Genetic deafness detection system, marker or probe, drug and application
By identifying and repairing the Taperin-Clic5-Ptprq cyclic protein complex at the root of hair cell cilia, and using CRISPR/Cas9 gene editing and AAV vector delivery systems, the problem of permanent deafness caused by functional damage to hair cells was solved, and partial recovery of hearing function was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SOUTHEAST UNIV
- Filing Date
- 2022-12-15
- Publication Date
- 2026-04-14
AI Technical Summary
Current technologies cannot effectively restore the functional damage to hair cells, leading to permanent deafness. Hearing aids and cochlear implants can only partially restore hearing and cannot fundamentally solve the problem.
By identifying and detecting the structure of the Taperin-Clic5-Ptprq cyclic protein complex at the root of hair cells' cilia, gene therapy was performed using CRISPR/Cas9 gene editing and AAV vector delivery systems to insert HA marker coding sequences, combined with STED imaging technology, and applying HA markers or exogenous TAPERIN and hammerhead ribozyme N107V1.
The function of hair cells was restored, hearing was partially restored, the importance of Taperin in the ring structure at the root of hair cells and hair cilia was clarified, and the stability and normal function of the hearing structure were ensured.
Smart Images

Figure CN115717166B_ABST
Abstract
Description
Technical Field
[0001] This disclosure pertains to the field of hearing impairment, specifically relating to hereditary deafness detection systems, biomarkers or probes, drugs, and their applications. Background Technology
[0002] Hearing impairment is the most common sensorineural disorder worldwide. In mammals, auditory hair cells and supporting cells are only produced during embryonic development. Once hair cells are damaged, they cannot regenerate spontaneously, leading to permanent deafness. Irreversible damage to hair cells is the key cause of sensorineural hearing loss. Clinically, treatment for deafness primarily involves hearing aids and cochlear implants. While these methods can partially restore hearing, they rely on residual hair cells and have limitations, failing to address the root cause. Therefore, the ideal treatment for sensorineural hearing loss is gene therapy to regenerate hair cells, repairing the structure and function of the cochlea and fundamentally restoring hearing. Currently, adeno-associated virus (AAV)-mediated gene therapy is the most promising method for treating sensorineural hearing loss.
[0003] Many gene mutations can lead to hearing loss. Among them, Taperin (Tprn) is a hearing-related protein expressed in the root of the stoma of the hair cells in the inner ear. It has been found that mutations in this gene can lead to autosomal recessive deafness (DFNB79).
[0004] Current research indicates that mutations in taperin can cause deafness in mice and humans. Clinically, the main treatments for deafness are hearing aids and cochlear implants, but both of these methods rely on the quality and quantity of remaining hair cells and spiral neurons. Summary of the Invention
[0005] In view of the shortcomings of the prior art, the purpose of this disclosure is to provide a detection system, biomarkers or probes, drugs and applications for hereditary deafness, and to explore the research and application of Taperin and Taperin-Clic5-Ptprq in hereditary deafness.
[0006] The objective of this disclosure can be achieved through the following technical solutions:
[0007] A system for diagnosing, treating, or detecting hereditary deafness, the system comprising:
[0008] The recognition module identifies the cyclic protein complex structure of Taperin-Clic5-Ptprq at the root of the hair cell cilia.
[0009] The detection module detects and identifies the integrity of the Taperin-Clic5-Ptprq cyclic protein complex structure.
[0010] The output module outputs the integrity information of the cyclic protein complex structure of Taperin-Clic5-Ptprq detected by the detection module.
[0011] In some disclosures, the detection module also includes the detection of Taperin expression levels;
[0012] The detection module and the output module include a discrimination module, which is used to determine whether Taperin is overexpressed;
[0013] The output module outputs the information determined by the discrimination module.
[0014] In some disclosures, the recognition module identifies the cyclic protein complex structure of Taperin-Clic5-Ptprq at the root of the hair cell cilia, including:
[0015] The biomarker is HA, which marks the Taperin-Clic5-Ptprq cyclic protein complex at the root of the hair cell cilia. The CRISPR / Cas9 genome editing inserts a hemagglutinin (HA) marker coding sequence at the TAPERINC- terminus before the stop codon. The peptide-mediated splitting Cas9 system is delivered to HCs along with the recombinant donor via the AAV vector Anc80L65.
[0016] Alternatively, STED imaging can be used to characterize the distribution of Taperin.
[0017] In a second aspect, a biomarker or probe for the diagnosis, treatment, or detection of hereditary deafness includes HA, said HA being a cyclic protein complex of Taperin-clic5-ptprq.
[0018] Thirdly, a pharmaceutical agent for the diagnosis, treatment, or detection of hereditary deafness, including any one of the following:
[0019] As described in the second aspect, markers or probes;
[0020] Exogenous taperin;
[0021] Hammerhead ribozyme N107V1.
