of each cytokine was calculated according to the instructions of the human IL-2 ELISA detection kit (ELISA MAXTM Deluxe Set Human IL-2, Biolegend, 431804), human TNF-α ELISA detection kit (ELISA MAXTM Deluxe Set Human TNF-α, Biolegend, 430204), and human IFN-γ ELISA detection kit (ELISA MAXTM Deluxe Set Human IFN-γ, Biolegend, 430104). Figure 9 Figure 9 The results show that compared with untreated T cells, PD1-GPRC5D-CART(BMK) and PD1-GPRC5D-CART(Z22) can significantly secrete related cytokines. PD1-GPRC5D-CART(Z22) exhibits higher release amount of cytokines IL-2, TNF-α and IFN-γ than PD1-GPRC5D-CART(BMK). Therefore, the above example results show that PD1-GPRC5D-CART(Z22) has better killing effect than the current positive control PD1-GPRC5D-CART(BMK). SEQUENCE LISTING <110> Shanghai Bangyao Biotechnology Co., Ltd. <120> Chimeric antigen receptors targeting GPRC5D and uses thereof <160> 68 <170> SIPOSequenceListing 1.0 <210> 1 <211> 52 <212> DNA <213> Artificial Sequence <400> 1 ​agcgaattct ctagacaatt gcttgccgcc accatgtaca aggactgcat cg 52 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <400> 2 cgggggatcc ctcgagtgat catactcctc ctgcatcttg 40 <210> 3 <211> 127 <212> PRT <213> Artificial Sequence <400> 3 Glu Val Gin Leu Gin Gin Ser Gly Ala Glu Leu Met Lys Pro Gly Ala 1 5 10 15 Ser Val Lys lie Ser Cys Lys Ala Thr Gly Tyr Thr Phe Ser Ser Tyr 20 25 30 Trp Met Glu Trp Val Lys Gin Arg Pro Gly Leu Gly Leu Glu Trp lie 35 40 45 Gly Gin lie Leu Pro Gly Ser Ser Tyr Thr Asn Tyr Asn Asp Lys Phe 50 55 60 Lys Gly Lys Ala Thr Phe Thr Ala Asp Thr Ser Ser Asn Thr Ala Tyr 65 70 75 80 Met Gin Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Glu Val Gin Leu Gin Gin Ser Gly Ala Glu Leu Met Lys Pro Gly AlaAla Lys Lys Gly Gly Pro lie Tyr Tyr Gly Asn Arg Pro Phe Tyr Tyr 100 105 110 Ala Met Asp Tyr Trp Gly Gin Gly Thr Ser Val Thr Val Ser Ser 115 120 125 <210> 4 <211> 107 <212> PRT <213> Artificial Sequence (Artificial Sequence) <400> 4 Asn lie Met Met Thr Gin Thr Pro Lys Phe Leu Leu Val Ser Ala Gly 1 5 10 15 Asp Arg Val Thr lie Thr Cys Lys Ala Ser Gin Ser Val Ser Asn Asp 20 25 30 Val Ala Trp Tyr Gin Gin Lys Pro Gly Gin Ser Pro Lys Leu Gin lie 35 40 45 Tyr Tyr Ala Ser Asn Arg Tyr Thr Gly Val Pro Asp Arg Phe Thr Gly 50 55 60 Ser Gly Tyr Gly Thr Asp Phe Thr Phe Thr lie Ser Thr Val Gin Ala 65 70 75 80 Glu Asp Leu Ala Val Tyr Phe Cys Gin Gin Asp Tyr Ser Ser Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu lie Lys 100 105 <210> 5 <211> 118 <212> PRT <213> Artificial Sequence <400> 5 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr 20 25 30 Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Asn Leu Glu Trp Ile 35 40 45 Gly Leu Ile Asn Pro Tyr Asn Gly Arg Thr Ile Tyr Asn Gln Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Val Ala Leu Arg Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Ser Leu Thr Val Ser Ser 115 <210> 6 <211> 107 <212> PRT <213> Artificial Sequence <400> 6 Asp Ile Val Met Thr Gin Ser Gin Lys Phe Met Ser Thr Ser Val Gly 1 5 10 15 Asp Arg Val Ser Val Thr Cys Lys Ala Ser Gin Asn Val Gly Thr Asn 20 25 30 Val Ala Trp Tyr Gin Gin Lys Pro Gly