Compositions for detecting gastric cancer and their uses

This invention provides a composition and kit by detecting the methylation status of ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12 genes, which solves the problems of insufficient sensitivity and specificity in gastric cancer detection in the prior art, and realizes efficient detection and diagnosis of early gastric cancer.

CN116287268BActive Publication Date: 2026-06-30BIOCHAIN BEIJING SCI & TECH

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
BIOCHAIN BEIJING SCI & TECH
Filing Date
2023-03-14
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Current technologies lack highly sensitive and specific methods for detecting gastric cancer gene methylation, resulting in a low early diagnosis rate of gastric cancer, which affects treatment outcomes and patient survival rates.

Method used

A composition and kit are provided, comprising nucleic acid probes and primers for detecting the methylation status of ARL10, EGR3, ST8SIA4, BCAT1, THBD and KCNJ12 genes, enabling in vitro detection of gastric cancer through DNA polymerization and bisulfite treatment.

Benefits of technology

It can detect gastric cancer sensitively and specifically, improve the early diagnosis rate of gastric cancer, reduce the harm of invasive testing, and has important clinical application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004128383490000191
    Figure BDA0004128383490000191
  • Figure BDA0004128383490000201
    Figure BDA0004128383490000201
  • Figure BDA0004128383490000211
    Figure BDA0004128383490000211
Patent Text Reader

Abstract

This application provides a composition for detecting gastric cancer and its use therein. The composition comprises a nucleic acid for detecting the methylation status of a target gene, wherein the target gene is selected from one or more of ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12. This application also provides a kit comprising the composition, and its use in preparing a kit for in vitro detection of gastric cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of molecular biology and relates to gene detection, specifically to a nucleic acid composition for detecting methylation of gastric cancer-related genes, as well as the corresponding kit and its uses. Background Technology

[0002] Stomach cancer is a highly malignant cancer. A significant factor contributing to its high mortality rate is the low rate of early-stage diagnosis. The cure rate for early-stage stomach cancer is far higher than that for mid-to-late-stage cancer; however, due to the lack of obvious and specific symptoms in early-stage stomach cancer, most patients are diagnosed at an advanced stage. Clinical studies have found that the process from the formation of a lesion to the appearance of clinical symptoms takes an average of several years; this provides an effective window for detecting early-stage stomach cancer and improving its diagnostic rate. Fully utilizing this window can potentially improve the effectiveness of stomach cancer treatment and reduce its mortality rate.

[0003] Recent studies have shown that epigenetics plays a crucial role in the occurrence and development of cancer. As an important mechanism of epigenetics, the regulation of DNA methylation in various cancers has been extensively studied. Research data shows that the regulation of gene methylation is related to biological mechanisms such as chromatin structure and gene expression regulation; changes in cellular gene methylation occur in the early stages of tumor formation and continue throughout the occurrence and development of cancer; and the methylation of tumor suppressor genes is a key molecular mechanism for the transformation of precancerous lesions into malignant tumor cells. However, there is currently a lack of detection technologies, methods, and products specifically for detecting methylation genes in gastric cancer. Therefore, there is a current demand for methylation gene markers with high sensitivity and specificity for gastric cancer detection. Summary of the Invention

[0004] In view of the problems existing in the current gastric cancer detection, the purpose of this application is to provide a composition, a kit for in vitro detection of gastric cancer, the use thereof, a method for performing the detection based on the kit, and the use for detecting gastric cancer.

[0005] The specific technical solution of this application is as follows:

[0006] 1. A composition for in vitro detection of gastric cancer, the composition comprising:

[0007] Nucleic acid used to detect the methylation status of a target gene.

[0008] The methylation status of the target gene is characterized by the methylation of the target sequence of the target gene.

[0009] The target gene is selected from any one or more of the following genes:

[0010] ARL10, EGR3, ST8SIA4, BCATl, THBD, KCNJ12.

[0011] 2. The composition according to claim 1, wherein the target sequence of the ARL10 gene is shown in SEQ ID NO: 19.

[0012] 3. The composition according to claim 1, wherein the target sequence of the EGR3 gene is shown in SEQ ID NO: 20.

[0013] 4. The composition according to claim 1, wherein the target sequence of the ST8SIA4 gene is shown in SEQ ID NO: 21.

[0014] 5. The composition according to claim 1, wherein the target sequence of the BCAT1 gene is shown in SEQ ID NO: 22.

[0015] 6. The composition according to claim 1, wherein the target sequence of the THBD gene is shown in SEQ ID NO: 23.

[0016] 7. The composition according to claim 1, wherein the target sequence of the KCNJ12 gene is shown in SEQ ID NO: 24.

[0017] 8. The composition according to any one of claims 1 to 7, wherein the nucleic acid for detecting the methylation status of the target gene comprises:

[0018] Primers, wherein the primers are fragments of at least 9 nucleotides from the target sequence of the target gene.

