Application of hsa_circ_0006718 in the preparation of a kit for diagnosing gastric cancer or differentiating between gastritis and gastric cancer

Abstract

The present invention provides the use of hsa_circ_0006718 in the preparation of a kit for diagnosing gastric cancer or differentiating between gastritis and gastric cancer, belonging to the field of molecular diagnostic technology. Based on the results of a plasma exosome circRNA chip, the present invention selects candidate molecules to be verified through screening by P value and difference fold. After ensuring that the primers can effectively amplify the target circRNA molecule, a large number of plasma samples of normal physical examination subjects, gastric cancer patients, and chronic atrophic gastritis patients are collected and exosome circRNA is extracted to verify the candidate molecules. The entire experimental process and the screening method for plasma exosome circRNA markers are also applicable to plasma exosome circRNA markers of other diseases and have broad application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of molecular diagnosis technology, and specifically relates to the use of hsa_circ_0006718 in preparing a kit for diagnosing gastric cancer or differentiating between gastritis and gastric cancer. Background Art

[0002] Gastric cancer is the fifth most common malignant tumor in the world and the second leading cause of cancer death in my country, with high morbidity and mortality rates. Due to its insidious onset, there are often no obvious symptoms in the early stages, and most patients are diagnosed in the late stages. The gold standard for clinical diagnosis is tissue pathological biopsy, which is very traumatic and difficult to achieve early screening. Therefore, there is an urgent need for a convenient and minimally invasive diagnostic method to assist in the early diagnosis of gastric cancer in clinic. Chronic atrophic gastritis is a gastric disease characterized by atrophy of the intrinsic glands of the gastric mucosa. Moderate to severe gastritis has a certain rate of canceration. Clinically, the treatments for chronic atrophic gastritis and gastric cancer are different. In order to avoid the inconvenience caused by misdiagnosis to patients, there is an urgent need to find a test kit that can differentiate between chronic atrophic gastritis and gastric cancer.

[0003] Exosomes are membrane-bound vesicles with diameters ranging from 40 to 160 nm. They carry large quantities of proteins, nucleic acids, and other substances from new cells, reflecting the real-time state of parent cells to a certain extent and transmitting these substances through intercellular communication. Exosomes are widely distributed in various body fluids. Detecting exosomes derived from body fluids can enable minimally invasive or non-invasive liquid biopsies, a diagnostic method with broad application prospects.

[0004] circRNA is a new type of non-coding RNA with a covalent circular structure. It has the advantages of high stability, long half-life, and tissue-specific distribution. It is widely involved in the progression of various human diseases such as tumors and is closely related to the progression and prognosis of the disease. Therefore, it is very suitable as a diagnostic marker and therapeutic target for the disease.

[0005] Exosomes can enrich and protect circRNAs from degradation, making them more stable and abundant, making them suitable as specific diagnostic markers for diseases. Currently, there are few reports on exosomal circRNAs in gastric cancer. Therefore, identifying differentially expressed circRNAs in plasma exosomes from gastric cancer patients would be a significant aid in the diagnosis of gastric cancer. Summary of the Invention

[0006] In view of this, the purpose of the present invention is to provide the use of hsa_circ_0006718 in the preparation of a kit for diagnosing gastric cancer. Based on the fact that the expression level of hsa_circ_0006718 in gastric cancer patients is higher than that in normal subjects and gastritis patients, it can be used as a gastric cancer diagnostic marker to prepare related detection products.

[0007] The present invention aims to provide the use of hsa_circ_0006718 in the preparation of a kit for distinguishing gastritis from gastric cancer. Based on the differential expression of hsa_circ_0006718 in the exosomes of the body fluids of gastritis patients and gastric cancer patients, hsa_circ_0006718 plays an application value in distinguishing gastritis from gastric cancer.

[0008] The present invention provides use of hsa_circ_0006718 as a gastric cancer diagnostic marker in preparing a kit for diagnosing gastric cancer.

[0009] The present invention provides the use of hsa_circ_0006718 as a gastric cancer diagnostic marker in the preparation of a kit for distinguishing gastritis from gastric cancer.

[0010] The present invention provides use of a reagent for detecting the expression level of hsa_circ_0006718 in preparing a kit for diagnosing gastric cancer or differentiating between gastritis and gastric cancer.

