Carbonyl reductase mutants and their use in the preparation of (r)-8-chloro-6-hydroxyoctanoate compounds
By modifying the carbonyl reductase mutant of Pichia pastoris and co-expressing it with glucose dehydrogenase, the problem of low enzyme activity and efficiency in the enzymatic preparation of (R)-8-chloro-6-hydroxyoctanoate compounds was solved, and efficient and low-cost catalytic synthesis was achieved.
Patent Information
- Application Number
- CN202111167493.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-10-07
- Publication Date
- 2026-01-06
- Estimated Expiration
- 2041-10-07
AI Technical Summary
Existing enzymatic methods for preparing (R)-8-chloro-6-hydroxyoctanoate compounds suffer from problems such as insufficient enzyme activity, low reaction efficiency, high coenzyme dosage, and high cost.
Through enzyme library screening and protein engineering, a carbonyl reductase mutant derived from Pichia pastoris was developed and co-expressed with glucose dehydrogenase to improve its catalytic properties for the efficient synthesis of (R)-8-chloro-6-hydroxyoctanoate compounds.
It improves the catalytic activity and stereoselectivity of carbonyl reductase, reduces the amount of coenzyme required, simplifies the operation process, and is suitable for industrial production.
Smart Images

Figure QLYQS_1 
Figure BDA0003291984290000041 
Figure BDA0003291984290000051
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biochemical engineering technology, specifically relating to a carbonyl reductase mutant, a recombinant expression plasmid containing the gene sequence of the mutant and a recombinant expression transformant, and the application of the recombinant expression transformant co-expressing the carbonyl reductase mutant and glucose dehydrogenase in the catalytic preparation of (R)-8-chloro-6-hydroxyoctanoate compounds. Background Technology
[0002] Alpha-lipoic acid (ALA) is a safe and effective "universal antioxidant" that efficiently scavenges free radicals that can cause disease and accelerate aging. In addition, ALA is clinically used to treat diabetic peripheral neuropathy and diabetic nephropathy. However, ALA is a chiral compound with two configurations, only the R-configuration possesses physiological activity, and the price of the R-configuration is more than five times that of the racemic version; therefore, most commercially available products are still racemic. However, to reduce the burden on the human body in metabolizing the S-isomer, the efficient preparation of optically pure R-configuration ALA has significant application value and broad market prospects.
[0003] Numerous chemical and biological methods have been developed for the synthesis of (R)-α-lipoic acid. Currently, there are two main types of methods for synthesizing (R)-α-lipoic acid: one is a resolution method, but both chemical and enzymatic resolution methods have a theoretical yield limit of only 50%; the other method involves the enzymatic reduction of 8-chloro-6-carbonyloctanoate compounds to obtain the key precursor (R)-8-chloro-6-hydroxyoctanoate compounds, followed by a few routine reaction steps to obtain (R)-α-lipoic acid. The second method has advantages such as mild reaction conditions, high chemoselectivity, and high yield, showing great promise for application. Regarding the substrate 8-chloro-6-carbonyloctanoate compounds, Olbrich et al. discovered that a strain of *Geotrichum candidum* DSM 13776 can catalyze the reduction of methyl 8-chloro-6-carbonyloctanoate, but the substrate concentration was only 5 g / L, although the addition of exogenous NADP was not required. +However, the reaction time was 24 hours, and the R configuration product was obtained with only a 62% yield and an ee value of 88% (US20030180896A1). Müller et al. screened commercial enzymes and obtained the alcohol dehydrogenase TBADH from Thermoanaerobium brokii to prepare (R)-8-chloro-6-hydroxyoctanoate methyl ester with a conversion of over 85% and an ee value of >99.5%, but the substrate concentration (2 g / L) was too low, which is still some distance from industrial production (US2005003218 0). Hummel et al. used the alcohol dehydrogenase NGADH from Nocardia globulera to asymmetrically prepare (R)-8-chloro-6-hydroxyoctanoate ethyl ester. At a substrate concentration of 44 g / L, 95% conversion was achieved in 24 hours, but the reaction time was long and an additional 4 mM NADP was required. + The cost is too high (WO2007028729). Gupta et al. discovered that the oxidoreductase MzCR from *Metschnikowia zobellii* can prepare ethyl (R)-8-chloro-6-hydroxyoctanoate at a substrate concentration of 85 g / L and 0.1 mM NADP. + Under certain conditions, although the ee value can reach over 97%, only 55% of the substrate is converted after 24 hours of reaction (WO2005049816). Recently, Xu Jianhe's research group discovered through database mining that the ε-ketoester reductase CpAR2 from *Candida parapsilosis* exhibits excellent catalytic efficiency for the substrate ethyl 8-chloro-6-carbonyloctanoate. Furthermore, co-expression with glucose dehydrogenase was demonstrated in whole-cell reactions at a substrate concentration of 330 g / L and 0.1 mM NADP. + Under certain conditions, with the addition of 5% ethanol as a co-solvent, the R-configuration product was obtained in 86% yield and >99% ee value after 13 hours of reaction (Adv. Synth. Catal. 2015, 357, 1697-1702; CN106164260A). Based on this, Xu Jianhe's research group further modified CpAR2, ultimately achieving a substrate concentration of 110 g / L and 0.1 mM NADP... + Under certain conditions, with the addition of 5% dimethyl sulfoxide as a co-solvent, the R-configuration product could be obtained in 85% yield and with an ee value >99% after 4 hours of reaction (ChemBioChem 2020, 21, 1341-1346; CN11004119A). This study reduced the amount of whole-cell catalyst used, but required the addition of a co-solvent, and the expensive coenzyme NADP... + The usage remains high, increasing production costs. Summary of the Invention
[0004] This invention addresses the problems existing in the enzymatic preparation of (R)-8-chloro-6-hydroxyoctanoate compounds (II). Through enzyme library screening and protein engineering, it provides a mutant of carbonyl reductase SsCR derived from *Scheffersomyces stipitis* CBS 6054 with enhanced enzyme activity and stereoselectivity. The recombinant expression transformant co-expressed with glucose dehydrogenase of this carbonyl reductase mutant is used as a catalyst for the efficient synthesis of (R)-8-chloro-6-hydroxyoctanoate compounds (II).