[0022] Fourthly, a kit for the diagnosis, treatment, or detection of hereditary deafness, characterized in that the kit contains any one of the following:
[0023] As described in the second aspect, markers or probes;
[0024] Exogenous taperin;
[0025] Hammerhead ribozyme N107V1.
[0026] In some publications, the use of the Taperin-clic5-ptprq cyclic protein complex in pharmaceuticals for the diagnosis, treatment, or detection of hereditary deafness has been documented.
[0027] In some disclosures, protein carriers are used in pharmaceuticals for the diagnosis, treatment, or detection of hereditary deafness, said protein carriers including AAV carriers containing TAPERIN.
[0028] In some publications, hammerhead ribozymes are used in pharmaceuticals for the diagnosis, treatment, or detection of hereditary deafness caused by the overexpression of exogenous taperin.
[0029] To address the shortcomings of existing technologies, this invention provides a method for gene therapy that can restore hearing in mice by treating taperin-induced deafness.
[0030] The beneficial effects of this disclosure are:
[0031] It was clarified that Taperin forms a ring-like structure in the cone-shaped region at the root of the hair cell stylus;
[0032] The structure of the Taperin-Clic5-Ptprq ring complex at the root of the static ciliary was determined;
[0033] The formation of the cyclic complex structure of Taperin-Clic5-Ptprq is crucial for maintaining hearing, and its disruption can cause severe hearing loss.
[0034] Taperin expression levels are crucial for the maintenance and stability of the ring structure;
[0035] Hearing loss caused by the destruction of the ring structure can be treated through gene delivery. Attached Figure Description
[0036] To more clearly illustrate the technical solutions in the embodiments of this disclosure or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, those skilled in the art can obtain other drawings based on these drawings without creative effort.
[0037] Figure 1: Schematic diagram of Taperin located at the root of the cilia; (A) Representative confocal images of Taperin (magenta) and F-actin (green) in P6 mouse HCs; scale bar: 5 μm; (B) Two-color confocal images of Taperin (magenta) and F-actin (green) in OHCs and IHCs; the intensity distribution corresponding to the dashed lines is shown in the figure; scale bar: 1 μm; (C) Representative confocal images of Taperin in P6 mouse OHCs and IHCs; scale bar: 1 μm; (D) Left, confocal image of Myo7a showing the cochlear spiral; right, illustrating the relative position in the entire cochlear spiral; we consider 0% to be the bottom of the cochlear spiral and 100% to be the top of the cochlear spiral; scale bar: 1 mm; (E) Conventional confocal images of Taperin in OHCs and IHCs at different bends of the cochlear spiral shown in (D); scale bar: 5 μm (39) and 1 μm (bottom);
[0038] Figure 2 : TAPERIN forms a ring structure in the cone region of the cilia; (A) Conventional STED images of TAPERIN in mouse OHC and IHC, with magnified yellow box areas, as shown in the figure; the inserted images are confocal images under the same imaging field; the fluorescence intensity corresponding to the dashed lines (1-8) is shown at the bottom; the scale bars in OHC are 1 μm and 500 nm, and in IHC they are 1 μm and 400 nm; (B) Diameter of the TAPERIN ring in OHC and IHC; the error bars are the standard error of the mean; (C) HEK-293T cells transfected with FLAG, Tprn-FLAG, or Tprn-HA structures; immunoprecipitation was performed using FLAG antibody, followed by immunoprecipitation using FLAG or HA antibody. (D) A strategy for inserting HA into the Tprn coding sequence in HCs via AAV and Crispr / Cas9-mediated homology-directed repair (HDR); (E) An experimental model of Tprn-HA knock-in (KI) in the mouse cochlea described using Anc80L65; cochleas were collected at P13 for further PCR, genome sequencing, and STED imaging; (F) A standard STED image of TAPERIN-HA in AAV-infected IHCs; the HA sequence was inserted into the Tprn coding sequence in IHCs via AAV and Crispr / Cas9-mediated HDR, with a dose of 9 × 10⁻⁶ in the left ear. 10 GCs; The STED image magnified in units of the yellow dashed box area in the figure represents a representative continuous optical section along the z-axis (interval of 0.319 μm); The rings are numbered and show the intensity distribution corresponding to the dashed lines (1-3); The scale bars are 1 μm and 250 nm, respectively;