Gin Ser Pro Lys Ala Leu Ile 35 40 45 Tyr Ser Ala Ser Tyr Arg Tyr Ser Gly Val Pro Asp Arg Phe Thr Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn Val Gin Ser 65 70 75 80 Glu Asp Leu Ala Glu Tyr Phe Cys Gin Gin Tyr Asn Ser Tyr Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Ile Asn 100 105 <210> 7 <211> 119 <212> PRT <213> Artificial Sequence <400> 7 Glu Val Gin Leu Gin Gin Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Ala Gly Tyr 20 25 30 Thr Val Asn Trp Val Lys Gln Ser His Gly Lys Asn Leu Glu Trp Ile 35 40 45 Gly Leu Ile Asn Pro Tyr Asn Gly Gly Thr Thr Tyr Thr Pro Lys Phe 50 55 60 Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Thr Arg Gly Gly Phe Tyr Arg Tyr Asp Phe Asp Phe Trp Gly Gln Gly 100 105 110 Thr Ser Val Thr Val Ser Ser 115 <210> 8 <211> 107 <212> PRT <213> Artificial Sequence <400> 8 Asp Ile Leu Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Glu Arg Val Ser Leu Thr Cys Arg Ala Ser Gln Glu Ile Ser Gly Tyr 20 25 30 Leu Ser Trp Leu Gln Gln Lys Pro Asp Gly Thr Ile Lys Arg Leu Ile 35 40 45 Tyr Ala Ala Ser Thr Leu Asp Ser Gly Val Pro Lys Arg Phe Ser Gly 50 55 60 Ser Arg Ser Gly Ser Asp Tyr Ser Leu Thr Ile Ser Ser Leu Glu Ser 65 70 75 80 Glu Asp Phe Ala Asp Tyr Tyr Cys Leu Gln Tyr Ala Ser Tyr Pro Phe 85 90 95 Thr Phe Gly Ser Gly Thr Lys Leu Glu Met Lys 100 105 <210> 9 <211> 119 <212> PRT <213> Artificial Sequence <400> 9 Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Thr 1 5 10 15 Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr 20 25 30 Thr Val Asn Trp Val Lys Gln Ser His Gly Lys Asn Leu Glu Trp Ile 35 40 45 Gly Leu Ile Asn Pro Tyr Asn Gly Gly Thr Thr Tyr Thr Pro Lys Phe 50 55 60 Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Thr Arg Gly Gly Phe Tyr Arg Tyr Asp Phe Asp Phe Trp Gly Gln Gly 100 105 110 Thr Ser Leu Thr Val Ser Ser 115 <210> 10 <211> 107 <212> PRT <213> Artificial Sequence (Artificial Sequence) <400> 10 Glu Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Glu Arg Val Ser Leu Thr Cys Arg Ala Ser Gln Asp Ile Gly Ser Ser 20 25 30 Leu Asn Trp Leu Gln Gln Glu Pro Asp Gly Thr Ile Lys Arg Leu Ile 35 40 45 Tyr Ala Thr Ser Ser Leu Asp Ser Gly Val Pro Lys Arg Phe Ser Gly 50 55 60 Ser Arg Ser Gly Ser Asp Tyr Ser Leu Thr Ile Ser Ser Leu Glu Ser 65 70 75 80 Glu Asp Phe Val Asp Tyr Tyr Cys Leu Gln Tyr Ala Ser Ser Pro Tyr 85 90 95 Thr Phe Gly Gly Gly Thr Lys Leu Glu Met Lys 100 105 <210> 11 <211> 118 <212> PRT <213> Artificial Sequence <400> 11 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Met Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr 20 25 30 Thr Met Asn Trp Val Lys Gln Ser His Gly Lys Asn Leu Glu Trp Ile 35 40 45 Gly Leu Ile Asn Pro Tyr Asn Gly Arg Thr Ile Tyr Asn Gln Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Val Ala Leu Arg Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Ser Leu Thr Val Ser Ser 115 <210> 12 <211> 107 <212> PRT <213> Artificial Sequence <400> 12 Ser lie Val Met Thr Gin Ser Gin Lys Phe Met Ser Thr Ser Val Gly 1 5 10 15 Asp Lys Val Ser Val Thr Cys Lys Ala Ser Gin Ser Val Tyr Thr Asn 20 25 30 Val Ala Trp Tyr Gin Gin Lys Pro Gly Gin Ser Pro Lys Ser