Prmt2 interfering lentivirus and use thereof

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to PRMT2 interfering lentivirus and application thereof. The application designs the interfering lentivirus by taking PRMT2 as a target, and studies the role and mechanism of the interfering lentivirus in triple-negative breast cancer. Experiments show that the interfering lentivirus PRMT2-KD1 and PRMT2-KD2 can down-regulate PRMT2 gene expression, inhibit cell migration, invasion and aerobic glycolysis; the PRMT2 high-expression plasmid combined with a glycolysis inhibitor verifies that PRMT2 affects cell migration and invasion by regulating aerobic glycolysis; animal experiments show that the PRMT2 interfering lentivirus can inhibit lung metastasis of mouse triple-negative breast cancer. The above results suggest that PRMT2 can be used as a drug target for the treatment of triple-negative breast cancer metastasis.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to PRMT2 interference lentivirus and its applications. Background Technology

[0002] Breast cancer is one of the most common malignant tumors in women. Triple-negative breast cancer accounts for about 15% of all breast cancers. Furthermore, because it lacks expression of estrogen receptor (ER), progesterone receptor (PR), and the proto-oncogene Her-2, the effectiveness of current breast cancer treatments is limited, leading to poor prognosis, high recurrence and metastasis rates, and high mortality.

[0003] Aerobic glycolysis, also known as the Warburg effect, is an important basis and marker of energy metabolism reprogramming. Even under oxygen-sufficient conditions, tumor cells still obtain energy through inefficient glycolysis. Currently, aerobic glycolysis in tumor cells is considered a new direction for anticancer therapy. In-depth research into the glucose metabolism process and its regulation in tumor cells will provide new therapeutic targets for cancer treatment.

[0004] PRMT2, a member of the arginine methyltransferase family, is primarily located in the cytoplasm and acts as a transcriptional cofactor in the transcriptional activity of steroid hormones / nuclear receptors. Current functional studies of PRMT2 mainly focus on breast cancer and glioblastoma. Research has found that high expression of PRMT2 can inhibit the proliferation and development of breast cancer, but its role in breast cancer migration and invasion differs. Therefore, exploring the role and mechanism of PRMT2 in breast cancer metastasis can lay the foundation for developing and preparing drugs to treat breast cancer using PRMT2 as a drug target. Currently, no shRNA-interfering lentiviruses targeting PRMT2 have been used in the treatment and mechanistic research of triple-negative breast cancer metastasis. Summary of the Invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide a PRMT2 interference lentivirus and its application.

[0006] This invention provides shRNAs targeting PRMT2, the nucleic acid sequences of which are shown in SEQ ID NO.1 and / or SEQ ID NO.2. In this invention, PRMT2-interfering lentiviruses containing the shRNA can downregulate host PRMT2 gene expression, inhibiting cell migration, invasion, and aerobic glycolysis; they can also influence cell migration and invasion by regulating aerobic glycolysis; in a nude mouse lung metastasis model, the number of tumor nodules in the lung tissue of the PRMT2-interfering lentivirus group was significantly reduced, indicating that it can significantly inhibit lung metastasis of triple-negative breast cancer in mice. Its PRMT2 interference effect on host cells is superior to that of other shRNA-based PRMT2-interfering lentiviruses.

[0007] The present invention provides a recombinant vector, comprising a vector backbone, and / or the shRNA as described in claim 1.

[0008] Furthermore, the vector backbone of the present invention includes a vector backbone containing essential elements for protein expression capable of expressing the shRNA. In some embodiments, the present invention uses the GV640 vector as the test subject to express shRNA.

[0009] In this invention, the recombinant vector also includes recombinant vectors formed by the shRNA in a single or repeated tandem form, and this invention does not limit this.

[0010] This invention provides a PRMT2 interference lentivirus, the raw materials of which include the shRNA described in this invention and / or the expression vector described in this invention.

[0011] This invention provides cells for producing the PRMT2 interfering lentivirus described herein.

[0012] Furthermore, the cells are tool cells, including but not limited to: primary cells, diploid fibroblasts, and continuous cell lines, which can serve as cell factories for the production of the PRMT2 interfering lentivirus; even further, the continuous cell lines include tumor cells, which can rapidly produce and divide. In this invention, 293T cells are used as cell factories for the production of PRMT2 interfering lentivirus.

