Application of miR-29 in the preparation of anti-radiation drugs

Abstract

The present invention constructs a gene knockout mouse model and finds that miR-29 plays a key role in the radiation resistance of mouse intestinal epithelial tissue, and finds that it directly targets and inhibits HNF4γ. MiR-29 achieves the radiation resistance effect by specifically targeting HNF4γ and inhibiting its activity.

Description

Technical Field

[0001] The present application relates to the preparation and application of anti-radiation drugs, and specifically to the application of microRNA in the preparation of anti-radiation drugs, and belongs to the field of biopharmaceuticals. Background Art

[0002] In recent years, the application of ionizing radiation in the medical field has increased day by day, and radiotherapy has become an important means of treating tumors. During radiotherapy, high doses of radiation prevent or delay the growth of tumor cells by destroying their DNA. In this process, radiation will inevitably damage the DNA of normal cells around tumor cells, resulting in side effects.

[0003] The intestine is an important target organ of radiation damage. After ionizing radiation, intestinal epithelial cells are damaged and the intestinal mucosa necrotizes and falls off. Stem cells located in the intestinal crypts are radiation-sensitive cells. Ionizing radiation causes a decrease in the number of surviving intestinal crypt stem cells, and at the same time, the proliferation and differentiation ability of cells is inhibited, resulting in intestinal dysfunction, triggering digestive tract reactions such as nausea, vomiting, diarrhea, and loss of appetite. About a week later, gastrointestinal syndrome, sepsis, and electrolyte imbalance occur, ultimately leading to death. Therefore, intestinal radiation protection has always been one of the research focuses and difficulties in the field of radiobiology.

[0004] With the development of science and technology, nucleic acid-based drugs have been developed and utilized, and microRNA, as a small RNA molecule consisting of 20-24 nucleotides, is widely used to treat various diseases such as IBD. MicroRNA (miRNA) is a non-coding RNA that is involved in regulating the promotion and inhibition of cancer genes. Studies have found the role of miRNA in inducing radiation resistance in cancer cell lines using clinically relevant radiation-resistant (CRR) cells. For example, miR-7-5p is highly expressed in all CRR cells examined, while the expression of MiR-7-5p is reduced in CRR cells that have lost their radiation resistance, and treatment of CRR cells with miR-7-5p inhibitors leads to decreased resistance to radiation. In contrast, overexpression of miR-7-5p in CRR cells using miR-7-5p mimics showed further resistance to radiation. Overexpression of miR-7-5p in parental cells also leads to resistance to radiation. These results suggest that miR-7-5p can control the radioresistance of various cancer cells at clinically relevant doses of radiation. For example, recent analysis results show that miR-30a, miR-30c, miR-150, miR-200b and miR-320a are dose- or time-dependent with radiation exposure, and behave similarly across species, with a certain degree of genetic conservation, suggesting the possibility of applying animal model results to humans. Currently, there are no reports on the use of miR-29 in the preparation of anti-radiation drugs. Summary of the invention

[0005] One aspect of the present invention is to provide the use of miR-29 in the preparation of anti-radiation drugs. In a specific embodiment, the miR-29 is miR-29a and / or miR-29b; in another specific embodiment, the miR-29 is to achieve anti-radiation damage by specifically targeting HNF4γ and inhibiting its activity.

[0006] The second aspect of the present invention provides an application of an HNF4γ inhibitor in the preparation of an anti-radiation drug; in a specific embodiment, the inhibitor is selected from a specific antibody, a specific interfering nucleic acid fragment, siRNA, and microRNA; preferably, the inhibitor is miR-29a and / or miR-29b; in another specific embodiment, the anti-radiation is to promote the recovery of the intestine of the irradiated subject, preferably, to promote the regeneration of intestinal crypts. .

[0007] The third aspect of the present invention provides a method for preparing a mouse model, characterized in that the gene encoding mouse miR-29 is knocked out by gene editing. In a specific embodiment, the gene editing method is CRISPR-Cas9 method; in another specific embodiment, the gene editing method is CRISPR-Cas9, wherein the guide RNA sequence used is shown in SEQ ID NO:1 and / or SEQ ID NO:2.