[0011] Preferably, the nucleotide sequence of hsa_circ_0006718 is shown in SEQ ID NO:1.

[0012] Preferably, the source of hsa_circ_0006718 is plasma exosomes.

[0013] Preferably, the reagent for detecting the expression level of hsa_circ_0006718 includes a primer pair for qPCR amplification of hsa_circ_0006718;

[0014] The primer pair for qPCR amplification of hsa_circ_0006718 includes a forward primer with a nucleotide sequence as shown in SEQ ID NO: 2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 3.

[0015] Preferably, the reagent further comprises 2×AceQ qPCR SYBR Green Master Mix.

[0016] Preferably, the method for diagnosing gastric cancer is that when the expression level of hsa_circ_0006718 in the exosomes of the sample to be diagnosed is significantly increased compared with the expression level of hsa_circ_0006718 in the exosomes of healthy sources or the exosomes of gastritis patients, it indicates that the sample to be diagnosed has a risk of gastric cancer.

[0017] If the relative expression level of hsa_circ_0006718 in the exosomes of the sample to be diagnosed is ≥-3.38167, the sample has a risk of coming from a gastric cancer patient.

[0018] The present invention provides the use of hsa_circ_0006718 as a diagnostic marker for gastric cancer in the preparation of a kit for diagnosing gastric cancer. Using plasma exosome samples from patients diagnosed with gastric cancer or gastritis by physicians, as well as healthy individuals, the present invention screened for a differentially expressed molecule, hsa_circ_0006718, through circRNA chip sequencing. Simultaneously, by detecting the expression level of hsa_circ_0006718 in plasma exosomes, the researchers demonstrated that hsa_circ_0006718 expression levels in plasma exosomes from gastric cancer patients were significantly higher than those in healthy controls, and ruled out the effect of surgery on the expression of hsa_circ_0006718 in gastric cancer exosomes. Therefore, the experimental results of the present invention demonstrate that hsa_circ_0006718 can be used as a diagnostic marker for gastric cancer, thereby enriching clinical gastric cancer diagnostic products.

[0019] The present invention also provides the use of hsa_circ_0006718 as a diagnostic marker for gastric cancer in the preparation of a kit for distinguishing gastritis from gastric cancer. The present invention uses plasma exosome samples from patients diagnosed with gastric cancer, gastritis, and healthy individuals as materials, respectively, and screens for a differentially expressed molecule, hsa_circ_0006718, through circRNA chip sequencing. Simultaneously, by detecting the expression level of hsa_circ_0006718 in plasma exosomes, it is shown that the expression level of hsa_circ_0006718 in plasma exosomes of gastric cancer patients is significantly higher than that of gastritis patients, and the effect of surgery on the expression level of hsa_circ_0006718 in gastric cancer exosomes is ruled out. Therefore, the present invention provides a method for effectively distinguishing gastric cancer from gastritis, providing an effective method for quickly distinguishing gastric cancer from gastritis in clinical practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Cluster analysis diagram and volcano diagram of the plasma exosome circRNA chip results used in the present invention;

[0021] Figure 2 The amplification curve and melting curve of hsa_circ_0006718 and the internal reference gene β-actin detected by real-time fluorescence quantitative PCR provided by the present invention are as follows;

[0022] Figure 3 This is a diagram showing the TA cloning and sequencing results of the qPCR product of hsa_circ_0006718 provided by the present invention;

[0023] Figure 4 This is an agarose electrophoresis diagram of the products of cDNA and gDNA amplified in two cell lines using back-to-back specific primers for hsa_circ_0006718 provided by the present invention;

[0024] Figure 5 This is a graph showing the relative expression changes of hsa_circ_0006718 and linear RNA β-actin before and after RNase R treatment provided by the present invention;

[0025] Figure 6 This is a graph showing the expression differences of hsa_circ_0006718 in plasma exosomes from 47 healthy subjects, 42 patients with chronic atrophic gastritis, and 61 patients with gastric cancer using real-time fluorescence quantitative PCR provided by the present invention;

[0026] Figure 7 : This is a graph showing the specificity and sensitivity of plasma exosome hsa_circ_0006718 in diagnosing gastric cancer (compared with healthy subjects and patients with chronic atrophic gastritis, respectively) analyzed by the ROC curve provided by the present invention;

[0027] Figure 8 This is a schematic diagram of the expression differences of hsa_circ_0006718 in plasma exosomes of 15 gastric cancer patients before and after surgery provided by the present invention. DETAILED DESCRIPTION

[0028] The present invention provides the use of hsa_circ_0006718 as a gastric cancer diagnostic marker in the preparation of a kit for diagnosing gastric cancer and / or differentiating between gastritis and gastric cancer.