[0039] Figure 3 : TAPERIN-CLIC5-PTPRQ forms a ring complex in the cone region of the cilia; Conventional confocal and STED images of TAPERIN (magenta) and F-actin (green) in P14 mouse OHCs; Intensity distributions corresponding to the dashed lines (1-6) are shown below; Scale bar: 500 nm; (B) Co-IP between TAPERIN and actin; Mouse N2A cells transfected with FLAG, Tprn-FLAG, Tprn-HA, or Actb-FLAG plasmids; Immunoprecipitation was performed using FLAG antibody, followed by Western blotting using β-actin or HA antibody to detect co-expressed proteins; This image represents three independent experiments; (C) (A) Co-transfection of HEK-293T cells with FLAG, Tprn-FLAG, or Clic5-HA plasmids; immunoprecipitation using FLAG antibody followed by Western blotting using HA antibody to detect co-expressed proteins; representative data from three independent experiments; (D) Representative STED image of CLIC5-HA in Anc80L65-Clic5-HA-infected cochlear P17 IHC; scale bar: 1 μm; (E) Representative double STED image of CLIC5-HA (magenta) and TAPERIN (green) in Anc80L65-Clic5-HA-infected cochlear IHC on day 17 post-P3 surgery, at a dose of 4.5 × 10⁻⁶. 10 GCs; 3D dual STED images of the xz and yz axes are displayed; the mean diameters of the TAPERIN and CLIC5 concentric rings are 226±7 nm and 389±9 nm, respectively; scale bar: 400 nm; error bars are the standard errors of the mean; p-values are calculated by t-test; ****p<0.0001; (F) HEK 293T cells were treated with FLAG, Tprn-FLAG, Clic5-FLAG, or Ptprq. Cyto - HA structural transfection; immunoprecipitation using FLAG antibody, followed by Western blotting using either FLAG or HA antibody to detect co-expressed proteins; these images represent three independent experiments; conventional confocal and STED images of PTPRQ-HA in (G)AAV-infected IHC; HA sequence inserted into the end of the Ptprq coding sequence in IHC via AAV and Crispr / Cas9-mediated HDR, with a dose of 9 × 10⁻⁶ in the left ear. 10GCs; Scale bar: 1 μm; (H) HeLa cells were transfected with Tprn-HA, Clic5-mNeoGreen or memPtprq-HA structures; TAPERIN signal was stained and imaged 2 days after transfection, and the TAPERIN signal intensity distribution corresponding to the dashed line is shown in the figure; Cyto: cytoplasm; Nuc: nucleus; Scale bar: 10 μm;
[0040] Figure 4In vivo disruption of the interaction between TAPERIN and CLIC5 leads to hearing loss and sensorineural epithelial damage; (A) Diagram of a TAPERIN fragment structure used to identify the CLIC5 binding domain, with binding regions indicated by "+"; (B) Co-transfection of HEK293T cells with TAPERIN fragment structures and CLIC5-FLAG structures; Immunoprecipitation using FLAG antibody followed by Western blotting using HA antibody to detect co-expressed proteins; these images represent three independent experiments; (C) TAPERIN #5 and #6 fragments competitively weaken the interaction between TAPERIN and CLIC5; HEK 293T cells were co-transfected with TAPERIN fragments (#5 or #6) and Clic5-FLAG structures; immunoprecipitation was performed using FLAG antibody, followed by Western blotting using HA antibody to detect co-expressed proteins; these images represent two independent experiments; (D) Schematic diagram illustrating the Anc80L65 competitive inhibition assay; at P2, all mice were injected with the corresponding virus in their left ear; ABR testing was performed at least 4 weeks after infection and cochleas were collected for further morphological analysis; (E) Anc80L65 was injected on day 35 post-P2 surgery. Representative cochlear confocal images of Tprn#5-HA; green: Myo7a, magenta: Tprn#5-HA; scale bar: 10 μm; (F) Representative cochlear confocal images of Anc80L65-Tprn#5-HA injected on day 35 post-P2 surgery; green: phalloidin, magenta: TAPERIN; scale bar: 400 nm; (G) Representative cochlear confocal images of Anc80L65-Tprn#6-HA injected on day 56 post-P2 surgery; green: Myo7a, magenta: Tprn#6- HA; Scale bar: 10 μm; (H) Representative ABR waveforms recorded from mice in the control group, Anc80L65-Tprn#5-HA injection group, and Anc80L65-Tprn#6-HA group after 32 days, showing a 16 kHz sound between 20 dB and 90 dB; (I) Recording ABR test results of mice at P34 in the control group (n=4), Anc80L65-Tprn#5-HA injection group (n=6), and Anc80L65-Tprn#5-HA injection group (n=6); (J) SEM images of cochlear epithelial cells in mice injected with Anc80L65-Tprn#5-HA on day 35 post-P2 surgery; yellow triangles indicate missing HCs; scale bar: 10 μm; (K) SEM images of HCs cilia in the control group and Anc80L65-Tprn#5-HA-infected group on day 35 post-P2 surgery; yellow arrows indicate missing cilia; scale bar: 1 μm; (L) Total number of cilia in OHCs in the control group and Anc80L65-Tprn#5-HA-infected group, corresponding to (K) figure; with 5.25×10. 9 Or 7.5×10 9 The GCs were administered to the left ear of all mice with the corresponding viral doses; the error bar is the standard error of the mean, and the p-values were calculated by t-test, *p<0.05, **p<0.01, ***p<0.001;