[0008] The fourth aspect of the present invention is to provide a method for screening anti-radiation drugs using a mouse model, wherein the mouse model is a mouse in which the gene encoding miR-29 is knocked out by gene editing. In a specific embodiment, the gene editing method is the CRISPR-Cas9 method, wherein the guide RNA sequence used is shown in SEQ ID NO:1 and / or SEQ ID NO:2. In another specific embodiment, the method steps include 1) giving the mouse model a certain dose of radiation; 2) observing the damage to the intestinal crypts; 3) administering a candidate drug; 4) observing the repair of the intestinal epithelial crypts or the recovery of the expression of miR-29, to determine whether the drug is an effective anti-radiation drug.

[0009] The beneficial effects of the present invention are that by establishing a stable genetic knockout mouse model, by giving a certain dose of radiation, it is found that miR-29 has a potential role in anti-radiation therapy; and through the cell metabolic pathway, it is found that the direct target of miR-29 that plays a related role is HNF4γ; in mice lacking miR-29, after a certain dose of radiation is given, the damage to the intestinal crypts of the mice is significantly higher than that of the wild-type control mice; after restoring the expression of miR-29, this trend is reversed, indicating that miR-29 has an effect of resisting radiation damage in vivo, and can be used as a potential drug for treating radiation damage. In addition, the mouse model prepared by the present application can also be used as an animal model for screening anti-radiation drugs. After a certain dose of radiation is given to the animal model, the crypt damage of the intestinal epithelium is observed, and then a certain dose of candidate drugs is given. After a certain period of time, the recovery of the crypt damage of the intestinal epithelium or the recovery expression of miR-29 is observed, and it can be judged whether the drug is a potential drug for treating radiation damage. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 Schematic diagram of knockout mouse construction. Note: (A) Schematic diagram of the construction of miR-29a / b1 whole-body knockout mice (gRNA1: AGGAAGCTGGTTTCATATGGTGG; gRNA2: GACTACGTTATTGCTGACGTTGG). (B) The excised sequence in the miR-29a / b1 coding sequence, the sequence in the middle of the red dotted line is the excised sequence, the bold sequence is the exon of miR-29, the red base sequence is the mature sequence of miR-29a, and the blue base sequence is the miR-29b1 sequence.

[0011] Figure 2 .MiR-29 deficiency exacerbates weight loss and survival rate in mice after irradiation.

[0012] Figure 3 .miR-29 knockout slows down intestinal epithelial damage repair.

[0013] Figure 4 .miR-29 knockout inhibits regenerative crypt reconstruction.

[0014] Figure 5 .miR-29 inhibits fatty acid oxidation signaling pathway in mouse small intestinal epithelial cells.

[0015] Figure 6 .miR-29 directly targets HNF4γ.

[0016] Figure 7 .miR-29 inhibits fatty acid oxidation levels in intestinal organoids.

[0017] Figure 8 Artificial administration of miR-29 analogs accelerated the repair of radiation-induced damage to the intestinal epithelium of mice. DETAILED DESCRIPTION

[0018] The following is a further detailed description of the specific implementation methods and technical solutions of the present invention in conjunction with the accompanying drawings and specific embodiments. It should be made clear that those skilled in the art can refer to the content of this article and appropriately improve the process parameters for implementation. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art, and they are all deemed to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0019] Example 1 Obtaining transgenic mice

[0020] After the fragment encoding miR-29ab1 in the mouse genome was cut by CRISPR / Cas9 technology, miR-29ab1 whole-body knockout mice were obtained by pronuclear injection. + / -). Cut sequence and position as Figure 1 shown.

[0021] The gene editing method used in the present invention is carried out with reference to the literature (Li Y, Lin Z, Huang C, et al. Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing. Metabolic engineering, 2015, 31: 13-21.), and the steps include:

[0022] 1.1 Plasmid construction

[0023] The purpose of constructing the plasmid pGRB is to transcribe the corresponding gRNA, thereby forming a complex with the Cas9 protein, and recognizing the target gene target site through base pairing and PAM to achieve the target DNA double-strand break. The pGRB plasmid is constructed by recombination of a DNA fragment containing the target sequence with a linearized vector fragment.

[0024] 1.1.1 Target sequence design

[0025] Design target sequence (PAM: 5'-NGG-3') using CRISPR RGEN Tools

[0026] gRNA1:5'-AGGAAGCTGGTTTCATATGGTGG-3'(SEQ ID NO:1);

[0027] gRNA2:5'-GACTACGTTATTGCTGACGTTGG-3'(SEQ ID NO:2).