[0029] In the present invention, the nucleotide sequence of hsa_circ_0006718 is preferably as shown in SEQ ID NO: 1 (CTTGGCTTGTGGAGATGTTGAAGGAAAGTTTGATATTTTATTCAATA GAGTTCAAGCAATTCAGAAGAAAAGTGGAAACTTTGATCTGCTGTTGTGTGTAGGAAATTTCTTTGGCTCCACCCAAGATGCTGAATGGGAGGAGTATAAGACTGGCATCAAGAAAGCTCCTATTCAGACATATGTGCTTGGTGCTAATAACCAGGAAACAGTAAAATATTTCCAGGATGCTGATGGATGTGAATTAGCTGAAAACATTACTTATCTGG). The source of hsa_circ_0006718 is preferably plasma exosomes.

[0030] The present invention provides use of a reagent for detecting the expression level of hsa_circ_0006718 in preparing a kit for diagnosing gastric cancer or differentiating between gastritis and gastric cancer.

[0031] In the present invention, the reagent for detecting the expression level of hsa_circ_0006718 preferably includes a primer pair for qPCR amplification of hsa_circ_0006718. The primer pair for qPCR amplification of hsa_circ_0006718 includes a forward primer having a nucleotide sequence as shown in SEQ ID NO: 2 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 3. The reagent preferably also includes 2×AceQ qPCR SYBR Green Master Mix. The kit preferably also includes qPCR amplification primers for an internal reference gene. The nucleotide sequence of the qPCR amplification primers for the internal reference gene is a forward primer having a nucleotide sequence as shown in SEQ ID NO: 4 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 5. The kit preferably includes an extraction reagent and / or a reverse transcription reagent for exosome total RNA. The present invention has no particular restrictions on the source of the extraction reagent and / or reverse transcription reagent for exosome total RNA; any of the extraction reagents and / or reverse transcription reagents known in the art can be used.

[0032] In the present invention, the method for diagnosing gastric cancer or differentiating between gastritis and gastric cancer is preferably as follows: RNA is extracted from the sample to be diagnosed, and the obtained cDNA is used as a template to prepare a qPCR reaction system, amplified by qPCR, and the relative expression level of hsa_circ_0006718 is analyzed by technology. Then, according to the judgment method, it is determined whether the sample to be diagnosed has a risk of gastric cancer or gastric cancer and gastritis are distinguished.

[0033] In the present invention, the sample to be diagnosed is preferably a plasma sample. Exosomes are preferably extracted from the plasma sample, and then RNA is extracted from the exosomes to obtain RNA. The present invention has no particular restrictions on the method for extracting exosomes, and any extraction method well known in the art can be used. The method for extracting RNA from exosomes is preferably a kit method. The present invention has no particular restrictions on the source of the kit used to extract RNA from exosomes, and any RNA extraction kit well known in the art can be used. In an embodiment of the present invention, the kit for extracting RNA from exosomes was purchased from QIAGEN.

[0034] The present invention has no particular limitation on the reverse transcription method, and any reverse transcription method known in the art can be used. In the embodiment of the present invention, the reverse transcription kit was purchased from Novozymes.

[0035] In the present invention, the qPCR amplification reaction system preferably comprises 10 μl of 2×AceQ qPCR SYBR Green MasterMix, 0.4 μl of 10 μM forward primer, 0.4 μl of 10 μM reverse primer, 2 μl of cDNA, and 7.2 μl of RNase-free ddH2O. The qPCR amplification reaction program preferably comprises: 95°C for 5 min; 40 cycles of 95°C for 10 s, 54°C for 30 s, and 75°C for 1 s (fluorescence collection); 60°C for 15 s (fluorescence collection), and 95°C for 15 s (0.5°C increments).