[0013] This invention provides a method for constructing interfering lentiviruses, which utilizes the PRMT2 interfering lentiviruses described in this invention, and / or the cell-based interfering lentiviruses described in this invention.

[0014] Furthermore, in some specific embodiments, the method for preparing the interfering lentivirus is as follows: 293T cells are transformed or transfected using the PRMT2 interfering lentivirus described in this invention, the cell supernatant is collected, and the PRMT2 interfering lentivirus is obtained through concentration and purification. The transformation methods include chemical transformation and electrotransformation; the transfection methods include calcium phosphate coprecipitation, artificial liposome method, and viral transfection, which are not limited in this invention.

[0015] In this invention, the use of any one of the following (I) to (IV) in the preparation of a medicament for treating triple-negative breast cancer is also provided:

[0016] I) The shRNA described in this invention;

[0017] II) The expression vector described in this invention;

[0018] III) The PRMT2 interference lentivirus described in this invention;

[0019] IV) The tool cells described in this invention.

[0020] Furthermore, the treatment described in this invention includes inhibiting the metastasis and / or invasion of breast cancer cells. In this invention, inhibiting breast cancer metastasis includes inhibiting the metastasis of triple-negative breast cancer, including but not limited to lung metastasis, bone metastasis, brain metastasis, or lymph node metastasis.

[0021] This invention provides a drug comprising any one of the following: i) to iv):

[0022] i) The shRNA described in this invention;

[0023] ii) The expression vector described in this invention;

[0024] iii) The PRMT2 interference lentivirus described in this invention;

[0025] iv) The tool cells described in this invention.

[0026] In this invention, the drug contains liposomes of the recombinant carrier described in this invention.

[0027] Alternatively, the drug described in this invention may also include fermentation broth of shRNA, bacterial cells, supernatant, or active substances containing shRNA, and this invention does not limit the scope of the invention.

[0028] Furthermore, the dosage form of the drug can be powder, granules or liquid preparation, and the administration method can be intravenous injection, intramuscular injection or feeding, and the present invention does not limit it.

[0029] Furthermore, the medicament described in this invention also includes products made from medically acceptable excipients or carriers, but this invention does not limit the scope of the invention.

[0030] This invention designs interfering lentiviruses targeting PRMT2 to investigate their role and mechanism in triple-negative breast cancer. Experiments show that interfering lentiviruses PRMT2-KD1 and PRMT2-KD2 downregulate PRMT2 gene expression, inhibiting cell migration, invasion, and aerobic glycolysis. The binding of a PRMT2-overexpressing plasmid to the glycolysis inhibitor 2-DG validates that PRMT2 affects cell migration and invasion by regulating aerobic glycolysis. Animal experiments demonstrate that PRMT2-interfering lentiviruses significantly inhibit lung metastasis in mouse triple-negative breast cancer. These results suggest that PRMT2 could be used as a drug target for the treatment of triple-negative breast cancer metastasis. Attached Figure Description

[0031] Figure 1 Validation of the efficiency of PRMT2 gene knockdown mediated by lentiviruses interfering with PRMT2, A: protein level, B: mRNA level;

[0032] Figure 2 This study demonstrates the effect of PRMT2-interfering lentivirus on the migration and invasion abilities of MDA-MB-231 cells.

[0033] Figure 3 This study demonstrates the effect of PRMT2-interfering lentivirus on the wound healing ability of MDA-MB-231 cells.

[0034] Figure 4 The effect of PRMT2-interfering lentivirus on glucose consumption and lactate production in MDA-MB-231 cells is shown. A: glucose consumption; B: lactate production.

[0035] Figure 5 This study demonstrates the effect of PRMT2 high expression combined with the glycolysis inhibitor 2-DG on the migration and invasion abilities of MDA-MB-231 cells.

[0036] Figure 6 This study demonstrates the effect of PRMT2 high expression combined with the glycolysis inhibitor 2-DG on the wound healing ability of MDA-MB-231 cells.

[0037] Figure 7 The effect of PRMT2-interfering lentivirus on lung metastasis of triple-negative breast cancer is shown in the following figures: A: Body weight change curve over time; B: Statistical graph of lung tumor nodules in each group; C: Representative images of lung tissue and HE staining; D: In vivo imaging of mice at the experimental endpoint; E: Total fluorescence expression level of mice in each group. Detailed Implementation

[0038] This invention provides a PRMT2 interference lentivirus and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.