Leu lie 35 40 45 Tyr Ser Ala Ser Tyr Arg Tyr Asn Gly Val Pro Asp Arg Phe Thr Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr lie Ser Asn Val Gin Ser 65 70 75 80 Glu Asp Leu Ala Glu Tyr Phe Cys Gin Gin Tyr Asn Ser Tyr Pro Val 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu lie Lys 100 105 <210> 13 <211> 8 <212> PRT <213> Artificial Sequence <400> 13 Gly Tyr Thr Phe Ser Ser Tyr Trp 1 5 <210> 14 <211> 8 <212> PRT <213> Artificial Sequence <400> 14 Ile Leu Pro Gly Ser Ser Tyr Thr 1 5 <210> 15 <211> 20 <212> PRT <213> Artificial Sequence <400> 15 Ala Lys Lys Gly Gly Pro Ile Tyr Tyr Gly Asn Arg Pro Phe Tyr Tyr 1 5 10 15 Ala Met Asp Tyr 20 <210> 16 <211> 8 <212> PRT <213> Artificial Sequence <400> 16 Gly Tyr Ser Phe Thr Gly Tyr Thr 1 5 <210> 17 <211> 8 <212> PRT <213> Artificial Sequence <400> 17 Ile Asn Pro Tyr Asn Gly Arg Thr 1 5 <210> 18 <211> 11 <212> PRT <213> Artificial Sequence <400> 18 Ala Arg Val Ala Leu Arg Tyr Ala Met Asp Tyr 1 5 10 <210> 19 <211> 8 <212> PRT <213> Artificial Sequence <400> 19 Gly Tyr Ser Phe Ala Gly Tyr Thr 1 5 <210> 20 <211> 8 <212> PRT <213> Artificial Sequence <400> 20 Ile Asn Pro Tyr Asn Gly Gly Thr 1 5 <210> 21 <211> 12 <212> PRT <213> Artificial Sequence <400> 21 Thr Arg Gly Gly Phe Tyr Arg Tyr Asp Phe Asp Phe 1 5 10 <210> 22 <211> 8 <212> PRT <213> Artificial Sequence <400> 22 Gly Tyr Ser Phe Thr Gly Tyr Thr 1 5 <210> 23 <211> 8 <212> PRT <213> Artificial Sequence <400> 23 Ile Asn Pro Tyr Asn Gly Gly Thr 1 5 <210> 24 <211> 12 <212> PRT <213> Artificial Sequence <400> 24 Thr Arg Gly Gly Phe Tyr Arg Tyr Asp Phe Asp Phe 1 5 10 <210> 25 <211> 8 <212> PRT <213> Artificial Sequence <400> 25 Gly Tyr Ser Phe Thr Gly Tyr Thr 1 5 <210> 26 <211> 8 <212> PRT <213> Artificial Sequence <400> 26 Ile Asn Pro Tyr Asn Gly Arg Thr 1 5 <210> 27 <211> 11 <212> PRT <213> Artificial Sequence <400> 27 Ala Arg Val Ala Leu Arg Tyr Ala Met Asp Tyr 1 5 10 <210> 28 <211> 6 <212> PRT <213> Artificial Sequence <400> 28 Gln Ser Val Ser Asn Asp 1 5 <210> 29 <211> 9 <212> PRT <213> Artificial Sequence <400> 29 Gln Gln Asp Tyr Ser Ser Pro Leu Thr 1 5 <210> 30 <211> 6 <212> PRT <213> Artificial Sequence <400> 30 Gln Asn Val Gly Thr Asn 1 5 <210> 31 <211> 9 <212> PRT <213> Artificial Sequence <400> 31 Gln Gln Tyr Asn Ser Tyr Pro Leu Thr 1 5 <210> 32 <211> 6 <212> PRT <213> Artificial Sequence <400> 32 Gln Glu Ile Ser Gly Tyr 1 5 <210> 33 <211> 9 <212> PRT <213> Artificial Sequence <400> 33 Leu Gln Tyr Ala Ser Tyr Pro Phe Thr 1 5 <210> 34 <211> 6 <212> PRT <213> Artificial Sequence <400> 34 Gln Asp Ile Gly Ser Ser 1 5 <210> 35 <211> 9 <212> PRT <213> Artificial Sequence <400> 35 Leu Gin Tyr Ala Ser Ser Pro Tyr Thr 1 5 <210> 36 <211> 6 <212> PRT <213> Artificial Sequence <400> 36 Gln Ser Val Tyr Thr Asn 1 5 <210> 37 <211> 9 <212> PRT <213> Artificial Sequence <400> 37 Gln Gin Tyr Asn Ser Tyr Pro Val Thr 1 5 <210> 38 <211> 127 <212> PRT <213> Artificial Sequence <400> 38 Gln Val Gin Leu Val Gin Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Thr Gly Tyr Thr Phe Ser Ser Tyr 20 25 30 Trp Met His Trp Val Arg Gin Ala Pro Gly Gin Gly Leu Glu Trp Met 