[0005] One of the technical solutions of the present invention is to provide a carbonyl reductase mutant. This carbonyl reductase mutant is a derived protein possessing carbonyl reductase activity, formed by substituting one or more amino acids of valine at position 127, leucine at position 135, and leucine at position 211 of the amino acid sequence shown in SEQ ID No. 2.
[0006] In this invention, carbonyl reductase SsCR from *Scheffersomyces stipitis* CBS 6054 is used as the parent protein for protein engineering modification. By replacing one or several amino acids, mutants with enhanced carbonyl reductase activity and stereoselectivity are obtained.
[0007] This invention employs a semi-rational design approach, using methyl 8-chloro-6-carbonyloctanoate as a substrate and the amino acid sequence shown in SEQ ID No. 2 as a template to construct a mutant library, and then performs three rounds of modifications. First, based on substrate binding pocket and conservation analysis, a site-directed saturation mutation was performed on leucine at position 211, i.e., mutated to one of the other 19 amino acids. It was found that mutating to histidine yielded mutant Mu01, which exhibits improved enzyme activity and stereoselectivity. Using the mutant with the best results from the first round as a template, a strategy of expanding the substrate binding pocket was employed. It was discovered that mutating valine at position 127 to alanine yielded mutant Mu02, which further enhances enzyme activity. Following a combinatorial center activity saturation mutation strategy, using Mu02 as a template, iterative saturation mutations were performed, and the SsCR mutant, exhibiting both increased carbonyl reductase activity and improved selectivity, was obtained through screening.
[0008] In this invention, the crude enzyme solution of the parent carbonyl reductase SsCR exhibits an activity and stereoselectivity of 45.65 U / mL and 92.5% ee for the substrate methyl 8-chloro-6-carbonyloctanoate, respectively.
[0009] Among them, the mutant proteins with better catalytic performance are:
[0010] (1) Replace the leucine at position 211 of the amino acid sequence shown in SEQ ID No. 2 with histidine (SsCR).L211H The crude enzyme form of this enzyme exhibited an activity and stereoselectivity of 147.93 U / mL and >99.9% ee to methyl 8-chloro-6-carbonyloctanoate, respectively.
[0011] (2) Replace the leucine at position 211 of the amino acid sequence shown in SEQ ID No. 2 with glutamic acid (SsCR). L211E The crude enzyme form of this enzyme exhibited an activity and stereoselectivity of 171.22 U / mL and 98.1% ee for methyl 8-chloro-6-carbonyloctanoate, respectively.
[0012] (3) Replace the leucine at position 211 of the amino acid sequence shown in SEQ ID No. 2 with threonine (SsCR). L211T The crude enzyme form of this enzyme exhibited an activity and stereoselectivity of 144.73 U / mL and 97.5% ee for methyl 8-chloro-6-carbonyloctanoate, respectively.
[0013] (4) Replace the leucine at position 211 of the amino acid sequence shown in SEQ ID No. 2 with histidine, and replace the valine at position 127 with alanine (SsCR). L211H / V127A The crude enzyme form of this enzyme exhibited an activity and stereoselectivity of 727.81 U / mL and 95.3% ee for methyl 8-chloro-6-carbonyloctanoate, respectively.
[0014] (5) Replace the leucine at position 211 of the amino acid sequence shown in SEQ ID No. 2 with histidine, and replace the valine at position 127 with alanine and the leucine at position 135 with isoleucine (SsCR). L211H / V127A / L135I The crude enzyme form of this enzyme exhibited an activity and stereoselectivity of 800.59 U / mL and 98.0% ee for methyl 8-chloro-6-carbonyloctanoate, respectively.
[0015] The second technical solution of the present invention provides an isolated nucleic acid. The nucleic acid is a nucleic acid encoding the carbonyl reductase as described in technical solution one, specifically a nucleic acid encoding a derivative protein in which one or more amino acids of valine at position 127, leucine at position 135, and leucine at position 211 of the amino acid sequence shown in SEQ ID No. 2 are substituted, resulting in increased carbonyl reductase activity and stereoselectivity.
[0016] The preparation method of the nucleic acid described in this invention can be a conventional preparation method in the art. The preferred preparation method can be: artificial full-sequence synthesis; or isolation from recombinant expression plasmids or recombinant transformants encoding the amino acid sequence of the protein; or obtaining nucleic acid molecules encoding the SsCR mutant gene through gene cloning technology.
[0017] The third technical solution of the present invention is to provide a recombinant expression plasmid containing the nucleic acid sequence of the carbonyl reductase mutant described in the present invention. This recombinant expression plasmid can be prepared using conventional methods in the art, i.e., by ligating the nucleic acid sequence of the carbonyl reductase mutant described in the present invention onto various commercially available conventional plasmid vectors. The plasmid is preferably a pET sequence plasmid, more preferably a pET-28a(+) plasmid. The recombinant expression plasmid described in the present invention can be prepared by the following method: the nucleic acid product obtained by PCR amplification and the expression vector pET-28a are double-digested with restriction endonucleases NdeI and XhoI, respectively, to form complementary sticky ends, and then ligated with T4 DNA ligase to form a recombinant expression plasmid containing the carbonyl reductase mutant gene described in the present invention.
[0018] The fourth technical solution of the present invention is to provide a transformant containing a recombinant expression plasmid of the carbonyl reductase mutant gene and a plasmid containing the glucose dehydrogenase gene GDH, which are co-expressed.
[0019] The co-expression transformant can be obtained by co-transforming the recombinant expression plasmid containing the carbonyl reductase mutant gene described in this invention with a plasmid containing the glucose dehydrogenase gene GDH into a suitable host cell. The host cell can be any conventional host cell in the art, provided that the recombinant expression plasmid can stably replicate spontaneously and that the carbonyl reductase mutant gene it carries can be effectively expressed. The preferred host cell in this invention is *Escherichia coli* BL21(DE3). The plasmid transformation method is a conventional method in the art, such as heat shock or electroporation, with heat shock being preferred. A preferred embodiment of heat shock is as follows: the plasmid solution is mixed with competent cells, heat-shocked at 42°C for 45 seconds, then incubated on ice for 2 minutes, followed by recovery at 37°C for 1 hour, and then plated on LB agar plates containing kanamycin and chloramphenicol to obtain the target co-expression transformant.
