Staphylococcus capitis MLST molecular typing method
By screening and constructing a conserved gene database of Staphylococcus aureus using the MLST method, and designing primers for PCR amplification and analysis, the reliability and cost-effectiveness issues of molecular typing of Staphylococcus aureus in existing technologies have been solved. This has enabled efficient molecular typing and clonal identification, supporting scientific research on Staphylococcus aureus.
Patent Information
- Application Number
- CN202211184110.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-27
- Publication Date
- 2026-06-05
- Estimated Expiration
- 2042-09-27
AI Technical Summary
The lack of a reliable, efficient, and economical molecular typing system for Staphylococcus aureus in current technologies limits the progress of scientific research. Furthermore, existing methods require whole genome sequencing and phylogenetic knowledge, making it difficult to share and compare results between different laboratories.
The Multiple Site Sequence Typing (MLST) method was used to construct an MLST database by screening seven conserved genes: atpB_2, carB, clpP, hisS, mntC, phoA, and rluB. Primers were designed for PCR amplification and sequencing, and the ST and CC types were determined using IQ-TREE and iTOL software.
It enables efficient, accurate, and economical typing of Staphylococcus aureus, simplifies the operation process, provides a reliable molecular typing tool, supports clone identification and genetic diversity research, and promotes the control of multidrug-resistant clones.
Smart Images

Figure CN115948580B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular typing of pathogenic microorganisms, specifically to the MLST molecular typing method for Staphylococcus aureus. Background Technology
[0002] Staphylococcus capillus is a common opportunistic pathogen in clinical practice, belonging to the coagulase-negative staphylococci (CoNS). Although its pathogenicity is lower than that of Staphylococcus aureus, clinical infections are not uncommon, frequently causing catheter-related bloodstream infections, endocarditis, bone and joint infections, and delayed neonatal sepsis in hospitalized patients. This prolongs hospital stays, increases patient mortality, and raises the disease burden on society, making it a significant clinical pathogen. Previous epidemiological surveys have shown that Staphylococcus capillus has become one of the most common bloodstream infection pathogens in neonatal intensive care units worldwide. However, the lack of a reliable, efficient, and economical molecular typing system has limited scientific research on this pathogen to a few well-equipped laboratories, which is highly detrimental to scientific progress.
[0003] Currently, the most commonly used technique for molecular typing of Staphylococcus aureus is phylogenetic tree based on SNP differences. This technique offers very high resolution and is the best method for determining the phylogenetic relationships between strains; however, this analytical method has several prerequisites. First, the complete genome sequence of Staphylococcus aureus is required; second, the analyst must have knowledge of phylogenetics; and third, a certain level of computer hardware is necessary. In comparison, Multilocus Sequence Typing (MLST) is a technique commonly used in microbial epidemiological surveys. Specifically, this technique uses differences in the DNA fragment sequences of 4-8 housekeeping genes to molecularly type pathogens. Generally, the target sequence is amplified by PCR using primers, followed by sequencing or a genome-wide search for the fragment's sequence, which is then compared with the corresponding DNA sequence in the MLST database. If the sequence already exists in the database, the previously identified sequence number is used directly; if the sequence does not exist in the database, a new sequence number is assigned regardless of the nature and number of base differences. For example, the sequence number of a gene is used to search the database. If such an arrangement already exists, the ST type (ST) of the strain is obtained; if no such arrangement exists, a new ST number is assigned. In addition, some ST types are closely related, and these ST types are collectively referred to as clonal complexes (CC).
[0004] Therefore, using MLST technology for typing Staphylococcus aureus is very suitable, achieving high efficiency, accuracy, and cost-effectiveness. This method not only provides high resolution but also, due to its standardization, allows for the comparability of results from different laboratories worldwide, enabling data sharing and comparison. Currently, no research has been reported on multi-site sequence typing of Staphylococcus aureus. Summary of the Invention
[0005] The purpose of this invention is to address the shortcomings of existing technologies by providing a Staphylococcus aureus MLST molecular typing method.
[0006] The objective of this invention is achieved through the following technical solution: a method for molecular typing of Staphylococcus aureus using the MLST method, characterized by comprising the following steps:
[0007] (1) Conserved gene fragment sequence determination: Seven conserved genes of bacteria were screened out: atpB_2, carB, clpP, hisS, mntC, phoA, and rluB;
[0008] (2) Constructing the MLST database: Download all Staphylococcus capillaris genomes from public genome databases, identify 7 conserved gene sequences in each genome, perform ligation on each sequence using the MAFFT algorithm, assign allele sequence types based on base differences, and assign strain sequence types based on the combination of the 7 conserved gene sequence numbers. The sequence types are ST types. Then, use PHYLOViZ software to analyze the MLST information of all strains using the eBURST algorithm and define the main CC types.