35 40 45 Gly Ile Ile Leu Pro Gly Ser Ser Tyr Thr Ser Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Lys Gly Gly Pro Ile Tyr Tyr Gly Asn Arg Pro Phe Tyr Tyr 100 105 110 Ala Met Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 125 <210> 39 <211> 107 <212> PRT <213> Artificial Sequence <400> 39 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ala Ser Gln Ser Val Ser Asn Asp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile 35 40 45 Tyr Tyr Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala 65 70 75 80 Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Asp Tyr Ser Ser Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 40 <211> 127 <212> PRT <213> Artificial Sequence <400> 40 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Thr Gly Tyr Thr Phe Ser Ser Tyr 20 25 30 Trp Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Ile Ile Leu Pro Gly Ser Ser Tyr Thr Ser Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Lys Gly Gly Pro lie Tyr Tyr Gly Asn Arg Pro Phe Tyr Tyr 100 105 110 Ala Met Asp Tyr Trp Gly Gin Gly Thr Thr Val Thr Val Ser Ser 115 120 125 <210> 41 <211> 107 <212> PRT <213> Artificial Sequence (Artificial Sequence) <400> 41 Asp lie Gin Leu Thr Gin Ser Pro Ser Phe Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr lie Thr Cys Lys Ala Ser Gin Ser Val Ser Asn Asp 20 25 30 Leu Ala Trp Tyr Gin Gin Lys Pro Gly Lys Ala Pro Lys Leu Leu lie 35 40 45 Tyr Tyr Ala Ser Thr Leu Gin Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr lie Ser Ser Leu Gin Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gin Gin Asp Tyr Ser Ser Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu lie Lys 100 105 <210> 42 <211> 118 <212> PRT <213> Artificial Sequence <400> 42 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr 20 25 30 Thr Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Leu Ile Asn Pro Tyr Asn Gly Arg Thr Ile Tyr Asn Gln Lys Phe 50 55 60 Lys Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Val Ala Leu Arg Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Thr Val Thr Val Ser Ser 115 <210> 43 <211> 107 <212> PRT <213> Artificial Sequence <400> 43 Asp Ile Gin Met Thr Gin Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gin Ser Val Tyr Thr Asn 20 25 30 Leu Ala Trp Phe Gin Gin Lys Pro Gly Lys Ala Pro Lys Ser Leu Ile 35 40 45 Tyr Ser Ala Ser Ser Leu Gin Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gin Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gin Gin Tyr Asn Ser Tyr Pro Val 85 90 95 Thr Phe Gly Gin Gly Thr Lys Val Glu Ile Lys 100 105 <210> 44 <211> 63 <212> DNA <213> Artificial Sequence <400> 44 atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60 ccg 63 <210> 45 <211> 45 <212> DNA <213> Artificial Sequence <400> 45 ggtggcggtg gctcgggcgg tggtgggtcg ggtggcggcg gatct 45 <210> 46 <211> 135 <212> DNA <213> Artificial Sequence <400> 46 accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 60 tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg 120 gacttcgcct gtgat 135 <210> 47 <211> 72 <212> DNA <213> Artificial Sequence <400> 47 atctacatct gggcgccctt ggccgggact tgtggggtcc ttctcctgtc actggttatc 