[0041] Figure 5 : Taperin deficiency can lead to severe hearing loss and damage to the cilia; (A) Tprn generated using the CRISPR / Cas9 system – / – A schematic diagram of mice; (B) Control group at P30, Tprn + / – and Tprn – / – Confocal images of taperin in mouse cochlear epithelial cells; scale bar: 10 μm; (C) control group and Tprn at P30. + / – and Tprn – / – Representative ABR trajectories recorded in mice show a 16kHz sound between 20dB and 90dB; (D) Recorded ABR results in mice, control group (1 month, n=3), Tprn + / – (1 month, n=3), Tprn – / – (1 month, n=5) and Tprn – / – (2 months, n=3); (E) at P30, 2 months and 4.5 months, control mice and Tprn – / – Representative confocal images of Myo7a signals at the apex, middle, and base of the mouse cochlear spiral; yellow arrows indicate missing OHCs, and triangles indicate missing IHCs; Myo7a is used for HC labeling; scale bar: 20 μm; (F) control group and Tprn at P30. – / – Representative SEM images of cilia in mouse OHC; numbers 1-3 represent rows of cilia from tallest to shortest; yellow arrows indicate missing cilia; scale bar: 1 μm; control group and Tprn at (G)P30. – / – Statistics on the total number of cilia and the number of the shortest row of cilia in mice (row 3); (H)P30 control group and Tprn – / – SEM images of cilia in mouse IHCs; yellow arrows indicate fused cilia; scale bar: 2 μm; error bars are the standard errors of the mean; p-values were calculated by t-test, with no significant difference, *p<0.05, **p<0.01, ***p<0.001;
[0042] Figure 6 Exogenous TAPERIN in Tprn – / –Overexpression in mice led to stenociliary atrophy and hearing loss in a dose-dependent manner; (A) Schematic diagram of the control group and exogenous Tprn-HA expression vector; (B) Experimental paradigm describing the ANC80L65 rescue experiment; At P1-P2, the expression rate in the left ear of all mice was 4.5 × 10⁻⁶. 9 GCs were administered viral doses; ABR testing was performed 4 weeks after injection and cochlea samples were collected for further tissue analysis; (C) ABR results 4 weeks after injection: Tprn – / – Mice, Tprn injected with empty vector + / + Mouse (Tprn) – / – +Anc80) and injection of exogenous Tprn-HA (Tprn – / – +Anc80-Tprn) of Tprn – / – Mice; (D) Representative confocal images of exogenous taperin signal in the styloid cilia at 4 weeks of age, from the control group and Anc80L65-Tprn-HA (dose 4.5 × 10⁻⁶). 9 GCs) infected with Tprn – / – Mouse HCs; Blue: F-actin, Purple-red: Taperin, Red: HA; Scale bar: 1 μm; (E) At 4 weeks, from Tprn – / – +Anc80L65-Tprn-HA mice (dose 4.5×10⁻⁶) 9 Representative confocal images of exogenous Tprn-HA signals in OHC and IHC at GCs; Red: HA, Gray: albumin (PV), an HC marker; Scale bar: 2 μm; (F) Representative ABR trajectories of wild-type mice injected with Anc80 and different titers of Anc80-Tprn-HA at P30, showing 16 kHz sound between 20 dB and 90 dB; (G) ABR results of wild-type mice injected with Anc80 and different doses of Anc80L65-Tprn-HA at P30; (H) Anc80L65-Tprn-HA injected at 4 weeks (dose of 7.5 × 10⁻⁶). 9 Representative SEM images of cochlear epithelial cells from wild-type GCs mice; scale bar: 10 μm; all mice were injected with the virus at P1-P2; error bars are the standard error of the mean.
[0043] Figure 7 HHR-mediated expression of appropriate amounts of exogenous taperin partially restored Tprn. – / – Impaired hearing in mice; (A) Schematic diagram of HHR-mediated exogenous Tprn-HA vector expression; (B) Tprn from Anc80-Tprn-HA-HHRN107v1 at P30. – / –Representative confocal images of TAPERIN-HA signal (red) in mouse cochlear epithelial cells; scale bar: 20 μm; (C) Representative ABR trajectories of different groups of mice recorded at P30: Tprn + / + ,Tprn – / – ,Tprn – / – +Anc80-Tprn-N107v1(6×10 9 GCs) and Tprn – / – +Anc80-Tprn-N107v1(1.5×10 10 (GCs) showed a 16kHz sound between 20dB and 90dB; (D) showed the corresponding ABR test results of mice at different frequencies; (E) 14 Tprn mice at P30. – / – +Anc80-Tprn-N107v1(6×10 9 Results of ABR threshold variation with frequency in GC-injected mice; (F) Anc80-Tprn-N107v1 (6×10⁻⁶) injected at 2 months. 9 GCs) of Tprn – / – ABR results in mice showed that functional hearing recovered at 1 month; (G)Tprn – / – (WT control), Anc80-Tprn-HA-N107v1(N107v1, 6×10) 9 GCs) and Anc80-Tprn-HA (Tprn, 6 × 10 9 qPCR results of Tprn-HA expression at the transcriptional level in the cochlea and contralateral cochlea of GC-injected mice; representative images of (H)TAPERIN-HA immunoblot; from injection of Anc80-Tprn-HA-N107v1 (6×10⁻⁶) mice. 9 GCs) or Anc80-Tprn-HA (6×10 9 Protein samples were collected from the cochlea of mice containing GCs; (I) Anc80-Tprn-HA-N107v1 (N107v1, 6×10 9 GCs) or Anc80-Tprn-HA (Tprn, 6 × 10 9Representative confocal images of TAPERIN-HA (grey) signal in cochlear epithelial cells of mice injected with GCs; scale bar: 5 μm; (J) Conventional confocal and STED images of TAPERIN-HA in rescued IHCs; intensity distribution corresponding to dashed lines (1-6) is shown on the right; scale bar: 1 μm; virus was injected into the left ear of all mice at P1-P2, and samples and data were collected at P32; error bars are the standard error of the mean, p-values were calculated by t-test, *p<0.05, **p<0.01, ***p<0.001; Detailed Implementation
[0044] The technical solutions of the embodiments of this disclosure will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this disclosure, and not all embodiments. Based on the embodiments of this disclosure, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this disclosure.