[0028] 1.1.2 Preparation of DNA fragments containing target sequences

[0029] 1.1.3 Preparation of linear vector

[0030] The vector was linearized by inverse PCR amplification.

[0031] 1.1.4 Recombination reaction

[0032] 1.1.5 Plasmid transduction

[0033] 1.1.6 Clone identification

[0034] The gene editing method used in the present invention has the following specific process: according to the structure of the miR-29 gene, a guide RNA (gRNA) for knocking out exon 1 is designed, and Cas9 mRNA and gRNA expressing Cas9 protein are obtained by in vitro transcription. Cas9 mRNA and gRNA are injected into the fertilized eggs of C57BL / 6 mice by microinjection to obtain F0 generation mice. The mouse tail genome is extracted from F0 generation mice, and positive F0 generation mice are confirmed by PCR identification and product sequencing. Positive F0 generation mice are mated with C57BL / 6 mice to obtain positive F1 generation heterozygous mice.

[0035] Example 2: Ionizing Radiation Treatment of Mice

[0036] The miR-29ab1 obtained in Example 1 was taken at 12 weeks of age. - / - Mice and wild mice were irradiated with 12Gy of cobalt-60 radiation and then observed for 5 days. The weight and survival rate of the mice were statistically analyzed. Samples were taken 2 hours, 3 days, 4 days, and 5 days after irradiation. The weight and survival rate were statistically analyzed. The results are shown in Figure 2 ,Depend on Figure 2 miR-29ab1 - / - The weight loss rate of mice was significantly higher than that of wild-type mice, while the survival rate was significantly lower than that of wild-type mice.

[0037] Example 3: Analysis of mouse intestinal epithelial tissue characteristics

[0038] 1. Hematoxylin and eosin (H&E) staining analysis

[0039] 1) Paraffin-embedded blocks were sliced ​​to a thickness of 5 μm and baked at 63°C for 1 hour until the wax in the slices melted.

[0040] 2) Dewaxing and hydration, the steps are as follows: xylene twice, 15 minutes each time; 100% ethanol twice, 5 minutes each time; 95% ethanol twice, 5 minutes each time; 80% ethanol, 70% ethanol, 50% ethanol, and distilled water once each, all for 5 minutes.

[0041] 3) Hematoxylin staining: add hematoxylin to each slide to cover the tissue, incubate at room temperature for 3 minutes, and rinse with running tap water for 5 minutes.

[0042] 4) Eosin staining: Before eosin staining, place the slide in 95% ethanol for 30 seconds, then add eosin for 10 seconds, and then fix with 95% ethanol. Dehydrate with 100% ethanol twice, 3 minutes each time. Dehydrate with xylene twice, 10 minutes each time.

[0043] 5) Seal the slides with neutral gum and examine under a microscope.

[0044] Results Figure 3 As shown in the figure, miR-29ab1 - / - The degree of damage to the intestinal epithelial tissue in mice was higher than that in wild-type mice.

[0045] 2. Immunohistochemical staining analysis

[0046] 1) Paraffin sectioning, dewaxing and hydration methods are the same as those for H&E.

[0047] 2) Then, place the slices in a 0.01 mol / L (pH 6.0) sodium citrate solution, heat in a microwave oven at high heat until boiling, then heat at low heat for 20 minutes for antigen repair, and cool naturally at room temperature.

[0048] 3) Draw a water-blocking circle according to the tissue morphology, add an appropriate amount of 3% hydrogen peroxide solution into the water-blocking circle, and react in the dark for 15 minutes to remove endogenous peroxidase.

[0049] 4) After washing the slides with distilled water, place them in 1% Triton X-100 / PBS for permeabilization at room temperature for 20 minutes, and then wash them with PBS solution three times, each time for 5 minutes.

[0050] 5) Then cover the tissue with universal blocking solution for immunostaining and block at room temperature for 1 hour. Add primary antibody Ki67 (1:400) and incubate at 4°C overnight. After rinsing with PBST and PBS, add secondary antibody and incubate at room temperature for 30 minutes.

[0051] 6) After rinsing with PBST and PBS, add horseradish enzyme, incubate at room temperature for 30 minutes, and wash with PBS three times, each time for 5 minutes.