60 accctttact gc 72 <210> 48 <211> 126 <212> DNA <213> Artificial Sequence <400> 48 aaacggggca gaaagaaact cctgtatata ttcaaacaac catttatgag accagtacaa 60 actactcaag aggaagatgg ctgtagctgc cgatttccag aagaagaaga aggaggatgt 120 gaactg 126 <210> 49 <211> 336 <212> DNA <213> Artificial Sequence <400> 49 agagtgaagt tcagcaggag cgcagacgcc cccgcgtaca agcagggcca gaaccagctc 60 tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc 120 cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg cctgtacaat 180 gaactgcaga aagataagat ggcggaggcc tacagtgaga ttgggatgaa aggcgagcgc 240 cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac caaggacacc 300 tacgacgccc ttcacatgca ggccctgccc cctcgc 336 <210> 50 <211> 381 <212> DNA <213> Artificial Sequence <400> 50 gaggttcagc tgcagcagtc tggagctgag ctgatgaagc ctggggcctc agtgaagata 60 tcctgcaagg ctactggcta cacattcagt agctactgga tggagtgggt aaagcagagg 120 cctggacttg gccttgagtg gattggacag attttacctg gaagtagtta tactaactac 180 aatgacaaat tcaagggcaa ggccacattc actgcagata catcctccaa cacagcctac 240 atgcaactca gcagcctgac atctgaggac tctgccgtct attactgtgc aaaaaagggg 300 ggcccgatat actatggtaa ccgtcctttt tactatgcta tggactactg gggtcaagga 360 acctcagtca ccgtctcgag t 381 <210> 51 <211> 321 <212> DNA <213> Artificial Sequence <400> 51 aacattatga tgacacagac tcccaaattc ctgcttgtat cagcaggaga cagggttacc 60 ataacctgca aggccagtca gagtgtgagt aatgatgtag cttggtacca acagaagcca 120 gggcagtctc ctaaactgca gatatactat gcatccaatc gctacactgg agtccctgat 180 cgcttcactg gcagtggata tgggacggat ttcactttca ccatcagcac tgtgcaggct 240 gaagacctgg cagtttattt ctgtcagcag gattatagct ctccgctcac gttcggtgct 300 gggacaaagt tggaaataaa a 321 <210> 52 <211> 354 <212> DNA <213> Artificial Sequence <400> 52 gaggtccagc tgcaacagtc tggacctgag ctggtgaagc ctggagcttc aatgaagata 60 tcctgcaagg cttctggtta ctcattcact ggctacacca tgaactgggt gaaacagagc 120 catggaaaga accttgagtg gattggactt attaatcctt ataatggtcg tactatatac 180 aaccagaagt tcaagggcaa ggccacatta actgtagaca agtcatccag cacggcctac 240 atggagctcc tcagtctgac gtccgaggac tctgcagtct attactgtgc aagagtggca 300 ttacggtatg ctatggacta ctggggtcaa ggcacctctc tcacagtctc gagt 354 <210> 53 <211> 321 <212> DNA <213> Artificial Sequence <400> 53 gacattgtga tgactcagtc tcaaaaattc atgtccacat cagtaggaga cagggtcagc 60 gtcacctgca aggccagtca gaatgtgggt actaatgtag cctggtatca acagaaacca 120 gggcaatctc ctaaagcact gatttactcg gcatcctacc ggtacagtgg agtccctgat 180 cgcttcacag gcagtggatc tgggacagat ttcactctca ccatcagcaa tgtgcagtct 240 gaagacttgg cagagtattt ctgtcagcaa tataacagct atcctctcac gttcggtgct 300 ggcaccaagc tggaaatcaa t 321 <210> 54 <211> 357 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 54 gaggtccagc ttcagcagtc tggacctgag ctggtgaagc ctggagcttc aatgaagatt 60 tcctgcaagg cttctggtta ctcattcgct ggctacaccg tgaactgggt gaagcagagc 120 catggcaaga accttgagtg gattggactt attaatcctt acaatggtgg tactacctac 180 accccgaagt tcaaggacaa ggccacatta actgtagaca agtcatccag cacagcctat 240 atggagctcc tcagtctgac atctgaggac tctgcagtct actactgtac aagagggggt 300 ttctataggt acgactttga cttctggggc caaggaacct cagtcaccgt ctcgagt 357 <210> 55 <211> 321 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 