[0009] (3) Verify the distribution of ST types: Core genome analysis was performed on the collected Staphylococcus capitella genomes, and phylogenetic analysis based on SNP differences in the core genome was performed using IQ-TREE software; the phylogenetic tree was visualized using the iTOL website to confirm the correspondence between each major clone and the ST type.
[0010] Furthermore, it also includes the following steps:
[0011] (1) Primer design and verification: Based on the sequences of each conserved gene and the sequence of the fragment to be amplified, primers mntC forward, mntC reverse, phoA forward, phoA reverse, atpB_2 forward, atpB_2 reverse, hisS forward, hisS reverse, rluB forward, rluB reverse, carB forward, carB reverse, clpP forward and clpP reverse were designed. Their gene sequences are shown in SEQ ID NO.1 to 14. Amplification was performed using optimized PCR reaction system and conditions.
[0012] The 50 μL reaction system for PCR amplification is as follows:
[0013]
[0014] The PCR reaction conditions were: 95℃ pre-denaturation for 7 min, followed by 30 cycles, each cycle consisting of 95℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 30 s, and a final extension at 72℃ for 5 min.
[0015] (2) The PCR products were identified by 1.0% agarose gel electrophoresis. The prepared agarose gel was placed in the electrophoresis tank, and 1×TAE buffer was added to the tank until the gel was submerged. After confirming the electrode orientation, electrophoresis was performed at 120V for 25 minutes. After electrophoresis, the presence and size of the bands were checked by UV imaging. Products with the expected electrophoretic length were sequenced for DNA. The sequencing results were compared with those in the MLST allele library using Ridom software to determine the ST type. Attached Figure Description
[0016] Figure 1 It is a phylogenetic tree constructed using collected Staphylococcus capitella genomes, and major clones are identified. In addition, ST and CC type results determined based on this invention are also identified.
[0017] Figure 2 The results are MLST amplified sequence PCR electrophoresis results. In the figure, M is the marker, and 1-7 are representative strains of Staphylococcus capillaris. Detailed Implementation
[0018] The following is based on Figures 1-2 The embodiments of the present invention will be described in detail below.
[0019] This invention provides a method for MLST molecular typing of Staphylococcus aureus, comprising the following steps:
[0020] (1) Determination of conserved gene fragment sequences
[0021] Preliminary experiments identified seven conserved bacterial genes—atpB_2, carB, clpP, hisS, mntC, phoA, and rluB—for use in this invention. These seven conserved genes are publicly available and can be screened from complete genomes downloaded from GenBank.
[0022] (2) Construct the MLST database, collect genomes, and determine the ST and CC types.
[0023] All Staphylococcus aureus genomes (complete genomes) were downloaded from the public genome database (Genbank). Seven conserved gene sequences were identified from each genome. The MAFFT algorithm was used to perform ligation on each sequence, and sequence types were assigned based on base differences. The strain sequence types were then assigned based on the combination of the seven conserved gene sequence numbers, defined as ST types. The MLST information of all strains was then analyzed using the eBURST algorithm in PHYLOViZ software to obtain the dominant CC types.
[0024] It should be understood that public genome databases (Genbank) include, but are not limited to: NCBI Assembly database, Genome database and SRA database.
[0025] (3) Verify the ST-type distribution
[0026] Core genome analysis was performed on the collected Staphylococcus aureus genomes, and phylogenetic analysis based on SNP differences in the core genome was conducted using IQ-TREE software. The phylogenetic tree was visualized using the iTOL website to confirm the correspondence between each major clone and the ST type.
[0027] The molecular typing method for Staphylococcus aureus in this invention has a good correspondence between the ST and CC types determined by collecting Staphylococcus aureus genomes and the clonal types and classification results determined by phylogenetic tree. Using the MLST system, the clonal attribution of Staphylococcus aureus can be determined simply and quickly.
[0028] It should be understood that in some embodiments, corresponding primers are provided for ease of use, so that typing results can be obtained without sequencing the complete genome. Designed primers help to reliably, efficiently and economically perform molecular typing of isolated strains.
[0029] The primers are designed below, and the correctness of the method is verified.
[0030] Based on the sequences of each conserved gene and the sequence of the fragment to be amplified, primers mntC forward, mntC reverse, phoA forward, phoA reverse, atpB_2 forward, atpB_2 reverse, hisS forward, hisS reverse, rluB forward, rluB reverse, carB forward, carB reverse, clpP forward, and clpP reverse were designed using the Primer3Plus website. Their gene sequences are shown in SEQ ID NO.1 to 14 (see Table 1 for details). Amplification was performed using an optimized PCR reaction system and conditions.