[0019] The fragment contains at least one CpG dinucleotide sequence.

[0020] 9. The composition according to any one of claims 1 to 8, wherein the nucleic acid for detecting the methylation status of the target gene comprises:

[0021] The probe is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderately or strictly controlled conditions.

[0022] The fragment contains at least one CpG dinucleotide sequence.

[0023] 10. The composition according to any one of claims 1 to 9, further comprising:

[0024] A reagent that converts the unmethylated cytosine base at carbon 5 of the target sequence of a target gene into uracil.

[0025] 11. The composition according to any one of claims 1 to 10, wherein the nucleic acid for detecting the methylation status of the target gene further comprises:

[0026] Blockers that preferentially bind to target sequences in an unmethylated state.

[0027] 12. The composition according to claim 11, wherein,

[0028] The fragment of at least 9 nucleotides is a sequence of SEQ ID NO: 1 and SEQ ID NO: 2, or a sequence of SEQ ID NO: 4 and SEQ ID NO: 5, or a sequence of SEQ ID NO: 7 and SEQ ID NO: 8, or a sequence of SEQ ID NO: 10 and SEQ ID NO: 11, or a sequence of SEQ ID NO: 13 and SEQ ID NO: 14, or a sequence of SEQ ID NO: 16 and SEQ ID NO: 17;

[0029] The fragment of at least 15 nucleotides is the sequence of SEQ ID NO: 3, or the sequence of SEQ ID NO: 6, or the sequence of SEQ ID NO: 9, or the sequence of SEQ ID NO: 12, or the sequence of SEQ ID NO: 15, or the sequence of SEQ ID NO: 18.

[0030] 13. An oligonucleotide for in vitro detection of gastric cancer, comprising:

[0031] The fragment comprises at least nine nucleotides of any one or more of SEQ ID NO: 19 to SEQ ID NO: 24 or their complementary sequences, and includes at least one CpG dinucleotide sequence.

[0032] 14. The oligonucleotide according to claim 13, further comprising:

[0033] A fragment comprising at least 15 nucleotides hybridized to any one or more of SEQ ID NO: 19 to SEQ ID NO: 24 or their complementary sequences under moderately or strictly controlled conditions, and containing at least one CpG dinucleotide sequence.

[0034] 15. The oligonucleotide according to claim 13, further comprising:

[0035] Blockers that preferentially bind to target sequences in an unmethylated state.

[0036] 16. An oligonucleotide for in vitro detection of gastric cancer, comprising:

[0037] The sequences of SEQ ID NO: 1 and SEQ ID NO: 2.

[0038] 17. The oligonucleotide according to claim 16, further comprising:

[0039] The sequence of SEQ ID NO: 3.

[0040] 18. An oligonucleotide for in vitro detection of gastric cancer, comprising:

[0041] The sequences of SEQ ID NO:4 and SEQ ID NO:5.

[0042] 19. The oligonucleotide according to claim 18, further comprising:

[0043] The sequence of SEQ ID NO: 6.

[0044] 20. An oligonucleotide for in vitro detection of gastric cancer, comprising:

[0045] The sequences of SEQ ID NO: 7 and SEQ ID NO: 8.

[0046] 21. The oligonucleotide according to claim 20, further comprising:

[0047] The sequence of SEQ ID NO: 9.

[0048] 22. An oligonucleotide for in vitro detection of gastric cancer, comprising:

[0049] The sequences of SEQ ID NO: 10 and SEQ ID NO: 11.

[0050] 23. The oligonucleotide according to item 22, further comprising:

[0051] The sequence of SEQ ID NO: 12.

[0052] 24. An oligonucleotide for in vitro detection of gastric cancer, comprising:

[0053] The sequences of SEQ ID NO: 13 and SEQ ID NO: 14.

[0054] 25. The oligonucleotide according to claim 24, further comprising:

[0055] The sequence of SEQ ID NO: 15.

[0056] 26. An oligonucleotide for in vitro detection of gastric cancer, comprising:

[0057] The sequences of SEQ ID NO: 16 and SEQ ID NO: 17.

[0058] 27. The oligonucleotide according to claim 26, further comprising:

[0059] The sequence of SEQ ID NO: 18.

[0060] 28. Use of any one or more of the ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12 genes in the preparation of a kit for the in vitro detection of gastric cancer.

[0061] 29. A kit comprising the composition of any one of items 1 to 12 or the oligonucleotide of any one of items 13 to 27.

[0062] 30. The kit according to claim 29, further comprising at least one other component selected from:

[0063] Nucleoside triphosphate, DNA polymerase, and buffer solution required for the function of the DNA polymerase.

[0064] 31. The kit according to item 29 or 30, further comprising: instructions for use.

[0065] 32. Use of the composition according to any one of items 1 to 12 or the oligonucleotide according to any one of items 13 to 27 in the preparation of a kit for in vitro detection of gastric cancer.