55 gacatcctga tgacccagtc tccatcctcc ttatctgcct ctctgggaga aagagtcagt 60 ctcacttgtc gggcaagtca ggaaattagt ggttacttaa gttggcttca gcagaaacca 120 gatggaacta ttaaacgcct gatctacgcc gcatccactt tagattctgg tgtcccaaaa 180 aggttcagtg gcagtaggtc tgggtcagat tattctctca ccatcagcag ccttgagtct 240 gaagattttg cagactatta ctgtctacaa tatgctagtt atccattcac gttcggctcg 300 gggaccaagc tggaaatgaa a 321 <210> 56 <211> 357 <212> DNA <213> Artificial Sequence <400> 56 caggttcagc tgcagcagtc tggacctgag ctggtgaagc ctggaacttc aatgaagatt 60 tcctgcaagg cttctggtta ctcattcact ggctacaccg tgaactgggt gaagcagagc 120 catggcaaga accttgagtg gattggactt attaatcctt acaatggtgg tactacctac 180 accccgaagt tcaaggacaa ggccacatta actgtagaca agtcatccag cacagcctat 240 atggaactcc tcagtctgac atctgaggac tctgcagtct actactgtac aagagggggt 300 ttctataggt acgactttga cttttggggc caaggcacct ctctcacagt ctcgagt 357 <210> 57 <211> 321 <212> DNA <213> Artificial Sequence <400> 57 gaaatccaga tgacccagtc tccatcctcc ttatctgcct ctctgggaga aagagtcagt 60 ctcacttgtc gggcaagtca ggacattggt agtagcttaa actggcttca gcaggaacca 120 gatggaacta ttaaacgcct gatctacgcc acatccagtt tagattctgg tgtccccaaa 180 aggttcagtg gcagtaggtc tgggtcagat tattctctca ccatcagcag ccttgagtct 240 gaagattttg tagactatta ctgtctacaa tatgctagtt ctccgtacac gttcggaggg 300 gggaccaagc tggaaatgaa a 321 <210> 58 <211> 354 <212> DNA <213> Artificial Sequence <400> 58 gaggttcagc tgcagcagtc tggacctgag ctggtgaagc ctggagcttc aatgaagata 60 tcctgcaagg cttctggtta ctcattcact ggctacacca tgaactgggt gaaacagagc 120 catggaaaga accttgagtg gattggactt attaatcctt ataatggtcg tactatatac 180 aaccagaagt tcaagggcaa ggccacatta actgtagaca agtcatccag cacggcctac 240 atggagctcc tcagtctgac gtctgaggac tctgcagtct attactgtgc aagagtggca 300 ttacggtatg ctatggacta ctggggtcaa ggcacctctc tcacagtctc gagt 354 <210> 59 <211> 321 <212> DNA <213> Artificial Sequence <400> 59 agcattgtga tgacccagtc tcaaaaattc atgtccacat cagtaggaga caaagtcagc 60 gtcacctgca aggccagtca gagtgtgtat actaatgttg cctggtatca acagaaacca 120 gggcaatctc ctaaatcact gatttactcg gcatcctacc gatacaatgg ggtccctgat 180 cgcttcacag gcagtggatc tgggacagat ttcactctca ccatcagcaa tgtgcagtct 240 gaagacttgg cagagtattt ctgtcagcaa tataacagct atccggtcac gttcggtgct 300 gggacaaaat tggaaataaa a 321 <210> 60 <211> 381 <212> DNA <213> Artificial Sequence <400> 60 caagtccagt tggtccagag tggggctgaa gtaaaaaagc caggcgcaag tgtcaaagtt 60 tcctgtaaag ccactggtta tacattttct agctactgga tgcattgggt acggcaagcg 120 ccgggacaag gtttagagtg gatggggata atccttcctg gctccagcta tacctcgtat 180 gcgcaaaaat tccaaggacg ggtgaccatg actagggata caagcacctc cacagtgtac 240 atggaactct ctagcctgcg tagcgaggat acagccgtgt attattgtgc aaaaaaaggc 300 ggccccattt actatgggaa tagacccttt tattacgcaa tggattattg gggccaggga 360 accactgtga cagtctcgag t 381 <210> 61 <211> 321 <212> DNA <213> Artificial Sequence <400> 61 gatatcgtga tgacgcaatc acctgacagt ctggccgtta gcctgggcga acgcgccaca 60 attaattgta aggccagcca aagcgtatca aacgacttgg cctggtatca gcaaaaaccg 120 ggccagccgc cgaaattgct tatttattat gcatcaacac gtgaaagcgg agttcccgac 180 cggttcagcg gctctggatc gggaactgat ttcacgctga cgatatcttc tctccaggca 240 GAGGACGTCG