[0039] Unless otherwise defined, all technical terms used herein have the same meaning as understood by one of ordinary skill in the art. For definitions and terminology in this field, those skilled in the art may refer to Current Protocols in Molecular Biology (Ausubel). The abbreviations for amino acid residues are the standard 3-letter and / or 1-letter codes used in this field to refer to one of the 20 commonly used L-amino acids.

[0040] This invention provides shRNAs targeting PRMT2, the nucleic acid sequences of which are shown in SEQ ID NO.1 and / or SEQ ID NO.2. The sequence of SEQ ID NO.1 is: ctggaggcttgctgaaggctgtatgctgagttgttcgtggctggtctgcgttttggccactgactgacgcagaccacacg aacaactcaggacacaaggcctgttactagcactcacatggaacaaatggccc. The sequence of SEQ ID NO.2 is: ctggaggcttgctgaaggctgtatgctgtggaagtggacgctaaaccaggttttggccactgactgacctggtttagtcc acttccacaggacacaaggcctgttactagcactcacatggaacaaatggccc.

[0041] The test materials used in this invention are all common commercially available products. The invention is further illustrated below with reference to embodiments:

[0042] Example 1: Construction of a PRMT2-interfering lentivirus

[0043] 1. Experimental Materials and Methods

[0044] (1) Cell line: The human metastatic breast cancer cell line MDA-MB-231 (Shanghai Jikai Biotechnology) was cultured in DMEM / F12 medium (Gibco) containing 10% fetal bovine serum (Gibco) and 1% penicillin / streptomycin at 37°C and 5% CO2.

[0045] (2) Primers: Primers used to identify the PCR amplification products of the human PRMT2 recombinant plasmid were designed and synthesized by Shanghai Jikai Biotechnology, and primers used to detect the mRNA of the human PRMT2 gene and the internal reference GAPDH were designed and synthesized by Shanghai Sangon Biotech.

[0046] (3) Antibodies: The antibody used to detect the protein encoded by the human PRMT2 gene was purchased from Santa Cruz, and the antibody and secondary antibody for the internal control protein actin were purchased from CST.

[0047] 2. Vector construction and lentivirus packaging

[0048] Using the human PRMT2 gene as a template, interference targets and shRNAs were designed. The shRNA interference sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2. BamHI and XbaI restriction endonuclease sites were added to both ends to synthesize single-stranded DNA oligos and prepare double-stranded DNA oligos. The GV640 vector (Shanghai Jikai Company) was linearized using BamHI / XbaI restriction enzymes. The DNA oligos were ligated into the linearized GV640 overexpression vector, transformed, and plated for culture. Positive clones were selected and identified by PCR. The correctly sequenced bacterial cultures were amplified, and plasmids were extracted. The quality-tested plasmids and viral packaging helper plasmids (Helper 1.0 and Helper 2.0) were co-transfected into 293T cells. After culturing for 48–72 h, the virus was harvested (i.e., the unpurified cell supernatant). Impurities were removed by centrifugation, and lentivirus was obtained through concentration and purification.

[0049] 3. Lentiviral infection of MDA-MB-231 cells and verification of infection efficiency:

[0050] When the MDA-MB-231 cell density was approximately 30%, interfering lentiviruses PRMT2-KD1, PRMT2-KD2, and a negative control virus (empty vector virus, denoted as NC) were added at an MOI of 10. The medium was changed 24 hours after cell infection, with uninfected cells serving as the control. Cells were collected after 72 hours, and proteins and RNA were extracted. The RNA was then converted to cDNA. PRMT2 expression levels were detected by Western blotting and RT-qPCR. The primer sequences for PRMT2 and GAPDH are shown in Table 1.

[0051] Table 1

[0052] Gene name Upstream primer sequence Downstream primer sequence size GAPDH TGACTTCAACAGCGACACCCA CACCCTGTTGCTGTAGCCAAA 121bp PRMT2 CGTGCGAGCTAAGGTGGTGATG TGAGCATGTGCGATGGACCAAC 106bp

[0053] The results are as follows Figure 1 As shown, lentivirus was used to infect MDA-MB-231 cells, and the protein and mRNA levels of PRMT2 in the cells were detected by Western blotting and RT-qPCR, respectively. Compared with the control group, the NC group did not affect the expression of PRMT2 in MDA-MB-231 cells, while the mRNA and protein levels of PRMT2 in the PRMT2-KD1 and PRMT2-KD2 groups were significantly decreased, indicating that PRMT2-KD1 and PRMT2-KD2 can significantly downregulate the expression of the PRMT2 gene in triple-negative breast cancer cells.