[0020] The fifth technical solution of the present invention provides a method for preparing cells containing a carbonyl reductase mutant and glucose dehydrogenase GDH, the specific steps of which are as follows:
[0021] The co-expression transformants described in this invention are cultured to obtain cells containing a carbonyl reductase mutant and glucose dehydrogenase GDH. The culture medium used for culturing the co-expression transformants can be any conventional culture medium in the art, provided that the co-expression transformants grow and produce cells containing the carbonyl reductase mutant and glucose dehydrogenase GDH as described in this invention. Specific procedures for culturing the co-expression transformants can be performed according to conventional procedures in the art.
[0022] The recombinant *E. coli* containing the carbonyl reductase mutant gene and glucose dehydrogenase GDH constructed using the above technical scheme was inoculated into LB medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.0) containing 25 μg / mL kanamycin sulfate and 12.5 μg / mL chloramphenicol. The medium was cultured overnight at 37°C with shaking. Then, 1% (v / v) of the culture was inoculated into a 2L Erlenmeyer flask containing 500 mL of LB medium (containing the same concentration of antibiotics) and cultured at 37°C and 180 rpm with shaking. When the OD600 of the culture reached 0.5–1.0 (preferably 0.6), isopropyl-β-D-thiogalactoside (IPTG) at a final concentration of 0.2 mM was added as an inducer. After induction at 18°C for 18 h, the culture medium was centrifuged, and the cells expressing the two enzymes were collected.
[0023] The sixth technical solution of this invention provides an application for the asymmetric reduction reaction of (R)-8-chloro-6-hydroxyoctanoate compound (II) catalyzed by the co-expression of carbonyl reductase mutant and glucose dehydrogenase GDH. The specific steps are as follows: using a recombinant expression transformant co-expressed with carbonyl reductase mutant and glucose dehydrogenase as a catalyst to catalyze the asymmetric reduction reaction of compound (I), and then using conventional chemical separation methods to extract and purify the optically pure compound (II) generated from the reaction solution. The reaction formula is:
[0024]
[0025] In the formula, R is hydrogen, benzyl, C1-C6 alkyl or cycloalkyl, monosubstituted or polysubstituted aryl.
[0026] Furthermore, the amount of the carbonyl reductase mutant and glucose dehydrogenase co-expressing cells is 10-60 g / L, the amount of coenzyme is 0-0.05 mM, the concentration of compound (I) is 0.5-2.0 M, and the reduction reaction temperature is 25-40 °C.
[0027] Specifically, the conditions for the asymmetric reduction reaction of methyl 8-chloro-6-carbonyloctanoate (I) are as follows: K₂HPO₄ buffer (pH 7.0, 100 mM), the concentration of the substrate methyl 8-chloro-6-carbonyloctanoate is 0.5–2.0 mol / L, the molar ratio of glucose to substrate methyl 8-chloro-6-carbonyloctanoate is 1.0–1.5 equivalents, and NADP coenzyme is added at a final concentration of 0–0.05 mM. +Cells co-expressing carbonyl reductase mutant and glucose dehydrogenase (GDH) were added, and the reaction was carried out under magnetic stirring at 30°C. During the reaction, the pH of the reaction solution was maintained at approximately 7.0 by adding NaOH solution (1.0 mol / L). Samples were taken periodically, and the products were extracted with an equal volume of ethyl acetate for conversion and optical purity (ee) analysis. Based on this, specific reaction conditions such as reaction temperature, pH, and catalyst dosage can be optimized and selected according to conventional conditions for this type of reaction in the field.
[0028] Using the preferred biocatalyst SsCR of the present invention L211H / V127A / L135I - In GDH recombinant co-expressing cells, with a coenzyme dosage of 0.05 mM and a catalyst dosage of 60 g / L, 200 g / L of methyl 8-chloro-6-carbonyl octanoate can be completely converted to (R)-8-chloro-6-hydroxy octanoate (98% ee) within 7 hours.
[0029] Compared with the prior art, the positive and progressive effects of the present invention are as follows:
[0030] To address the issues of insufficient enzyme activity and low reaction efficiency faced by carbonyl reductases in the biocatalytic synthesis of (R)-8-chloro-6-hydroxyoctanoate methyl ester, this invention uses carbonyl reductase SsCR as a starting point for protein engineering modification. Through a semi-rational design process, the stereoselectivity and catalytic activity of SsCR are improved. Using the carbonyl reductase SsCR mutant disclosed in this invention to catalyze the asymmetric reduction of the substrate 8-chloro-6-carbonyloctanoate methyl ester exhibits advantages such as high catalytic activity, short reaction time, and high stereoselectivity. Compared to other preparation methods, the carbonyl reductase prepared using the method of this invention is environmentally friendly, easy to operate, and readily scalable for industrial application, showing great promise for industrial applications. Detailed Implementation
[0031] The present invention will now be described in detail with reference to specific embodiments.
[0032] Example 1, 211 is a site-directed saturation mutagenesis of leucine.
[0033] The whole plasmid PCR amplification method was used. The PCR primers are shown in Table 1.
[0034] Table 1. Primers for whole-plasmid PCR amplification of site-directed saturation mutagenesis at position 211.
[0035]
[0036]
[0037] Using the recombinant expression plasmid pET28a-SsCR as a template, site-directed mutagenesis was performed using whole plasmid PCR.
[0038] The site-directed mutagenesis PCR amplification reaction system (50 μL) consisted of: 20 ng of recombinant plasmid template, 0.2 μM of each of a pair of mutant primers, 0.2 mM dNTPs, and 10 μL of... FastPfu Fly Buffer and 1μL FastPfuFlyDNA Polymerase (2.5 U / 50 μL) was added to 50 μL with sterile distilled water. PCR reaction procedure: (1) 98℃ pre-denaturation for 3 min; (2) 98℃ denaturation for 20 s; (3) 65℃ annealing for 30 s; (4) 72℃ extension for 7 min. Steps (2) to (4) were performed for a total of 30 cycles. Finally, the extension was performed at 72℃ for 10 min, and the product was stored at 4℃. The amplified PCR product was digested with the restriction enzyme Dpn I at 37℃ for 1 h and then transformed into E. coli BL21 competent cells. The cells were then evenly spread on LB agar plates containing 50 μg / mL kanamycin. After overnight culture at 37℃, single clones were selected and sequenced by a company. The results showed that leucine at position 211 was successfully mutated into 19 other amino acids besides leucine.