CCCTTATATT ATTCACAAAG ATGATTACTC CTGACCTTTT GGCGGC 300 GGCACCAAAG TCGAGATCAA G 321 <210> 62 <211> 381 <212> DNA <213> Artificial Sequence <400> 62 CAAGTCCAGT TGGTCCAGAG TGGGGCTGAA GTA AAAAAGCC AGGC GCAAGTGT CAAAGTT 60 TCCTGTAAGG CC ACTG GTTAT AC ATTTTCT AGCTACTGGATGC AT TGGGTACGGCAAGCG 120 CCGGGACAAG GTT TAGAGTGG ATGGGGATA ATCCTTCCTG GCTCCAGCTA TACCTCGTAT 180 GCGCAA AAA TTCC AAGGACGGGT GACC ATG ACTAGGGATA CAAGCACCTC CACAGTGTA C 240 ATGGAAC TCTCTAGCCTGC GTAGCGAGGA TACAGCCGTGT ATTATTGTGCA AAA AAAGGC 300 GGCCCCATTT ACTATGGGAA TAGAC CCTTTTATTACGCAATGGATTATTGGGGC CAGGGA 360 ACC ACTGTGAC AGTCTCGAGT 381 <210> 63 <211> 321 <212> DNA <213> Artificial Sequence <400> 63 GATATACAGT TGACCCAGTC ACCGAGCTTC CTGAGCGCCA GC GTTGGCGACC GAGTGAC C 60 attacgtgta aagcgagtca atcggtgtcc aacgatttgg cgtggtatca acagaagcct 120 ggaaaggccc ctaaactcct gatatactac gcaagcacat tacaaagcgg cgtcccatcc 180 cgtttctctg ggagcggcag tggcactgag ttcactctta ccatcagcag tctccaaccg 240 gaagacttcg ccacctacta ctgtcagcaa gactactcta gtccgctgac atttggcggc 300 ggtacgaagg tggaaattaa g 321 <210> 64 <211> 354 <212> DNA <213> Artificial Sequence <400> 64 caagtgcaat tggtgcaaag tggcgcagaa gttaaaaagc caggtagtag cgttaaagtg 60 tcatgcaagg cgagcggcta ctcatttact ggttacacga tcagctgggt gagacaagca 120 ccgggtcaag gactcgaatg gatggggctg atcaaccctt acaatggcag gacaatctac 180 aaccaaaagt tcaaaggaag agtgacaatc accgcggaca aatcaaccag tacggcgtac 240 atggaacttt caagtctgcg atctgaagat acggctgtat actactgcgc ccgtgtcgcc 300 ttaagatatg ctatggatta ctgggggcaa gggactaccg tgacagtctc gagt 354 <210> 65 <211> 321 <212> DNA <213> Artificial Sequence <400> 65 gatatccaaa tgactcagtc accgtcgagc ctaagcgcct ccgtgggcga ccgggttacc 60 ataacatgca aagcctctca aagcgtatac acgaatttgg cttggttcca acagaaaccc 120 ggtaaggctc cgaaatctct gatctacagc gccagctcac tgcaatctgg tgtaccaagt 180 cgcttctccg ggtccgggtc cgggacagac tttacgctga cgatttcgtc attgcagccc 240 gaggactttg ccacgtacta ttgccaacag tataacagct acccggtaac tttcgggcaa 300 ggaaccaaag ttgaaatcaa g 321 <210> 66 <211> 110 <212> PRT <213> Artificial Sequence <400> 66 Ser Ser Glu Leu Thr Gin Asp Pro Ala Val Ser Val Ala Leu Gly Gin 1 5 10 15 Thr Val Arg lie Thr Cys Gin Gly Asp Ser Leu Arg Ser Tyr Tyr Ala 20 25 30 Ser Trp Tyr Gin Gin Lys Pro Gly Gin Ala Pro Val Leu Val lie Tyr 35 40 45 Gly Lys Asn Asn Arg Pro Ser Gly lie Pro Asp Arg Phe Ser Gly Ser 50 55 60 Ser Ser Gly Asn Thr Ala Ser Leu Thr lie Thr Gly Ala Gin Ala Glu 65 70 75 80 Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp Ser Ser Gly Asn Pro 85 90 95 Pro Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 100 105 110 <210> 67 <211> 119 <212> PRT <213> Artificial Sequence (Artificial Sequence) <400> 67 Gln Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val His Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Ser His 20 25 30 Ser Met Asn Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ser lie Ser Ser Asp Ser Thr Tyr Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ser Gly Gly Gin Trp Lys Tyr Tyr Asp Tyr Trp Gly Gin Gly 100 105 110 Thr Leu Val Thr Val Ser Ser 115 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <400> 68 cgactggcca gggcgcctgt 20