[0045] Example 1: Confirmation of tperin expression at the root of cochlear styloid cilia
[0046] First, the location of taperin in the Corti organ was examined by immunofluorescence staining. Taperin was distributed in hair cells and supporting cells, and emitted a strong signal in the cone-shaped region of the cilia in the HC on day 6 after birth in mice. Figure 1 (A and B). To determine the presence of taperin in the early stages of HCs development, we measured taperin expression in the stomatal cilia at different developmental stages at birth. Taperin was concentrated in the epidermal plate of HCs as early as P0, but no taperin signal was detected in the cone region of the stomatal cilia at P0. Figure 1 (C). Taperin begins to accumulate in a cone-shaped region around P3 from the base (0%) of the cochlear spiral to the apex (100%). Figure 1 (D and E). Two-color fluorescence imaging results confirmed that each TAPERIN cluster spatially corresponds to a single stereocilia in outer hair cells (OHCs) and inner hair cells (IHCs). Figure 1 (B). In conclusion, our findings confirm that TAPERIN is a protein with specific localization in the cone-shaped region of the static cilia of well-developed HCs.
[0047] Example 2: Taperin forms a ring-shaped structure in the cone-shaped region at the root of the static cilia.
[0048] Recent advancements in super-resolution fluorescence microscopy have enabled highly precise molecular visualization, and the STED technique has been successfully developed to obtain high spatial resolution protein distributions within cellular compartments. To achieve even higher spatial resolution of taperin distribution in cilia, particularly in the cone region, we used STED imaging to characterize taperin distribution. At 100x magnification using confocal microscopy, we observed punctate aggregates of taperin in the cilia of OHC and IHC cells. Figure 2 A). STED showed that TAPERIN formed an organized ring structure with a diameter ranging from 150 nm to 200 nm, and delineated the edges of OHC and IHC ( Figure 2 (A and B). Furthermore, co-immunoprecipitation (Co-IP) experiments showed that TAPERIN molecules have homologous binding affinity ( Figure 2 Previous studies have shown that taperin appears as a dense point extending to the core of the stereocilia using stochastic optical reconstruction microscopy (STORM), which is inconsistent with our results. To rule out the influence of non-specific antibody binding, we used CRISPR / Cas9 genome editing to insert a hemagglutinin (HA) marker coding sequence at the mouse taperin-terminus before the stop codon. Figure 2 (D). The peptide-mediated cascade Cas9 system, along with the recombinant donor, was delivered to HCs via the AAV vector Anc80L65. Figure 2 E). Genomic PCR 11 days after viral injection confirmed that the HA tag had been inserted into the genome. Figure 2 Consistent with the above results, the HA signal displayed by the HA antibody showed a similar ring structure in three dimensions (E). Figure 2 This also validates the experimental results obtained using commercial TAPERIN antibodies. In summary, these results indicate that TAPERIN forms a ring structure in the conical region of the cilia and may play a key role in cilia stability.
[0049] Example 3: Taperin-clic5-ptprq cyclic protein complex anchors actin filaments beneath the cell membrane.