[0039] The activity of the site-directed mutants was determined, and the results are shown in Table 2. When the leucine residue at position 211 of SsCR was replaced with lysine, threonine, glutamic acid, histidine, and valine, the activity of the mutants increased by more than two times.
[0040] Table 2. Activities of SsCR and mutant crude enzymes against methyl 8-chloro-6-carbonyloctanoate.
[0041]
[0042]
[0043] Example 2, SsCR L211H site-directed mutation
[0044] The mutant SsCR obtained in Example 1 exhibited improved enzyme activity and stereoselectivity. L211H Based on the primers in Table 3, the recombinant expression plasmid pET28a-SsCR was used. L211H Using it as a template, site-directed mutagenesis was performed using whole plasmid PCR, and valine at position 127 was mutated to alanine.
[0045] Table 3. Primers for whole-plasmid PCR amplification of site-directed mutation at position 127.
[0046] First Sequence(5'-3') SsCR-V127A-forward CAGCAGTGTGGCGGCCATGAGTGTGCCGGAAG(SEQ ID No.42) SsCR-V127A-reverse CACTCATGGCCGCCACACTGCTGGTATACAC (SEQ ID No.43)
[0047] The site-directed mutagenesis PCR amplification reaction system (50 μL) consisted of: 20 ng of recombinant plasmid template, 0.2 μM of each of a pair of mutant primers, 0.2 mM dNTPs, and 10 μL of... FastPfu Fly Buffer and 1μL FastPfu FlyDNA Polymerase (2.5U / 50μL) was added to 50μL with sterile distilled water. PCR reaction procedure: (1) 98℃ pre-denaturation for 3min; (2) 98℃ denaturation for 20s; (3) 65℃ annealing for 30s; (4) 72℃ extension for 7min. Steps (2) to (4) were performed for a total of 30 cycles. Finally, the product was extended at 72℃ for 10min and stored at 4℃. The amplified PCR product was digested with Dpn I restriction enzyme at 37℃ for 1h and then transformed into E. coli BL21 competent cells. The cells were then evenly spread on LB agar plates containing 50μg / mL kanamycin. After overnight culture at 37℃, single clones were selected and sequenced by a company to obtain the target mutant.
[0048] Activity assays were performed on the site-directed mutant. When the valine at position 127 of SsCR was mutated to alanine, the activity of SsCR increased. L211H / V127A The crude enzyme activity was 727.81 U / mL.
[0049] Example 3, SsCR L211H / V127A site-directed mutation
[0050] The mutant SsCR with improved enzyme activity obtained in Example 2 L211H / V127A Based on the degenerate primers in Table 4, the recombinant expression plasmid pET28a-SsCR was used. L211H / V127A Using it as a template, site-directed mutagenesis was performed by whole plasmid PCR, and saturation mutagenesis was performed by combining proline at position 132 and leucine at position 135.
[0051] Table 4. PCR primers for iterative saturation mutations of proline at position 132 and leucine at position 135.
[0052]
[0053] The site-directed mutagenesis PCR amplification reaction system (50 μL) consisted of: 20 ng of recombinant plasmid template, 0.2 μM of each of a pair of mutant primers, 0.2 mM dNTPs, and 10 μL of... FastPfu Fly Buffer and 1μL FastPfu FlyDNA Polymerase (2.5U / 50μL) was added to 50μL with sterile distilled water. PCR reaction procedure: (1) 98℃ pre-denaturation for 3min; (2) 98℃ denaturation for 20s; (3) 65℃ annealing for 30s; (4) 72℃ extension for 7min. Steps (2) to (4) were performed for a total of 30 cycles. Finally, the extension was performed at 72℃ for 10min, and the product was stored at 4℃. The amplified PCR product was digested with the restriction enzyme Dpn I at 37℃ for 1h and then transformed into E. coli BL21 competent cells. The cells were then evenly spread on LB agar plates containing 50μg / mL kanamycin. After overnight culture at 37℃, 10 single clones were selected and sequenced by a company. If the sequencing results were consistent with expectations, a mutant library was obtained for screening.
[0054] The activity of the mutant library obtained by iterative saturation mutagenesis was determined. When the leucine at position 135 of SsCR was mutated to isoleucine, the SsCR activity was increased. L211H / V127A / L135I The crude enzyme activity was 800.59 U / mL.
[0055] Example 4, SsCR L211H / V127A / L135I Cells co-expressing GDH catalyze the asymmetric reduction reaction of methyl 8-chloro-6-carbonyloctanoate.
[0056] 10 mL K₂HPO₄ (pH 7.0, 100 mM), methyl 8-chloro-6-carbonyloctanoate (1.0 M), 175 g / L glucose (1.01 equiv.), and NADP coenzyme added to a final concentration of 0.05 mM. + and 60g / L SsCR L211H / V127A / L135IGDH cells were used to initiate the reaction at 30°C with magnetic stirring. During the reaction, the pH of the reaction solution was controlled at approximately 7.0 by adding 1.0 mol / L NaOH solution. Samples were taken periodically, and the substrate was extracted with an equal volume of ethyl acetate. The conversion rate of the substrate was analyzed by GC. The substrate was completely converted to (R)-8-chloro-6-hydroxyoctanoic acid methyl ester within 7 hours. After the reaction, the reaction solution was extracted three times with an equal volume of ethyl acetate to separate the organic phase. Anhydrous sodium sulfate was added, and the mixture was dried overnight. The solvent was removed by rotary evaporation, yielding 1.93 g of (R)-8-chloro-6-hydroxyoctanoic acid methyl ester, with a separation yield of 93%. A portion of the product was then phenylacetylated, and the ee value was determined. 1H NMR (400MHz, CDCl3) δ3.85(m,1H),3.77-3.63(m,5H),2.34(t,J=7.4Hz,2H),2.08(s,1H),1.94-1.82(m,2H),1.74-1.60(m,2H),1.54-1 .33(m,4H).13C{1H}NMR(101MHz,CDCl3)δ174.2,68.44,51.60,41.97,39.75,37.05,33.90,25.04,24.66.HRMS(ESI)m / z[M+Na]+calcd for C9H17ClO3Na231.0758,found231.0757.[α] 20 D -17.4 (c 1.0, EtOH). HPLC (Chiracel OJ, hexane / isopropanol=90 / 10, flow rate=1.0mL / min, λ=254nm, 25°C): t1=11.8min, t2=12.5min (major enantiomer) (98.0%ee).