Claims

1. A chimeric antigen receptor comprising an extracellular antigen-binding domain, wherein the extracellular antigen-binding domain comprises a GPRC5D antibody light chain variable region and a GPRC5D antibody heavy chain variable region, wherein, The variable region of the GPRC5D antibody light chain includes antibody light chain CDR sequences: LCDR1 is SEQ ID NO:28, LCDR2 is YAS, and LCDR3 is SEQ ID NO:29; the variable region of the GPRC5D antibody heavy chain includes heavy chain CDR sequences: HCDR1 is SEQ ID NO:13, HCDR2 is SEQ ID NO:14, and HCDR3 is SEQ ID NO:

15. The chimeric antigen receptor further comprises a transmembrane domain and an intracellular domain, wherein the transmembrane domain is any one or more of the following groups: α, β, or δ chains of T cell receptors, CD3ε, CD3δ, CD4, CD5, CD8α, CD9, CD16, CD22, CD27, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD152, CD 154 and PD1, and / or the intracellular domains are any one or more of the following groups: CARD11, CD2, CD7, CD27, CD28, CD30, CD40, CD54 (ICAM), CD83, CD134, CD137 (4-1BB), CD3ζ, CD150 (SLAMF1), CD152 (CTLA4), CD223 (LAG3), CD270 (HVEM), CD273 (PD-L2), CD274 (PD-L1), CD278 (ICOS), DAP10, LAT, NKD2C, SLP76, TRIM, and ZAP70.

2. The chimeric antigen receptor as described in claim 1, wherein, The variable region sequence of the GPRC5D antibody heavy chain is SEQ ID No:3 and the variable region sequence of the GPRC5D antibody light chain is SEQ ID No:4, or the variable region sequence of the GPRC5D antibody heavy chain is SEQ ID No:38 and the variable region sequence of the GPRC5D antibody light chain is SEQ ID No:39, or the variable region sequence of the GPRC5D antibody heavy chain is SEQ ID No:40 and the variable region sequence of the GPRC5D antibody light chain is SEQ ID No:

41.

3. The chimeric antigen receptor as described in claim 1, wherein the extracellular antigen-binding domain further comprises a leader peptide and a hinge region.

4. The chimeric antigen receptor as claimed in claim 1, wherein the chimeric antigen receptor comprises the leader peptide shown in SEQ ID No:44, the variable region of the GPRC5D antibody light chain, the linker peptide shown in SEQ ID No:45, the variable region of the GPRC5D antibody heavy chain, the hinge region shown in SEQ ID No:46, the CD8α transmembrane domain shown in SEQ ID No:47, the 4-1BB co-stimulatory signal transduction region shown in SEQ ID No:48, and the CD3ζ signal transduction domain shown in SEQ ID No:

49.

5. Use of the chimeric antigen receptor as described in any one of claims 1-4 in the preparation of a medicament or pharmaceutical composition for the treatment of myeloma.

6. A polynucleotide encoding a chimeric antigen receptor as described in any one of claims 1-4.

7. A vector comprising the polynucleotide as described in claim 6.

8. An immune effector cell comprising the polynucleotide of claim 6 or the vector of claim 7.

9. The immune effector cell as described in claim 8, wherein the immune effector cell is a T cell.

10. The immune effector cell of claim 8, wherein the immune effector cell is a PD1 gene knockout cell.

11. A pharmaceutical composition comprising the chimeric antigen receptor of any one of claims 1-4, the polynucleotide of claim 6, the carrier of claim 7, or the immune effector cell of any one of claims 8-10.

Images