[0036] In the present invention, a relative quantitative analysis method was used for the qPCR amplification results, with β-actin as the internal reference gene, using the formula ΔCt=CThsa_circ_0006718-CTβ-actin, and -ΔCt as the vertical coordinate, and Graphpad Prism was used for analysis and graphing.

[0037] In the present embodiment, only the relative expression levels of hsa_circ_0006718 in plasma exosomes of 47 normal subjects, 42 patients with chronic atrophic gastritis and 61 patients with gastric cancer were combined. Figure 6 As shown in the figure, the mean values of the three groups of data for normal subjects, chronic atrophic gastritis patients, and gastric cancer patients were -4.41116, -4.33613, and -3.38167, respectively. Therefore, it can be considered that in the samples shown in this example, when the relative expression level of hsa_circ_0006718 in plasma exosomes is ≥-3.38167, the sample may be from a gastric cancer patient. However, other possibilities cannot be ruled out and the specific judgment still needs to be made in combination with the results of clinical pathological biopsy.

[0038] In the present invention, the method for distinguishing gastritis from gastric cancer is preferably that when the relative expression level of hsa_circ_0006718 in plasma exosomes is ≥-3.38167, the sample is likely to come from a gastric cancer patient rather than a chronic atrophic gastritis patient or a normal person, but other possibilities are not excluded and the specific judgment should be made in combination with the results of clinical pathological biopsy.

[0039] In the present invention, the kit provided by the present invention is only used as a means of auxiliary diagnosis of gastric cancer or differentiation between gastritis and gastric cancer. If the disease is to be confirmed, a comprehensive judgment based on clinical gastroscopy and physiological biopsy test results is required.

[0040] The following examples describe in detail the use of hsa_circ_0006718 provided by the present invention in preparing a kit for diagnosing gastric cancer or differentiating between gastritis and gastric cancer. However, these examples should not be construed as limiting the scope of protection of the present invention.

[0041] Example 1

[0042] Plasma exosome circRNA chip sequencing

[0043] 1. After obtaining informed consent from the patients, preoperative plasma samples were collected from six gastric cancer patients. Plasma samples were then collected from six age- and sex-matched patients with chronic atrophic gastritis and six healthy subjects undergoing physical examinations. Gastric cancer patients were confirmed as having gastric cancer by endoscopy and pathological examination by a physician, and had no other major organ dysfunction. Exclusion criteria included gastric cancer patients with concurrent comorbidities such as diabetes, liver and kidney dysfunction, or other tumor-related diseases. The remaining six chronic atrophic gastritis patients and six healthy subjects were age- and sex-matched to the six gastric cancer patients.

[0044] 2. Preliminary processing of plasma samples:

[0045] (1) Collect 6-10 ml of cubital venous blood using an EDTA anticoagulant tube. Immediately after collection, gently invert the tube five times to mix thoroughly.

[0046] (2) After standing for at least 30 min, centrifuge the blood collection tube at 4°C, 3000 rpm, for 10 min to obtain plasma;

[0047] (3) The upper plasma layer was transferred to a 1.5 ml EP tube and centrifuged at 4°C, 3000 g, for 15 min to remove cell debris;

[0048] (4) The centrifuged plasma was aliquoted, registered, and stored at -80°C.

[0049] 3. Plasma exosome circRNA chip sequencing

[0050] (1) Using Agilent ceRNA expression profile chip sequencing from Shanghai Bohao Biotechnology Co., Ltd., differentially expressed molecules were screened with P < 0.05 and expression difference fold FC ≥ 2. After primer circularization verification and clinical plasma exosome sample verification, a differentially expressed molecule hsa_circ_0006718 ( Figure 1 ).

[0051] Example 2

[0052] Detection of plasma exosomes hsa_circ_0006718

[0053] 1. Extraction of exosomes from plasma samples:

[0054] (1) Thaw the sample stored at -80°C on ice, pipette 250 μl into a new EP tube, add 63 μl ExoQuick™ Exosome Precipitation Solution, mix gently by pipetting, and let stand at 4°C for 30 min to precipitate exosomes;

[0055] (2) Centrifuge at 4°C, 1500g for 30 min, remove the supernatant, and centrifuge again at 4°C, 1500g for 5 min. Carefully remove the supernatant without touching the precipitate.