[0050] The cone-shaped region is located at the base of the stereocilia, where parallel actin filaments begin to narrow and terminate in an orderly manner. Actin in the stereocilia consists of β-actin and γ-actin. We observed the correlation between taperin and actin in situ using dual STED imaging, where actin was labeled with an organic dye conjugated with phalloidin. STED images show that each taperin ring surrounds an actin dot (…). Figure 3(A) corroborates the result that TAPERIN forms a ring outlining the edge of a single stereocilia cross-section. Since HCs require TAPERIN to regulate stereocilia morphology, we sought to determine the relationship between TAPERIN and the actin terminal in the cone region. We validated its interaction with β-actin by constructing a Tprn overexpression plasmid for in vitro Co-IP. The results revealed an association between TAPERIN and endogenous β-actin, and vice versa. Figure 3 B). Considering the homologous binding affinity of taperin ( Figure 1 TAPERIN (C) may form connective tissue and interact with the tip of actin, thereby stabilizing actin and the stipe. However, how the TAPERIN loop, as a cytoplasmic protein, forms and anchors in the cone region remains unclear. A previous study showed that intracellular chloride channel 5 protein (CLIC5) stabilizes the membrane-actin filament junction in the cone region of the stipe, interacting directly with TAPERIN. We confirmed this observation in Co-IP experiments (C). Figure 3 To visualize their in situ correlation, we packaged the Clic5-HA expression cassette into an AAV vector and delivered it to the cochlea via round window membrane (RWM) injection at P3. The cochlea was harvested at P17 and immunostained with HA and TAPERIN antibodies. The teardrop-shaped CLIC5-HA dots in confocal imaging also exhibited a similar ring-like structure in STED images. Figure 3 In addition, CLIC5 exhibits a concentric ring shape with distinctly smaller taperin rings inside. Figure 3 E). Three-dimensional STED imaging confirmed this observation. Figure 3 As a cytoplasmic protein, the TAPERIN-CLIC5 complex may need to anchor to the cell membrane to hold actin filaments in place. PTPRQ is a membrane protein with a cone-shaped region, and we found that TAPERIN interacts with the C-terminus of PTPRQ (…). Figure 3 To visualize the structure of PTPRQ, we used Cas9-mediated homologous recombination to insert the HA tag into the end of the Ptprq gene coding region and imaged PTPRQ-HA using STED microscopy. PTPRQ exhibits a similar ring-like structure in cochlear HCs (F). Figure 3These results indicate that TAPERIN, CLIC5, and PTPRQ form a cyclic cluster complex in the cone region. To confirm this complex, we transfected HeLa cells with expression plasmids of Tprn, CLIC5, and mem-Ptprq (where the intracellular region of Ptprq is labeled with a membrane signal peptide). We found that TAPERIN coexists with CLIC5 in the cytoplasm, and the TAPERIN-CLIC5 complex is recruited to the vicinity of the cell membrane by the addition of mem-Ptprq. Figure 3 The results indicate that the TAPERIN-CLIC5 complex is anchored by the membrane protein PTPRQ. In summary, these results suggest that TAPERIN interacts with the terminal actin filaments beneath the membrane and may anchor the actin filaments to the base of the stenocilia via CLIC5 and PTPRQ. The integrity of this protein complex may be the reason for the structural stability of the stenocilia and normal hearing.
[0051] Example 4: Disruption of Taperin-Clic5 interaction leads to severe stomatal disturbance and deafness.
[0052] Next, we attempted to determine the potential role of the TAPERIN-CLIC5-PTPRQ ring cluster complex in normal hearing. We first generated several TAPERIN truncations fused with HA tags ( Figure 4 (A) To plot the protein domains crucial for the TAPERIN-CLIC5 interaction. TAPERIN contains a fragment of amino acids 106-506 (TAPERIN... 106-321 and TAPERIN 321-506 All of them have a strong affinity for CLIC5. Figure 4 (B). Consistent with this, TAPERIN 106-321 Or Taperin 321-506 Overexpression of TAPERIN can competitively inhibit the binding of full-length exogenous TAPERIN to CLIC5. Figure 4 To disrupt the in vivo interaction between Taperin and CLIC5, we used Taperin with the fluorescent protein mNeonGreen. 106-321 They were packaged into AAV vectors and delivered to the cochlea of P2 mouse pups. Figure 4 (D and E). Endogenous taperin was detected using antibodies targeting amino acids 350-520. Imaging results showed that endogenous taperin was dispersed along the entire axis of the styloid cilia, rather than concentrated in the cone region. Figure 4 The presence of CLIC5 indicates that proper localization of taperin and the formation of the ring structure requires CLIC5. Furthermore, truncated expression leads to a significant increase in the hearing threshold (F). Figure 4Next, we used scanning electron microscopy (SEM) to image the cilia after TAPERIN106-321 injection and found that disruption of the TAPERIN-CLIC5 interaction led to occasional HC loss (G to I). Figure 4 The degeneration and fusion of stereocilia in IHC (J) and OHC Figure 4 The presence of truncation proteins (K and L) could explain why the expression of these proteins leads to hearing loss. In summary, these results suggest that the interaction between TAPERIN and CLIC5 is necessary for stabilizing the cilia and maintaining normal hearing.
[0053] Example 5: Taperin overexpression failed to salvage hearing function in tpaerin- / - mice.