[0052] 7) Add DAB solution for color development, and when brown signal appears, put into distilled water to stop color development. Stain with hematoxylin for 1 minute, then dehydrate the slices with gradient ethanol and make them transparent with xylene, seal the slices with neutral gum, and examine under a microscope.

[0053] The results are as follows Figure 4 As shown in the figure, it can be seen that in the process of irradiated small intestinal epithelial repair, the number and height of crypts formed were significantly increased by miR-29ab1. - / - The intestinal epithelial tissue of mice was significantly lower than that of wild-type mice.

[0054] Example 4 Changes in target genes of miR-29

[0055] 1. Changes in gene expression profile at the mRNA level

[0056] Real-time quantitative PCR:

[0057] 1) Add 1 mL of Trizol reagent to every 50-100 mg of tissue sample, chop the tissue and crush the small intestine tissue with a multifunctional homogenizer. Extract RNA according to the kit method and determine the quality and concentration.

[0058] 2) Use a reverse transcription kit to perform reverse transcription, and store the cDNA sample at -20°C after the reverse transcription.

[0059] 3) The relative expression level of the gene was determined by real-time fluorescence quantitative PCR (qPCR), primer sequence:

[0060] Ppara

[0061] F:5'-AGAGCCCCATCTGTCCTCTC-3'(SEQ ID NO:3);

[0062] R:5'-ACTGGTAGTCTGCAAAACCAAA-3'(SEQ ID NO:4);

[0063] CD36

[0064] F: 5'-ATGGGCTGTGATCGGAACTG-3' (SEQ ID NO: 5);

[0065] R: 5'-GTCTTCCAATAAGCATGTCTCC-3' (SEQ ID NO: 6);

[0066] Pdk4

[0067] F: 5'-AGGGAGGTCGAGCTGTTCTC-3' (SEQ ID NO: 7);<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0068] <h2 style=";text-align:left;direction:ltr"> R:5'-GGAGGTGTTCACTAAGCGGTC-3'A(SEQ ID NO:8);<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0069] <h2 style=";text-align:left;direction:ltr"> Hnf4g<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0070] <h2 style=";text-align:left;direction:ltr"> F:5'-GTGTCAACTGTTTATGTGCCATC-3'(SEQ ID NO:9);<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0071] <h2 style=";text-align:left;direction:ltr"> R:5'-GTTCATTTTGCACCCGCTTCTTTT-3'(SEQ ID NO:10);<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0072] <h2 style=";text-align:left;direction:ltr"> Cpt1a<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0073] <h2 style=";text-align:left;direction:ltr"> F:5'-CCATGAAGCCTCAAACAGATC-3'(SEQ ID NO:11);<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0074] <h2 style=";text-align:left;direction:ltr"> R:5'-ATCACACCCACCACCACGATA-3'(SEQ ID NO:12);<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0075] <h2 style=";text-align:left;direction:ltr"> Fasn<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0076] <h2 style=";text-align:left;direction:ltr"> F:5'-GGAGGTGGTGATAGCCGGTAT-3'(SEQ ID NO:13);<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0077] <h2 style=";text-align:left;direction:ltr"> R:5'-TGGGTAATCCATAGAGCCCAG-3'(SEQ ID NO:14);<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0078] <h2 style=";text-align:left;direction:ltr"> Aldob<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0079] <h2 style=";text-align:left;direction:ltr"> F:5'-GAAACCGCCTGCAAAGGATAA-3'(SEQ ID NO:15);<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0080] <h2 style=";text-align:left;direction:ltr"> R:5'-GAGGGTCTCGTGGAAAAGGAT-3'(SEQ ID NO:16);<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0081] <h2 style=";text-align:left;direction:ltr"> Acsl5<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0082] <h2 style=";text-align:left;direction:ltr"> F:5'-TCCTGACGTTTGGAACGGC-3'(SEQ ID NO:17);<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0083] <h2 style=";text-align:left;direction:ltr"> R:5'-CTCCCTCAATCCCCACAGAC-3'(SEQ ID NO:18);<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0084] <h2 style=";text-align:left;direction:ltr"> Fabp6<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0085] F: 5'-CTTCCAGGAGACGTGATTGAAA-3' (SEQ ID NO: 19);

[0086] R: 5'-CCTCCGAAGTCTGGTGATAGTTG-3' (SEQ ID NO: 20);

[0087] Guca2b

[0088] F: 5'-AGGGTGTCTACATCAAGTACCAT-3' (SEQ ID NO: 21);

[0089] R: 5'-AAGGGCAAGGCTGGGTTATG-3' (SEQ ID NO: 22);

[0090] Apoa4

[0091] F: 5'-CAACAGGCTGAAGGCTACGAT-3' (SEQ ID NO: 23);

[0092] R: 5'-CGATTTTTGCGGAGACCTTGG-3' (SEQ ID NO: 24).