[0056] (3) Add 200 μl of finished PBS and mix thoroughly to dissolve the exosome precipitate. Let it stand at 4°C for at least 10 min to dissolve the precipitate.

[0057] 2. Extraction of total exosome RNA:

[0058] (1) Add 1 ml of QIAZOL Lysis Reagent to the exosome pellet, vortex and pipette to mix, and let stand at room temperature for 5 min;

[0059] (2) Add 200 μl (equal volume to the exosome sample) of chloroform, shake vigorously for 30 seconds, and then let it stand at room temperature for 2-3 minutes;

[0060] (3) Centrifuge at 4°C, 12,000 g, for 15 min, and transfer the upper aqueous phase to a new EP tube;

[0061] (4) Add 1.5 times the volume of pre-cooled anhydrous ethanol to the upper aqueous phase and mix thoroughly by pipetting;

[0062] (5) The mixture from step (4) was pipetted into the adsorption column (which has been placed in the collection tube) at a rate of 700 μl / time, centrifuged at room temperature, 12,000 g, for 15 s, and the lower filtrate was discarded. Repeat this process several times.

[0063] (6) Add 700 μl of RWT buffer to the adsorption column, centrifuge at room temperature, 12,000 g, for 15 s, and discard the lower filtrate;

[0064] (7) Add 500 μl of RPE buffer to the adsorption column, centrifuge at room temperature, 12,000 g for 15 s, and discard the lower filtrate;

[0065] (8) Add 500 μl of 80% ethanol to the adsorption column, centrifuge at room temperature, 12,000 g, 2 min, and discard the lower filtrate and outer collection tube;

[0066] (9) Place the adsorption column in a new 2 ml collection tube and centrifuge at room temperature, 12,000 g, for 5 min;

[0067] (10) Place the adsorption column in a new EP tube, add 14 μl of RNase-free water to the middle membrane of the adsorption column, and let it stand for 5 min;

[0068] (11) Centrifugation at room temperature, 12000g, 1 min, and washing the membrane to obtain the RNA solution;

[0069] (12) Aspirate all the RNA solution and drip it into the middle membrane of the adsorption column again. Let it stand at room temperature for 5 minutes and then centrifuge it again at room temperature, 12000g, 1 minute, and wash the membrane to obtain the RNA solution.

[0070] (13) To prevent degradation, the RNA solution was immediately reverse transcribed.

[0071] 3. Reverse transcribe RNA into cDNA. The reaction system is shown in Table 1, and the reverse transcription reaction conditions are shown in Table 2.

[0072] Table 1 Reverse transcription reaction system

[0073]

[0074] The reaction product can be placed at 4°C for immediate use in PCR reaction, or placed at -20°C for use within six months, or stored at -80°C to avoid repeated freezing and thawing.

[0075] Table 2 Reverse transcription reaction conditions

[0076]

[0077] 4. Real-time fluorescence quantitative PCR reaction. The reaction system is shown in Table 3, and the reaction conditions are shown in Table 4.

[0078] Table 3 qPCR reaction system

[0079]

[0080] Applied 3. Perform the reaction in a real-time fluorescence quantitative PCR instrument.

[0081] Table 4 qPCR reaction

[0082]

[0083] 5. qPCR analysis:

[0084] (1) qPCR results show the amplification curve and melting curve of hsa_circ_0006718 and β-actin, such as Figure 2 As shown;

[0085] (2) The qPCR product of hsa_circ_0006718 was recovered, and the TA cloning plasmid was constructed and sequenced. Figure 3 shown.

[0086] 6. Circularity verification of hsa_circ_0006718:

[0087] (1) gDNA (genomic DNA) amplification experiment:

[0088] The back-to-back primers were used to amplify cDNA and gDNA samples simultaneously, and the products were subjected to agarose gel electrophoresis. Figure 4 The results showed that hsa_circ_0006718 could be amplified in cDNA samples of two cell lines, but not in gDNA samples, indicating that it was formed by post-transcriptional regulation.