[0057] Example 5, SsCR L211H / V127A The asymmetric reduction reaction of methyl 8-chloro-6-carbonyloctanoate catalyzed by co-expression with GDH
[0058] 10 mL K₂HPO₄ (pH 7.0, 100 mM), methyl 8-chloro-6-carbonyloctanoate (2.0 M), 350 g / L glucose (1.01 equiv.), and NADP coenzyme added to a final concentration of 0.03 mM. + and 30g / L SsCR L211H / V127AGDH cells were used to initiate the reaction at 30°C with magnetic stirring. During the reaction, the pH of the reaction solution was controlled at approximately 7.0 by adding NaOH (1.0 mol / L). Samples were taken periodically, and the substrate was extracted with an equal volume of ethyl acetate. The conversion rate was analyzed by GC. The substrate was completely converted to (R)-8-chloro-6-hydroxyoctanoic acid methyl ester (95.3% ee) within 18 hours. After the reaction, the reaction solution was extracted three times with an equal volume of ethyl acetate to separate the organic phase. Anhydrous sodium sulfate was added, and the mixture was dried overnight. The solvent was removed by rotary evaporation, yielding 3.54 g of (R)-8-chloro-6-hydroxyoctanoic acid methyl ester, with a yield of 86%.
[0059] Example 6, SsCR L211H The asymmetric reduction reaction of methyl 8-chloro-6-carbonyloctanoate catalyzed by co-expression with GDH
[0060] 10 mL K₂HPO₄ (pH 7.0, 100 mM), methyl 8-chloro-6-carbonyloctanoate (0.5 M), 87 g / L glucose (1.01 equiv.), and NADP coenzyme added to a final concentration of 0.05 mM. + and 10g / L SsCR L211H GDH cells were used to initiate the reaction at 25°C with magnetic stirring. During the reaction, the pH of the reaction solution was controlled at approximately 7.0 by adding NaOH (1.0 mol / L). Samples were taken periodically, and the substrate was extracted with an equal volume of ethyl acetate. The conversion rate of the substrate was analyzed by GC. The substrate was completely converted to methyl (R)-8-chloro-6-hydroxyoctanoate (>99% ee) within 2 hours. After the reaction, the reaction solution was extracted three times with an equal volume of ethyl acetate to separate the organic phase. Anhydrous sodium sulfate was added and the mixture was dried overnight. The solvent was removed by rotary evaporation to obtain 0.94 g of methyl (R)-8-chloro-6-hydroxyoctanoate, with a separation yield of 92%.
[0061] Example 7, SsCR L211H / V127A / L135I Co-expression with GDH catalyzes the asymmetric reduction of 8-chloro-6-carbonyloctanoic acid.
[0062] 10 mL K₂HPO₄ (pH 7.0, 100 mM), 8-chloro-6-carbonyloctanoic acid (1.0 M), 175 g / L glucose (1.01 equiv.), 40 g / L SsCR L211H / V127A / L135I -GDH cells, without the addition of exogenous coenzyme NADP. +The reaction was initiated with magnetic stirring at 40℃. During the reaction, the pH of the reaction solution was controlled at approximately 7.0 by adding NaOH alkaline solution (1.0 mol / L). Samples were taken periodically, and the substrate was extracted with an equal volume of ethyl acetate. The conversion rate of the substrate was analyzed by GC. The substrate was completely converted to (R)-8-chloro-6-hydroxyoctanoic acid (90% ee) within 7 hours. After the reaction was completed, the reaction solution was extracted three times with an equal volume of ethyl acetate to separate the organic phase. Anhydrous sodium sulfate was added and the mixture was dried overnight. The solvent was removed by rotary evaporation, yielding 1.69 g of (R)-8-chloro-6-hydroxyoctanoic acid, with a separation yield of 88%.
[0063] Example 8, SsCR L211H / V127A / L135I Cells co-expressing GDH catalyze the asymmetric reduction of benzyl 8-chloro-6-carbonyl octanoate.
[0064] 10 mL K₂HPO₄ (pH 7.0, 100 mM), benzyl 8-chloro-6-carbonyloctanoate (1.2 M), 175 g / L glucose (1.01 equiv.), and NADP coenzyme added to a final concentration of 0.02 mM. + and 50g / L SsCR L211H / V127A / L135I GDH cells were used to initiate the reaction at 25°C with magnetic stirring. During the reaction, the pH of the reaction solution was controlled at approximately 7.0 by adding NaOH (1.0 mol / L). Samples were taken periodically, and the substrate was extracted with an equal volume of ethyl acetate. The conversion rate of the substrate was analyzed by GC. Within 5 hours, the substrate was completely converted to (R)-8-chloro-6-hydroxyoctanoic acid benzyl ester (93% ee). After the reaction, the reaction solution was extracted three times with an equal volume of ethyl acetate to separate the organic phase. Anhydrous sodium sulfate was added, and the mixture was dried overnight. The solvent was removed by rotary evaporation, yielding 2.97 g of (R)-8-chloro-6-hydroxyoctanoic acid benzyl ester, with a separation yield of 88%.
[0065] Example 9, SsCR L211H / V127A / L135I The asymmetric reduction reaction of ethyl 8-chloro-6-carbonyloctanoate catalyzed by co-expression with GDH
[0066] 10 mL K₂HPO₄ (pH 7.0, 100 mM), ethyl 8-chloro-6-carbonyloctanoate (2.0 M), 175 g / L glucose (1.01 equiv.), and NADP coenzyme added to a final concentration of 0.05 mM. + and 10g / L SsCR L211H / V127A / L135IGDH cells were used to initiate the reaction at 25°C with magnetic stirring. During the reaction, the pH of the reaction solution was controlled at approximately 7.0 by adding NaOH (1.0 mol / L). Samples were taken periodically, and the substrate was extracted with an equal volume of ethyl acetate. The conversion rate of the substrate was analyzed by GC. Within 3 hours, the substrate was completely converted to ethyl (R)-8-chloro-6-hydroxyoctanoate (99% ee). After the reaction, the reaction solution was extracted three times with an equal volume of ethyl acetate to separate the organic phase. Anhydrous sodium sulfate was added, and the mixture was dried overnight. The solvent was removed by rotary evaporation, yielding 3.96 g of ethyl (R)-8-chloro-6-hydroxyoctanoate, with a yield of 90%.