[0031] Table 1: Names, functions, and primer sequences of 7 conserved genes
[0032] Gene name Primer name Primer sequence 5'-3' Primer length (nt) Product length (bp) Tm (°C) mntC mntC forward CATGGTCAAACATGTCGGCG 20 471 57.45 mntC reverse GCTCGATGCGCTTTAGGAAT 20 55.40 phoA phoA forward AGCAATCGTCATACCACCAG 20 452 55.40 phoA reverse ACGGTCAACATAAAGTAGACGT 22 53.95 atpB_2 atpB_2forward GGGTCCAGTAATCGATGTTCGT 22 458 57.67 atpB_2reverse CTGTCTTACCAACACCGGCA 20 57.45 hisS hisS forward AGGTGTTGGCGATTCTACCG 20 521 57.45 hisS reverse CTGTTATACGAGGTGCGGT 19 55.16 rluB rluB forward ACCTACTCAAGTTATTACGAGTG 23 477 54.20 rluB reverse GTCAACACACGACCTTCTCC 20 57.45 carB carB forward GCACACCATACTCAAGTGAACG 22 484 57.67 carB reverse ACAGGGGATTCCATTGTCGT 20 55.40 clpP clpP forward GATTGACCTGTACGCTCAGCT 21 510 57.57 clpP reverse CAACAGTTATTACAAGGAGGA 21 51.71
[0033] The 50 μL reaction system for PCR amplification is as follows:
[0034]
[0035]
[0036] The PCR reaction conditions were as follows: pre-denaturation at 95℃ for 7 min, followed by 30 cycles, each cycle consisting of denaturation at 95℃ for 30 s, annealing at 54℃ for 30 s, extension at 72℃ for 30 s, and a final extension at 72℃ for 5 min.
[0037] Detection and Sequencing: PCR products were analyzed by 1.0% agarose gel electrophoresis to identify bands. The prepared agarose gel was placed in an electrophoresis tank, and 1×TAE buffer was added to submerge the gel. After confirming the electrode orientation, electrophoresis was performed at 120V for 25 minutes. After electrophoresis, the presence and size of bands were observed using a UV imager. Products with expected electrophoretic lengths were sequenced. The sequencing results were compared with the MLST allele database using Ridom software to determine the genotype and ST type.
[0038] This invention identified fragments of seven conserved genes through screening. Based on these sequence combinations, the system's ability to identify clones was clarified by typing all known Staphylococcus aureus genomes, confirming the ST and CC genotypes. The typing results were then compared with a phylogenetic tree based on core genome SNP differences, yielding reliable typing results. Furthermore, seven pairs of PCR primers and their functionality were designed and validated, enabling MLST typing of Staphylococcus aureus. This method can be used for clonal identification and genetic diversity studies of Staphylococcus aureus, aiming to address the increased medical burden caused by the spread of multidrug-resistant clones of this bacterium. It provides a reliable molecular typing tool for controlling the spread of multidrug-resistant clones and lays the foundation for further research on the drug resistance and pathogenic mechanisms of this bacterium.
[0039] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A primer set for MLST molecular typing of Staphylococcus capitella, characterized in that, It consists of the following primers, Primer pair for amplifying mntC: mntC forward CATGGTCAAACATGTCGGCG; mntC reverseGCTCGATGCGCTTTAGGAAT; Primer pair for amplifying phoA: phoA forward AGCAATCGTCATACCACCAG; phoA reverse ACGGTCAACATAAAGTAGACGT; Primer pair for amplifying atpB_2: atpB_2 forward GGGTCCAGTAATCGATGTTCGT; atpB_2reverse CTGTCTTACCAACACCGGCA; Primer pair for amplifying hisS: hisS forward AGGTGTTGGCGATTCTACCG; hisS reverse CTGTTATACGAGGTGCGGT; Primer pair for amplifying rluB: rluB forward ACCTACTCAAGTTATTACGAGTG; rluB reverse GTCAACACACGACCTTCTCC; Primer pair for amplifying carB: carB forward GCACACCATACTCAAGTGAACG; carB reverse ACAGGGGATTCATTGTCGT; Primer pair for amplifying clpP: clpP forward GATTGACCTGTACGCTCAGCT; clpP reverse CAACAGTTATTACAAGGAGGA.
Citation Information
Patent Citations
Level identification and bacterial strain typing integrated method of staphylococcus strain on the basis of single nucleotide polymorphism
CN107164512A
Application of staphylococcus epidermidis MLST typing in forensic microbial identification
CN110305971A