[0054] Our Co-IP experiments showed that TAPERIN can bind to the intracellular domains of actin, CLIC5, and PTPRQ, indicating that TAPERIN plays a central role in the cone region. To determine the function of TAPERIN in the auditory system, we generated Tprn by deleting all Tprn exons using the CRISPR / Cas9 system. – / – mice ( Figure 5 A). Immunostaining showed Tprn – / – Taperin was completely absent in mouse HCs. Figure 5 (B). Next, we analyzed Tprn using the auditory brainstem response (ABR). – / – The hearing ability of mice was found in adult Tprn – / – The mice exhibited almost complete deafness. Figure 5 (C and D), with mild to severe HC deficiency ( Figure 4 E). Heterozygous mice with Tprn haplo-insufficient doses (Tprn) + / – ) shows normal hearing ( Figure 5 (C and D) and normal sensory epithelial tissue. High-power scanning electron microscopy (SEM) and confocal images show that in Tprn – / – Disordered hair tufts in the apical region of the mouse cochlea (OHCs), with a lack of stereocilia in the middle and basal regions of the cochlea, especially the third row of stereocilia. Figure 5 F and G). Furthermore, fused static cilia were observed in the IHC ( Figure 5 The presence of H indicates that Tprn is crucial for normal hearing.
[0055] Gene therapy has recently emerged as a possible and promising strategy for treating hereditary diseases. To investigate Tprn... – / –To assess the potential for auditory function recovery in mice, we performed RWM injections of Anc80L65-CAG-Tprn-HA at P0–P1 and measured ABR at P30. Figure 6 (A and B), at this stage the mice exhibited severe deafness ( Figure 5 (D). Surprisingly, compared with control mice, the injected mice showed more severe hearing loss at mid- and high-frequency frequencies. Figure 6 (C).
[0056] We want to know why Tprn overexpression not only fails to salvage hearing loss, but actually exacerbates it. – / – Damage to mouse auditory epithelial cells. Considering that endogenous taperin was only clearly detected in the cone region and its expression level in HCs was very low ( Figure 1 We hypothesize that the expression level of exogenous taperin under the control of the CAG promoter is too high to function properly. Therefore, we imaged the exogenous Tprn-HA signal and found that taperin and HA signals could be detected along the entire axis of the stoma, rather than just in the cone region. Figure 6 (D), which may be the cause of the stenocilia defect. Furthermore, we observed almost no Taperin-HA signaling in the cytoplasm or nucleus of any HCs in the 3D stacked images. Figure 6 This indicates that exogenous taperin is mainly transported to the stereocilia. Considering that the taperin protein in the stereocilia may be caused by excessive taperin accumulation, we used different amounts of Anc80L65-Tprn-HA (0.75×10⁻⁶) to measure the protein content of the epithelial cells. 9 GCs, 1.5 × 10 9 GCs, and 4×10 9 Genetic copies of GCs (GCs) were injected into wild-type mice to assess changes in hearing thresholds. ABR results showed that mice injected with different viral titers exhibited increased hearing thresholds at all frequencies, and the thresholds increased with increasing viral load. Figure 6 Furthermore, we observed severe loss of cilia, increased cilia fusion, and loss of polarity in mice injected with Anc80L65-Tprn. Figure 5 H). These results confirm our hypothesis that exogenous TAPERIN plays a role in Tprn – / – Overexpression in mice led to more severe stomatal collapse and increased hearing loss.
[0057] Example 6: Reducing taperin expression with hammerhead ribozyme can partially restore hearing function in taperin- / - mice.
[0058] The above results indicate that proper Taperin localization is crucial for hearing function. Figure 4 Low doses of Anc80L65-CAG-Tprn-HA were insufficient to limit taperin to appropriate levels. Figure 6 (F and G). Considering the low expression level of endogenous TAPERIN, we attempted to significantly reduce the level of exogenous TAPERIN by using HHR. HHR is a small, self-dividing ribozyme widely used to regulate gene expression through the reversible division of transcribed RNA. According to a previous study, type I HHRN107v1 resulted in a 34-fold repression of the Gaussian luciferase reporter gene in HEK293T cells. Introducing N107v1 into the 3'UTR of the exogenous Tprn gene... Figure 7 A) It may reduce gene expression in the cochlea, thereby restoring hearing.
[0059] Regarding N107v1: This sequence is referenced in literature PMID:31873216; the N107V1 sequence (5'–3') is as follows:
[0060] CUGAGGUGCAGGUACAUCCAGCUGACGAGUCCCAAAUAGGACGAAACGCGCUUCGGUGCGUCCUGGAUUCCACUGCUAUCCAC.
[0061] We delivered exogenous Tprn along with N107v1 to P1-P2 Tprn via Anc80L65 injection at the 3'UTR. – / – In the cochlea of mice ( Figure 7 (A) The Tprn level of the injected virus was measured 30 days later. – / – TAPERIN-HA expression levels and hearing threshold in mice. TAPERIN was successfully expressed in hair follicles around P30. Figure 7 (B). ABR experiments showed that injection of a low dose of N107v1 (6×10) 9 Several Tprn (GCs) – / – The hearing threshold of mice was improved. Figure 7 The maximum recovery threshold in the intermediate frequency range (C to E) is approximately 30 dB. Figure 7 D), approximately half of the injected Tprn – / – Mice showed varying degrees of hearing recovery at different frequencies. Figure 7 (E). During a continuous observation period of up to 2 months, treated Tprn – / – One month after hearing recovery, mice showed detectable ABR thresholds in the mid-frequency range; however, untreated mice were severely deaf. Figure 7 F).