[0067] Example 10, SsCR L211H / V127A / L135I Asymmetric reduction reaction of phenyl 8-chloro-6-carbonyl octanoate catalyzed by co-expression with GDH
[0068] 10 mL K₂HPO₄ (pH 7.0, 100 mM), phenyl 8-chloro-6-carbonyl octanoate (0.5 M), 175 g / L glucose (1.01 equiv.), 20 g / L SsCR L211H / V127A / L135I -GDH cells, without the addition of exogenous coenzyme NADP. + The reaction was initiated with magnetic stirring at 35°C. During the reaction, the pH of the reaction solution was controlled at approximately 7.0 by adding NaOH (1.0 mol / L) alkaline solution dropwise. Samples were taken periodically, and the substrate was extracted with an equal volume of ethyl acetate. The conversion rate of the substrate was analyzed by GC. Within 8 hours, the substrate was completely converted to (R)-8-chloro-6-hydroxyoctanoic acid phenyl ester (95% ee). After the reaction was completed, the reaction solution was extracted three times with an equal volume of ethyl acetate to separate the organic phase. Anhydrous sodium sulfate was added and the mixture was dried overnight. The solvent was removed by rotary evaporation to obtain 1.11 g of (R)-8-chloro-6-hydroxyoctanoic acid phenyl ester, with a separation yield of 83%.
[0069] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. The invention is not limited to the above embodiments; any improvements and modifications made by those skilled in the art based on the disclosure of the invention, without departing from the scope of the invention, should be within the protection scope of the invention. sequence list <110> Fudan University <120> Carbonyl reductase mutants and their application in the preparation of (R)-8-chloro-6-hydroxyoctanoate compounds <130> 001 <160> 45 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1005 <212> DNA <213> Artificial Sequence <400> 1 atgaccacca gtgtgtttgt gagcggcgcc accggttacc tggcacagca gatcattgcc 60 ctggtgttaa gcaagggcta taaggtggtg ggcagcgttc gcagcgaaga gaaaggcgca 120 aacctgaaaa agctgtacgg cgacgacttt agctacgagg tggtgaaggt gctggagcag 180 aaaggtgcct ttgacgaagc cctgaagaag cacccggagg tgacaatttt tctgcacaca 240 gccagcccgg tgacctttga agtggaagac accgagaagg agatcctgat tccggccatc 300 aacggcacca aatacgtgct gcaaagcatt aaagacgtgg caccgcagat tacccgcgtt 360 gtgtatacca gcagtgtggt ggccatgagt gtgccggaag agctgggtag cccggatgtt 420 gtgttaagcg aagccagctg gagcagctta agctacgagc agagcaagac acatggcgtg 480 ctggcctatt tcggcagcaa acagtttgcc gagcgcgccg catgggagtt tgtggagcag 540 gagaaaccga atttcgccct gagcacagtg aacccggtgt atatctttgg cccgcaggcc 600 aaggacgaag aagtgaaagg caccctgaac ctgagcgccg aaatggtgaa tagcgtgctg 660 aagctgaaca aggacgatga tgtgccggca accaccggca cctttattga cgtgcgcgat 720 gtggccaaag cccatctggc cgcctttgaa aaggacgaag ccaagggtga acgcttactg 780 ctgagcaaca cccgttttaa cggtcagacc ctgctggacg tggtgcgcaa gaattttccg 840 cagctggcag ataagctgcc ggttggtaag ccgcacagcg atgattttag cgcattcaaa 900 gaatggaacg ataagaaaac taagaaaatt ctgggcttcg agtacttcga cttcgagacc 960 agcgttgttg acagcattaa gcaggtgctg aaggttcagg gttaa 1005 <210> 2 <211> 334 <212> PRT <213> Artificial Sequence <400> 2 Met Thr Thr Ser Val Phe Val Ser Gly Ala Thr Gly Tyr Leu Ala Gln 1 5 10 15 Gln Ile Ile Ala Leu Val Leu Ser Lys Gly Tyr Lys Val Val Gly Ser 20 25 30 Val Arg Ser Glu Glu Lys Gly Ala Asn Leu Lys Lys Leu Tyr Gly Asp 35 40 45 Asp Phe Ser Tyr Glu Val Val Lys Val Leu Glu Gln Lys Gly Ala Phe 50 55 60 Asp Glu Ala Leu Lys Lys His Pro Glu Val Thr Ile Phe Leu His Thr 65 70 75 80 Ala Ser Pro Val Thr Phe Glu Val Glu Asp Thr Glu Lys Glu Ile Leu 85 90 95 Ile Pro Ala Ile Asn Gly Thr Lys Tyr Val Leu Gln Ser Ile Lys Asp 100 105 110 Val Ala Pro Gln Ile Thr Arg Val Val Tyr Thr Ser Ser Val Val Ala 115 120 125 Met Ser Val Pro Glu Glu Leu Gly Ser Pro Asp Val Val Leu Ser Glu 130 135 140 Ala Ser Trp Ser Ser Leu Ser Tyr Glu Gln Ser Lys Thr His Gly Val 145 150 155 160 Leu Ala Tyr Phe Gly Ser Lys Gln Phe Ala Glu Arg Ala Ala Trp Glu 165 170 175 Phe Val Glu Gln Glu Lys Pro Asn Phe Ala Leu Ser Thr Val Asn Pro 180 185 190 Val Tyr Ile Phe Gly Pro Gln Ala Lys Asp Glu Glu Val Lys Gly Thr 195 200 205 Leu Asn Leu Ser Ala Glu Met Val Asn Ser Val Leu Lys Leu Asn Lys 210 215 220 Asp Asp Asp Val Pro Ala Thr Thr Gly Thr Phe Ile Asp Val Arg Asp 225 230 235 240 Val Ala Lys Ala His Leu Ala Ala Phe Glu Lys Asp Glu Ala Lys Gly 245 250 255 Glu Arg Leu Leu Leu Ser Asn Thr Arg Phe Asn Gly Gln Thr Leu Leu 260 265 270 Asp Val Val Arg Lys Asn Phe Pro Gln Leu Ala Asp Lys Leu Pro Val 275 280 285 Gly Lys Pro His Ser Asp Asp Phe Ser Ala Phe Lys Glu Trp Asn Asp 290 295 300 Lys Lys Thr Lys Lys Ile Leu Gly Phe Glu Tyr Phe Asp