[0089] (2) RNase R tolerance test:

[0090] RNase R is an exoribonuclease that is intolerant to almost all linear RNAs, but circRNAs are tolerant to it due to their circular nature. In this study, freshly extracted total RNA samples were treated with RNase R for 15-30 minutes, and the expression of hsa_circ_0006718 and linear RNA β-actin was detected by qPCR. The results are shown in Figure 2. Figure 5 As shown in the figure, the expression level of linear RNA β-actin decreased to about 10%, while the expression level of hsa_circ_0006718 did not change much, indicating that hsa_circ_0006718 is more stable than linear RNA β-actin.

[0091] Example 3

[0092] The application value of plasma exosome hsa_circ_0006718 as a diagnostic marker for gastric cancer and its application in the differential diagnosis of chronic atrophic gastritis and gastric cancer

[0093] (1) The present invention included 61 gastric cancer patients who visited the Department of Gastrointestinal Surgery of the First Affiliated People's Hospital of Jiangsu University from July 2021 to June 2022, 42 chronic atrophic gastritis patients who visited the Department of Gastrointestinal Surgery of the Affiliated Hospital of Jiangsu University from July 2021 to June 2022, and 47 healthy subjects matched by age and gender, and performed plasma exosome hsa_circ_0006718 detection on the above-mentioned populations. The two groups of samples were collected at the same time, and the sampling, packaging, and storage conditions were the same. The detection method was the same as described in Example 2.

[0094] (2) Data analysis: The experimental data were analyzed using a relative quantitative analysis method, with β-actin as the internal reference gene. The formula △Ct = CThsa_circ_0006718-CTβ-actin was used, and -△Ct was used as the vertical coordinate. Graphpad Prism was used to analyze and plot the relative expression levels of hsa_circ_0006718 in gastric cancer, chronic atrophic gastritis, and their corresponding healthy subjects.

[0095] (3) Result statistics:

[0096] The test results are shown in Table 5.

[0097] Table 5 shows the test results of healthy people / gastric cancer patients and chronic gastritis patients

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104] Note: N represents normal people, T represents gastric cancer patients, and G represents chronic atrophic gastritis patients.

[0105] Among the 61 gastric cancer patients, 42 chronic atrophic gastritis patients and 47 healthy control subjects provided by the present invention, the expression level of hsa_circ_0006718 in the plasma exosomes of gastric cancer patients was significantly higher than that of chronic atrophic gastritis and healthy subjects (see Figure 6 and Figure 7 , mean and standard deviation).

[0106] To verify whether the expression of hsa_circ_0006718 in plasma exosomes of gastric cancer is related to surgery, the present invention collected and tested plasma samples from 15 gastric cancer patients before and after surgery. Figure 8 As shown in the results, it was found that the expression level of hsa_circ_0006718 was significantly downregulated after surgery.

[0107] Example 4

[0108] Method for detecting samples using hsa_circ_0006718 as a diagnostic marker for gastric cancer

[0109] For clinical unknown samples, plasma exosomes were extracted and the relative expression of hsa_circ_0006718 was detected. The detection result of an unknown sample was -2.608, which was greater than the average relative expression of hsa_circ_0006718 in the plasma exosomes of the gastric cancer group patients mentioned above, which was -3.38167. Combined with the pathological biopsy results, it was found that the patient had poorly differentiated adenocarcinoma in the gastric antrum (partial signet ring cell carcinoma), and the tumor size was 2.2×1.7×1cm 3 , which meets the expected judgment criteria.

[0110] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting the expression level of hsa_circ_0006718 in preparing a kit for diagnosing gastric cancer, wherein the nucleotide sequence of hsa_circ_0006718 is shown in SEQ ID NO: 1, and the source of hsa_circ_0006718 is plasma exosomes.

2. The application according to claim 1, characterized in that The reagent for detecting the expression level of hsa_circ_0006718 includes a primer pair for qPCR amplification of hsa_circ_0006718; The primer pair for qPCR amplification of hsa_circ_0006718 includes a forward primer with a nucleotide sequence as shown in SEQ ID NO: 2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

3.

3. The application according to claim 2, characterized in that: The reagents also include 2×AceQ qPCR SYBR Green Master Mix.

Images