[0093] 2. Changes in protein expression profile

[0094] Western blot

[0095] 1) Add an appropriate amount of protein lysis buffer, break with a homogenizer and place on ice for 30 minutes. Centrifuge at 13000g, 4℃ for 15 minutes, and then transfer the supernatant to a new centrifuge tube; immediately use the BCA protein concentration assay kit (ThermoFisher Scientific) to determine the sample protein concentration.

[0096] 2) Adjust the protein concentration and add 5× SDS-PAGE loading buffer, mix well, incubate in a metal bath at 100°C for 15 min, and load directly. Perform electrophoresis at 80V constant voltage. When the bromophenol blue front reaches the interface between the stacking gel and the separation gel, adjust the voltage to 120V constant voltage and continue electrophoresis; stop electrophoresis when the bromophenol blue front approaches the bottom of the separation gel; transfer to the membrane at a constant current of 200mA for 2h.

[0097] 3) After transfer, immerse the PVDF membrane in the blocking solution and incubate at room temperature for 2 hours; transfer the PVDF membrane to the antibody dilution solution of the target protein and incubate overnight at 4°C.

[0098] 4) The next day, the PVDF membrane was rinsed 5 times in TBST on a shaker, each time for 5 minutes; the PVDF membrane was transferred to the secondary antibody dilution solution and incubated at room temperature for 1 hour, and then the PVDF membrane was rinsed 5 times in TBST on a shaker, each time for 5 minutes; the reaction solution was prepared according to the instructions of the ECL chemical substrate luminescence kit, the reaction solution was evenly dropped on the PVDF membrane, and exposed and photographed with a gel imager.

[0099] Changes in mRNA and protein levels are shown in Figure 5 As can be seen from the figure, miR-29ab1 - / - In the intestinal epithelial tissue of mice, the expression of PDK4, HNF4γ, ACADM, and CPT1A increased significantly, and sequence analysis revealed that it may directly target the gene HNF4γ ( Figure 6 ).

[0100] 3. Dual luciferase assay to verify miR-29 target gene

[0101] First, 293T cells were revived and cultured in DMEM cell culture medium containing 10% FBS and 1% SP in a cell culture incubator at 37°C and 5% CO2. After cell subculture and plating, they were transfected with wild-type plasmids of the target fragment and mutant plasmids of the target fragment, 50nmol / L miR-29mimics and miR-29NC (negative control), and a subsequent Renilla-firefly dual luciferase activity assay was performed 24 hours later.

[0102] 24 hours after transfection, add 100 μL of cell lysis buffer to each well and lyse at room temperature for 30 minutes. Transfer the above lysate to a 1.5 ml centrifuge tube and centrifuge at 7500 rpm for 5 minutes at room temperature. Add 20 μL of the above lysate supernatant and 100 μL of firefly luciferase substrate to a black 96-well plate to avoid bubbles. The multifunctional microwell detector detects relative light unit (RLU). After the test, immediately add 100 μL of Dual-Glo Stop&Glo Regent solution to each well. The multifunctional microwell detector detects relative light unit (RLU). Using sea cucumber luciferase as the internal reference and cells transfected with empty plasmid as the blank control, the RLU ratio of firefly luciferase to Renilla luciferase represents the degree of activation of the reporter gene.

[0103] The results showed that miR-29 specifically targets HNF4γ (results as shown in Figure 6 shown).

[0104] Example 5. Effect of miR-29 deficiency on metabolic function of small intestinal epithelial cells

[0105] 1. Fatty acid oxidation activity

[0106] 1) Inoculate crypts in black well plates, 10 μL per well, and culture for 2-3 days.