[0054] Example 2: Study on the mechanism by which PRMT2-interfering lentivirus inhibits the migration, invasion, and aerobic glycolysis of triple-negative breast cancer cells.

[0055] (1) Effects of lentiviruses on cell migration and invasion, glucose and lactate content

[0056] MDA-MB-231 cells were infected with lentiviruses PRMT2-KD1 and PRMT2-KD2, respectively. Uninfected cells served as the control group, and cells infected with the negative control virus served as the negative control group (NC). Cell migration and invasion, wound healing, glucose and lactate levels were measured. The specific steps are as follows:

[0057] Migration assay: 48 hours after lentiviral infection of MDA-MB-231 cells, the cells were digested and centrifuged. The cells were resuspended in serum-free medium, mixed, and counted at 1.5 × 10⁶ cells per well. 5 Cells were seeded in Transwell chambers, with culture medium containing 10% fetal bovine serum added to the lower chamber. After 48 hours of culture, the chambers were removed, cells were fixed, and Giemsa staining was used to photograph and record migrating cells.

[0058] Invasion assay: Dilute Matrigel (Sigma) 1:5 and coat the upper surface of the bottom membrane of the Transwell chamber. Incubate on ice for 30 minutes to allow solidification. Prepare cell suspension according to the "Migration Assay" procedure and seed 1.5 × 10⁶ cells. 5 Cells were counted in Matrigel-coated Transwell chambers. After 48 hours, cells were fixed, stained, and photographed.

[0059] Scratch assay: MDA-MB-231 cells were seeded in 6-well plates. After infecting the cells with lentivirus for 72 hours, horizontal lines were evenly drawn across the wells. The scratches were photographed and recorded after 0, 24, and 36 hours of culture.

[0060] Glucose content detection: Glucose consumption detection: Collect cell culture supernatant, prepare the working system according to the instructions, incubate at 37℃ for 10 min, and detect the absorbance at 490nm wavelength. Calculate the glucose content using the following formula.

[0061] Sample glucose concentration (mmol / L) = (sample tube absorbance (A)) / (calibration tube absorbance (A)) × calibration solution concentration;

[0062] Glucose consumption per group (mmol / L) = Value measured in simple culture medium - Value measured in each group

[0063] Lactic acid content detection: Lactic acid production content detection: Collect cell culture supernatant, prepare the working system according to the instructions of the lactic acid assay kit (Nanjing Jiancheng Biotechnology), detect the absorbance value at a wavelength of 530nm, and calculate the lactic acid content according to the following formula.

[0064] Sample lactate content (mmol / L) = (Measured OD - Blank OD) / (Standard OD - Blank OD) × Standard concentration × Sample dilution factor before testing

[0065] The results of the invasion, migration and scratch tests showed that ( Figure 2 and Figure 3 Compared with the Control and NC groups, the PRMT2-KD1 and PRMT2-KD2 groups showed significantly reduced cell crossing of the Transwell chamber bottom membrane and decreased wound healing ability, indicating that low PRMT2 expression can significantly inhibit the migration and invasion of triple-negative breast cancer cells. Glucose and lactate consumption were also observed. Figure 4 As shown, compared with the Control group and the NC group, the glucose consumption and lactate production of the PRMT2-KD1 and PRMT2-KD2 groups decreased, indicating that low expression of PRMT2 can significantly inhibit the aerobic glycolysis process of triple-negative breast cancer cells.

[0066] (2) Exploring its mechanism using the glycolysis inhibitor 2-DG.

[0067] MDA-MB-231 cells were seeded in 6-well plates to a density of approximately 60%–70%. After adherence, the cells were transfected with the PRMT2 overexpression plasmid (PRMT2-OE) and the pcDNA3.1(+) control plasmid (both purchased from Shanghai Jikai Biotechnology) according to the Lipofectamine 2000 (Invitrogen) instructions. The medium was changed after 6 hours, with untransfected cells serving as a control. Cells were harvested after 48 hours of culture for later use. Migration, invasion, and scratch assays were performed as described above.