[0062] Therefore, we evaluated Tprn expression at both transcriptional and translational levels in Tprn-N107v1-injected mice. Compared to mice injected with Anc80-Tprn, mice injected with Anc80-Tprn-N107v1 showed less Tprn mRNA transcripts in both the cochlea and contralateral cochlea, with approximately 100-fold and 3-fold inhibition, respectively. Figure 7 Similar trends were also confirmed by Western blotting and immunostaining of taperin-HA at the translational level. Figure 7 (H and I). More importantly, Tprn – / – TAPERIN-HA, expressed at low levels in mice, again showed a cyclic structure. Figure 7 The results (J) indicate that the restoration of the TAPERIN ring structure may be fundamental to hearing recovery. This also demonstrates the importance of the ring structure in maintaining normal hearing. In summary, these results suggest that in early developmental stages, adequate delivery of exogenous TAPERIN via HHR and Anc80L65 virus to HCs can restore hearing. Furthermore, in disease treatment, the use of HHR holds promise for achieving therapeutic effects without introducing strong cytotoxicity, thereby improving the safety and efficacy of gene therapy.
[0063] Based on the above research:
[0064] 1. We elucidated the precise structure of taperin at the root of the stenocilia. Previous studies only showed that taperin was expressed at the root of the stenocilia without characterizing its structure. Our study found that taperin forms a ring-like structure at the root of the stenocilia, which has not been reported before.
[0065] 2. The root of the stenocilia contains many proteins that play an important role in maintaining hearing and perform different functions. According to previous studies, we only knew that Taperin, Clic5, and Ptprq were expressed in the root of the stenocilia, but the relationship between them was not clear. Our results show that these three proteins form a cyclic complex structure, which has not been reported before.
[0066] 3. Since Taperin, Clic5, and Ptprq are expressed at the root of the stoma, and mutations in these substances all lead to hearing loss, our results indicate that disruption of the ring structure formed by Taperin-Clic5-Ptprq leads to severe hearing impairment in mice. This suggests that the ring structure formed by Taperin-Clic5-Ptprq plays an important role in maintaining hearing.
[0067] 4. Because gene therapy has become a promising method for treating hereditary deafness, we tried to use AAV-mediated exogenous taperin to restore hearing in taperin- / - mice. However, we found that overexpression of taperin could not restore hearing in mice and would cause more severe hearing loss. Therefore, when performing gene therapy on taperin- / - mice, the appropriate amount of taperin expression is crucial for hearing recovery.
[0068] 5. Hammerhead ribozymes (HHRs) are small, self-dividing ribozymes widely used in the reversible division of transcribed RNA to regulate gene expression. Therefore, we used them as a novel gene therapy tool to reduce exogenously overexpressed taperin genes. Crucially, we found that gene therapy using HHRs resulted in partial hearing recovery in taperin- / - mice, and this recovery could be extended to two months.
[0069] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of this disclosure. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.
[0070] The foregoing has shown and described the basic principles, main features, and advantages of this disclosure. Those skilled in the art should understand that this disclosure is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of this disclosure. Various changes and modifications can be made to this disclosure without departing from its spirit and scope, and all such changes and modifications fall within the scope of this disclosure as claimed.
Claims
1. A diagnostic or detection system for hereditary deafness, characterized in that, The system includes: The recognition module identifies the cyclic protein complex structure of Taperin-Clic5-Ptprq at the root of the hair cell cilia. The detection module detects and identifies the integrity of the Taperin-Clic5-Ptprq cyclic protein complex structure. The output module outputs the integrity information of the cyclic protein complex structure of Taperin-Clic5-Ptprq detected by the detection module.
2. The system for diagnosing or detecting hereditary deafness according to claim 1, characterized in that, The detection module also includes the detection of Taperin expression levels; The detection module and the output module include a discrimination module, which is used to determine whether Taperin is overexpressed; The output module outputs the information determined by the discrimination module.
3. The system for diagnosing or detecting hereditary deafness according to claim 1, characterized in that, The recognition module identifies the cyclic protein complex structure of Taperin-Clic5-Ptprq at the root of the hair cell's cilia, including: STED imaging was used to characterize the distribution of Taperin.
4. Application of reagents for detecting the integrity of the Taperin-clic5-ptprq cyclic protein complex in the preparation of pharmaceuticals for the diagnosis or detection of hereditary deafness.
Citation Information
Patent Citations
Adeno-associated virus (AAV) system for treating hereditary hearing loss
CN115103710A