[0107] 2) Aspirate the culture medium, add FA-Free Measurement Media to wash, and repeat once; add 5μL of drug (BSA / Etomoxir), and then add 10μL Extracellular O2 Consumption Reagent (protected from light), and add 10μL FA Measurement Media for the blank control; at this time, add 100μL High Sensitivity Mineral Oil (protected from light) to each well.

[0108] 3) Set the temperature of the microplate reader to 37°C, measure the fluorescence intensity in a cycle for a total of 120 minutes with an interval of 1.5 minutes, Ex / Em = 380 / 650nm. Obtain the oxygen consumption rate of non-long-chain fatty acids: no FA+Etomoxir; endogenous fatty acid oxidation rate: (no FA+BSA)-(no FA+Etomoxir); exogenous fatty acid oxidation rate: (FA+BSA)-(no FA+BSA).

[0109] 2. Acetyl CoA Determination

[0110] 1) Remove the culture medium, blow off the matrix gel with ice-cold PBS, collect 4 wells (24-well plate) in a 1.5 mL centrifuge tube, centrifuge at 4°C and 200g for 5 min, and freeze the precipitate at -80°C.

[0111] 2) Add 30 μL of 1M perchloric acid and vortex until smooth, centrifuge at 10000g for 10 min. Transfer 30 μL of supernatant to a new microcentrifuge tube and add 3M potassium bicarbonate at a ratio of 10:1. After vortexing, place on ice for 5 min. When a white precipitate appears, use pH test paper to verify whether the pH is 6-8. The supernatant is the sample to be tested.

[0112] 3) Use a black or white 96-well plate, add 10 μL of sample to each well, add 0, 10, 20, 30, 40, 50 μL of 2 μM standard to each well, and use buffer to make up the volume of each well to 50 μL. Add 10 μL of Quencher to each well, incubate at room temperature for 5 minutes, add 2 μL of Quencher Remover to each well, and incubate for another 5 minutes.

[0113] 4) Add 50 μL of Reaction Mix to each well and incubate at 37°C for 10 min in the dark. Measure the fluorescence intensity at Ex / Em=535 / 587 nm, and obtain the acetyl-CoA content based on the standard curve. Determine the protein concentration of the remaining samples by the BCA method, which is used to standardize the acetyl-CoA content (the results are expressed in pmol / μg protein).

[0114] The results are as follows Figure 7 As shown, Figure 7 miR-29ab1 - / - The acetyl-CoA content of mice increased, and the oxygen consumption increased significantly, indicating that their fatty acid oxidation activity increased, suggesting that the loss of miR-29 led to the aggravation of radiation damage in the intestinal epithelial tissue of mice.

[0115] Example 6 Effects of miR-29 analogs on intestinal epithelial tissue traits in mice

[0116] Artificially synthesized miR-29 analog (AgomiR-29);

[0117] The gene knockout mice described in Example 2 were injected and administered; the recovery of the small intestinal epithelium of the mice after radiation was detected according to the method described in Example 3. The specific results are shown in Figure 8 ,Depend on Figure 8 It can be seen that after the administration of AgomiR-29, during the recovery of intestinal crypts in mice after radiation, the height of kii67+ cells and crypts were higher than those in the control group, that is, miR-29 can improve the recovery of the mouse intestine after radiation.

Claims

1. The use of miR-29 in the preparation of a drug for improving radiation-induced small intestinal epithelial tissue damage, characterized in that: The improvement is the restoration of small intestinal epithelial crypts; the miR-29 is miR-29a and / or miR-29b.

2. The use according to claim 1, characterized in that: The miR-29 improves radiation-induced small intestinal epithelial damage by specifically targeting HNF4γ and inhibiting its activity.

3. Use of a mouse model in screening drugs for improving radiation-induced small intestinal epithelial tissue damage, characterized in that: The mouse model is a mouse in which the gene encoding miR-29 is knocked out by gene editing means, and the gene editing means is the CRISPR-Cas9 method, wherein the guide RNA sequences used are shown in SEQ ID NO: 1 and SEQ ID NO:

2.

4. The use according to claim 3, characterized in that: The screening steps are: 1) Giving the mouse model a certain dose of radiation; 2) Observing the damage of intestinal crypts; 3) Administering a candidate drug; 4) Observing the repair of intestinal epithelial crypts to determine whether the drug is an effective anti-radiation drug.

Images