[0068] Migration, invasion (e.g.) Figure 5 (as shown) and scratches (as shown) Figure 6 As shown in the experimental results, compared with the Control group and the pcDNA3.1(+) group, the PRMT2 high expression (PRMT2-OE) group had a significantly increased number of cells that crossed the Transwell chamber and enhanced wound healing ability. Compared with the PRMT2-OE group, after treatment with 2mM 2-DG, the number of cells that crossed the Transwell chamber in the PRMT2-OE+2DG group was significantly reduced, and the wound healing ability was decreased. These results indicate that PRMT2 high expression can promote the migration and invasion of triple-negative breast cancer cells, and the glycolysis inhibitor 2-DG can reverse the effect of PRMT2 high expression on the migration and invasion of triple-negative breast cancer cells.

[0069] Example 3: PRMT2-interfering lentivirus inhibits lung metastasis in triple-negative breast cancer

[0070] Experimental animals: 5-week-old female BALB / c nude mice (Shanghai Lingchang Biotechnology).

[0071] Cell line: Human metastatic breast cancer cell line MDA-MB-231 (Shanghai Jikai Biotechnology).

[0072] MDA-MB-231 cells were infected with lentiviruses PRMT2-KD1, PRMT2-KD2, and a negative control virus, respectively. After 72 hours, puromycin was added for selection, and after passage, puromycin was added again for selection until a stable cell line was successfully constructed.

[0073] Negative control cells in the logarithmic growth phase and stable cell lines with low PRMT2 expression were prepared into cell suspensions. Cells were inoculated via tail vein injection, with each mouse receiving 100 μL of cell suspension (containing 2 × 10⁻⁶ cells). 6 (cells). Body weight was measured weekly. After 49 days, mice were anesthetized by intraperitoneal injection of D-Luciferin (15 mg / mL) at a dose of 10 μL / g, followed by intraperitoneal injection of 2% sodium pentobarbital 15 minutes later. Imaging was performed using a Lumina LT in vivo imaging system (Perkin Elmer) to detect and record the total amount of fluorescent expression in the mice. The mice were euthanized by an overdose of 2% sodium pentobarbital, the peritoneum was opened, lung tissue was dissected, the number of tumor nodules on the lung tissue was recorded, and photographs were taken. The lung tissue was collected, fixed, and stained with hematoxylin and eosin (HE).

[0074] like Figure 7 As shown, compared with the NC group (injected with a negative control virus-stable cell line), there was no significant change in body weight in the PRMT2-KD1 and PRMT2-KD2 groups, but the number of tumor nodules in the lung tissue of the PRMT2-KD1 and PRMT2-KD2 groups was significantly reduced; in vivo imaging data showed a significant decrease in total fluorescence expression in the PRMT2-KD1 and PRMT2-KD2 groups. These results indicate that low expression of PRMT2 can inhibit the metastatic ability of triple-negative breast cancer.

[0075] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. shRNA, whose nucleotide sequence is shown in SEQ ID NO.

1.

2. A recombinant vector comprising a vector backbone and the shRNA as described in claim 1.

3. A PRMT2 interfering lentivirus, wherein the PRMT2 interfering lentivirus comprises the shRNA of claim 1 and / or the recombinant vector of claim 2.

4. Tool cells, characterized in that, The tool cells are those transformed or transfected with the PRMT2 interfering lentivirus of claim 3.

5. A method for preparing interfering lentivirus, wherein the interfering lentivirus described in claim 3 is used to infect cells, and then the interfering lentivirus is collected.

6. The use of any one of the following (I) to (IV) in the preparation of a drug for treating triple-negative breast cancer: I) The shRNA as described in claim 1; II) The recombinant vector according to claim 2; III) The PRMT2 interference lentivirus as described in claim 3; IV) The tool cell as described in claim 4.

7. The application according to claim 6, characterized in that, The treatment includes inhibiting the metastasis of breast cancer cells and / or inhibiting the invasion of breast cancer cells.

8. A drug for treating triple-negative breast cancer, comprising any one of the following i) to iv): i) The shRNA according to claim 1; ii) The recombinant vector as described in claim 2; iii) The PRMT2 interference lentivirus as described in claim 3; iv) The tool cell as described in claim 4.

9. The medicament according to claim 8, characterized in that, Liposomes containing the recombinant vector of claim 2.

Images