Phe Glu Thr 305 310 315 320 Ser Val Val Asp Ser Ile Lys Gln Val Leu Lys Val Gln Gly 325 330 <210> 3 <211> 334 <212> PRT <213> Artificial Sequence <400> 3 Met Thr Thr Ser Val Phe Val Ser Gly Ala Thr Gly Tyr Leu Ala Gln 1 5 10 15 Gln Ile Ile Ala Leu Val Leu Ser Lys Gly Tyr Lys Val Val Gly Ser 20 25 30 Val Arg Ser Glu Glu Lys Gly Ala Asn Leu Lys Lys Leu Tyr Gly Asp 35 40 45 Asp Phe Ser Tyr Glu Val Val Lys Val Leu Glu Gln Lys Gly Ala Phe 50 55 60 Asp Glu Ala Leu Lys Lys His Pro Glu Val Thr Ile Phe Leu His Thr 65 70 75 80 Ala Ser Pro Val Thr Phe Glu Val Glu Asp Thr Glu Lys Glu Ile Leu 85 90 95 Ile Pro Ala Ile Asn Gly Thr Lys Tyr Val Leu Gln Ser Ile Lys Asp 100 105 110 Val Ala Pro Gln Ile Thr Arg Val Val Tyr Thr Ser Ser Val Ala Ala 115 120 125 Met Ser Val Pro Glu Glu Ile Gly Ser Pro Asp Val Val Leu Ser Glu 130 135 140 Ala Ser Trp Ser Ser Leu Ser Tyr Glu Gln Ser Lys Thr His Gly Val 145 150 155 160 Leu Ala Tyr Phe Gly Ser Lys Gln Phe Ala Glu Arg Ala Ala Trp Glu 165 170 175 Phe Val Glu Gln Glu Lys Pro Asn Phe Ala Leu Ser Thr Val Asn Pro 180 185 190 Val Tyr Ile Phe Gly Pro Gln Ala Lys Asp Glu Glu Val Lys Gly Thr 195 200 205 Leu Asn His Ser Ala Glu Met Val Asn Ser Val Leu Lys Leu Asn Lys 210 215 220 Asp Asp Asp Val Pro Ala Thr Thr Gly Thr Phe Ile Asp Val Arg Asp 225 230 235 240 Val Ala Lys Ala His Leu Ala Ala Phe Glu Lys Asp Glu Ala Lys Gly 245 250 255 Glu Arg Leu Leu Leu Ser Asn Thr Arg Phe Asn Gly Gln Thr Leu Leu 260 265 270 Asp Val Val Arg Lys Asn Phe Pro Gln Leu Ala Asp Lys Leu Pro Val 275 280 285 Gly Lys Pro His Ser Asp Asp Phe Ser Ala Phe Lys Glu Trp Asn Asp 290 295 300 Lys Lys Thr Lys Lys Ile Leu Gly Phe Glu Tyr Phe Asp Phe Glu Thr 305 310 315 320 Ser Val Val Asp Ser Ile Lys Gln Val Leu Lys Val Gln Gly 325 330 <210> 4 <211> 33 <212> DNA <213> Artificial Sequence <400> 4 caccctgaac tttagcgccg aaatggtgaa tag 33 <210> 5 <211> 33 <212> DNA <213> Artificial Sequence <400> 5 tttcggcgct aaagttcagg gtgcctttca ctt 33 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <400> 6 caccctgaac attagcgccg aaatggtgaa tag 33 <210> 7 <211> 33 <212> DNA <213> Artificial Sequence <400> 7 tttcggcgct aatgttcagg gtgcctttca ctt 33 <210> 8 <211> 33 <212> DNA <213> Artificial Sequence <400> 8 caccctgaac atgagcgccg aaatggtgaa tag 33 <210> 9 <211> 33 <212> DNA <213> Artificial Sequence <400> 9 tttcggcgct catgttcagg gtgcctttca ctt 33 <210> 10 <211> 33 <212> DNA <213> Artificial Sequence <400> 10 caccctgaac gtgagcgccg aaatggtgaa tag 33 <210> 11 <211> 33 <212> DNA <213> Artificial Sequence <400> 11 tttcggcgct cacgttcagg gtgcctttca ctt 33 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <400> 12 caccctgaac tcgagcgccg aaatggtgaa tag 33 <210> 13 <211> 33 <212> DNA <213> Artificial Sequence <400> 13 tttcggcgct cgagttcagg gtgcctttca ctt 33 <210> 14 <211> 33 <212> DNA <213> Artificial Sequence <400> 14 caccctgaac ccgagcgccg aaatggtgaa tag 33 <210> 15 <211> 33 <212> DNA <213> Artificial Sequence <400> 15 tttcggcgct cgggttcagg gtgcctttca ctt 33 <210> 16 <211> 33 <212> DNA <213> Artificial Sequence <400> 16 caccctgaac acgagcgccg aaatggtgaa tag 33 <210> 17 <211> 33 <212> DNA <213> Artificial Sequence <400> 17 tttcggcgct cgtgttcagg gtgcctttca ctt 33 <210> 18 <211> 33 <212> DNA <213> Artificial Sequence <400> 18 caccctgaac gcgagcgccg aaatggtgaa tag 33 <210> 19 <211> 33 <212> DNA <213> Artificial Sequence <400> 19 tttcggcgct cgcgttcagg gtgcctttca ctt 33 <210> 20 <211> 33 <212> DNA <213> Artificial Sequence <400> 20 caccctgaac tacagcgccg aaatggtgaa tag 33 <210> twenty one <211> 33 <212> DNA <213> Artificial Sequence <400> twenty one tttcggcgct gtagttcagg gtgcctttca ctt 33 <210> twenty two <211> 33 <212> DNA <213> Artificial Sequence <400> twenty two caccctgaac catagcgccg aaatggtgaa tag 33 <210> twenty three <211> 33 <212> DNA <213> Artificial Sequence <400> twenty three tttcggcgct atggttcagg gtgcctttca ctt 33 <210> twenty four <211> 33 <212> DNA <213> Artificial Sequence <400> twenty four caccctgaac cagagcgccg aaatggtgaa tag 33 <210> 25 <211> 33 <212> DNA <213> Artificial Sequence <400> 25 tttcggcgct ctggttcagg gtgcctttca ctt 33 <210> 26 <211> 33 <212> DNA <213> Artificial Sequence <400> 26 caccctgaac aacagcgccg aaatggtgaa tag 33 <210> 27 <211> 33 <212> DNA <213> Artificial Sequence <400> 27 tttcggcgct gttgttcagg gtgcctttca ctt 33 <210> 28 <211> 33 <212> DNA <213> Artificial Sequence <400> 28 caccctgaac aagagcgccg aaatggtgaa tag 33 <210> 29 <211> 33 <212> DNA <213> Artificial Sequence <400> 29 tttcggcgct cttgttcagg gtgcctttca ctt 33 <210> 30 <211> 33 <212> DNA <213> Artificial Sequence <400> 30 caccctgaac gatagcgccg aaatggtgaa tag 33 <210> 31 <211> 33 <212> DNA <213> Artificial Sequence <400> 31 tttcggcgct atcgttcagg gtgcctttca ctt 33 <210> 32 <211> 33 <212> DNA <213> Artificial Sequence <400> 32 caccctgaac gagagcgccg aaatggtgaa tag 33 <210> 33 <211> 33 <212> DNA <213> Artificial Sequence <400> 33 tttcggcgct ctcgttcagg gtgcctttca ctt 33 <210> 34 <211> 33 <212> DNA <213> Artificial Sequence <400> 34 caccctgaac tgtagcgccg aaatggtgaa tag 33 <210> 35 <211> 33 <212> DNA <213> Artificial Sequence <400> 35 tttcggcgct acagttcagg gtgcctttca ctt 33 <210> 36 <211> 33 <212> DNA <213> Artificial Sequence <400> 36 caccctgaac tggagcgccg aaatggtgaa tag 33 <210> 37 <211> 33 <212> DNA <213> Artificial Sequence <400> 37 tttcggcgct ccagttcagg gtgcctttca ctt 33 <210> 38 <211> 33 <212> DNA <213> Artificial Sequence <400> 38 caccctgaac cggagcgccg aaatggtgaa tag 33 <210> 39 <211> 33 <212> DNA <213> Artificial Sequence <400> 39 tttcggcgct ccggttcagg gtgcctttca ctt 33 <210> 40 <211> 33 <212> DNA <213> Artificial Sequence <400> 40 caccctgaac gggagcgccg aaatggtgaa tag 33 <210> 41 <211> 33 <212> DNA <213> Artificial Sequence <400> 41 tttcggcgct cccgttcagg gtgcctttca ctt 33 <210> 42 <211> 32 <212> DNA <213> Artificial Sequence <400> 42 cagcagtgtg gcggccatga gtgtgccgga ag <210> 43 <211> 31 <212> DNA <213> Artificial Sequence <400> 43 31. cgccacactg ctggtataca cgccacactg <210> 44 <211> 42 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (11)..(12) <223> n is a, c, g, or t <220> <221> misc_feature <222> (20)..(21) <223> n is a, c, g, or t <400> 44 catgagtgtg nntgaagagn ntggtagccc ggatgttgtg tt <210> 45 <211> 42 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (12)..(13) <223> n is a, c, g, or t <220> <221> misc_feature <222> (21)..(22) <223> n is a, c, g, or t <400> 45 ccgggctacc annctcttca nncacactca tggccgccac and 42
Claims
1. A carbonyl reductase mutant, characterized in that, The carbonyl reductase mutant protein is as follows: (1) replacing the leucine at position 211 of the amino acid sequence shown in SEQ ID No. 2 with histidine; (2) replacing the leucine at position 211 of the amino acid sequence shown in SEQ ID No. 2 with glutamic acid; (3) replacing the leucine at position 211 of the amino acid sequence shown in SEQ ID No. 2 with threonine; (4) replacing the leucine at position 211 of the amino acid sequence shown in SEQ ID No. 2 with histidine, and replacing the valine at position 127 with alanine; (5) replacing the leucine at position 211 of the amino acid sequence shown in SEQ ID No. 2 with histidine, replacing the valine at position 127 with alanine, and replacing the leucine at position 135 with isoleucine.
2. An isolated nucleic acid, comprising, The nucleic acid is a nucleic acid encoding the carbonyl reductase mutant of claim 1.
3. A recombinant expression plasmid, characterized in that, The nucleic acid of claim 2.
4. A cell co-expressing the carbonyl reductase mutant of claim 1 and glucose dehydrogenase GDH.
5. Use of a cell co-expressing a carbonyl reductase mutant and a glucose dehydrogenase GDH according to claim 4 for the preparation of (R)-8-chloro-6-hydroxyoctanoate (II), characterized in that, Specific steps: using the carbonyl reductase mutant of claim 4 and glucose dehydrogenase co-expressed cell as catalyst to catalyze the asymmetric reduction reaction of 8-chloro-6-carbonyl octanoate compound (I), and then using chemical separation method to extract and refine the optically pure (R)-8-chloro-6-hydroxy octanoate compound (II) generated in the reaction from the reaction solution; the reaction formula is as follows: , In the formula, R is hydrogen, benzyl, C1-C6 alkyl or cycloalkyl, or mono-substituted or poly-substituted aryl.
6. Use according to claim 5, characterized in that, The amount of the carbonyl reductase mutant and glucose dehydrogenase co-expressed cell is 10-60 g / L, the amount of coenzyme is 0-0.05 mM, the concentration of compound (I) is 0.5-2.0 M, and the reaction temperature is 25-40℃.
Citation Information
Patent Citations
Generation and use of candida and carbonyl reductase thereof
CN106164260A
Method for the enantioselective reduction of 8-chloro-6-oxo-octanoic acid alkyl esters
US20030180896A1
Method for the production of (r)-and (s)-8-chloro-6-hydroxy-octanic acid alkyl esters by enzymatic reduction
US20050032180A1
Oxidoreductase from metschnikowia zobellii
WO2005049816A2
Nocardia globerula alcohol dehydrogenase and use thereof
WO2007028729A1
Cited By
Carbonyl reductase mutant and application thereof in synthesis of R-lipoic acid chiral intermediate
CN122012428A