[0066] 33. The use according to item 28 or 32, wherein the kit for in vitro detection of gastric cancer detects gastric cancer by means of a method comprising the following steps:

[0067] 1) Isolate DNA samples containing the target sequence or fragments of the target gene from the biological sample to be tested;

[0068] 2) Determine the methylation status of the target sequence of the target gene;

[0069] 3) The state of the biological sample is determined by the detection results of the methylation status of the target sequence of the target gene, thereby realizing the in vitro detection of gastric cancer.

[0070] 34. The use according to item 33, wherein the method comprises the following steps:

[0071] Extract genomic DNA from the biological sample to be tested;

[0072] The extracted genomic DNA was treated with a reagent to convert the unmethylated cytosine base at carbon 5 into uracil or other bases.

[0073] The reagent-treated DNA sample is contacted with DNA polymerase and primers containing the target sequence of the target gene to carry out a DNA polymerization reaction;

[0074] Detection of amplification products using probes; and

[0075] Based on the presence or absence of the amplification product, the methylation status of at least one CpG dinucleotide of the target sequence of the target gene is determined.

[0076] 35. The use according to item 34, wherein the reagent is a bisulfite reagent.

[0077] 36. A method for detecting gastric cancer, comprising the following steps:

[0078] Isolate DNA samples containing the target sequence or fragments of the target gene from biological samples to be tested;

[0079] Determine the methylation status of the target sequence of the target gene; and

[0080] The state of a biological sample is determined by detecting the methylation status of the target sequence of the target gene, thereby enabling in vitro detection of gastric cancer.

[0081] 37. A method for detecting gastric cancer, comprising the following steps:

[0082] Extract genomic DNA from the biological sample to be tested;

[0083] The extracted genomic DNA was treated with a reagent to convert the unmethylated cytosine base at carbon 5 into uracil or other bases.

[0084] The reagent-treated DNA sample is contacted with DNA polymerase and primers containing the target sequence of the target gene to carry out a DNA polymerization reaction;

[0085] Detection of amplification products using probes; and

[0086] Based on the presence or absence of the amplification product, the methylation status of at least one CpG dinucleotide of the target sequence of the target gene is determined.

[0087] 38. The method according to item 36 or 37, wherein,

[0088] The target gene is any one or more of the following genes: ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12.

[0089] 39. The method according to item 38, wherein the target sequence of the ARL10 gene is shown in SEQ ID NO: 19.

[0090] 40. The method according to item 38, wherein the target sequence of the EGR3 gene is shown in SEQ ID NO: 20.

[0091] 41. The method according to item 38, wherein the target sequence of the ST8SIA4 gene is shown in SEQ ID NO: 21.

[0092] 42. The method according to item 38, wherein the target sequence of the BCAT1 gene is shown in SEQ ID NO: 22.

[0093] 43. The method according to item 38, wherein the target sequence of the THBD gene is shown in SEQ ID NO: 23.

[0094] 44. The method according to item 38, wherein the target sequence of the KCNJ12 gene is shown in SEQ ID NO: 24.

[0095] 45. The method according to item 37, wherein the reagent is a bisulfite reagent.

[0096] 46. ​​The method according to item 38, wherein the primer is:

[0097] The fragment comprises at least nine nucleotides of any one or more of SEQ ID NO: 19 to SEQ ID NO: 24 or their complementary sequences, and includes at least one CpG dinucleotide sequence.

[0098] 47. The method according to item 38, wherein the probe is:

[0099] A fragment comprising at least 15 nucleotides hybridized to any one or more of SEQ ID NO: 19 to SEQ ID NO: 24 or their complementary sequences under moderately or strictly controlled conditions, and containing at least one CpG dinucleotide sequence.

[0100] 48. The method according to item 38, wherein the primer is a sequence of SEQ ID NO: 1 and SEQ ID NO: 2, or a sequence of SEQ ID NO: 4 and SEQ ID NO: 5, or a sequence of SEQ ID NO: 7 and SEQ ID NO: 8, or a sequence of SEQ ID NO: 10 and SEQ ID NO: 11, or a sequence of SEQ ID NO: 13 and SEQ ID NO: 14, or a sequence of SEQ ID NO: 16 and SEQ ID NO: 17.

[0101] 49. The method according to item 38, wherein the probe is the sequence of SEQ ID NO: 3, or the sequence of SEQ ID NO: 6, or the sequence of SEQ ID NO: 9, or the sequence of SEQ ID NO: 12, or the sequence of SEQ ID NO: 15, or the sequence of SEQ ID NO: 18.

[0102] This application has the following beneficial effects:

[0103] By detecting methylation target sequences in ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12, the methylation status can be sensitively and specifically detected, thus enabling the detection of cell-free DNA in gastric tissue and peripheral blood. Detection of gastric tissue and peripheral blood samples from gastric cancer patients and healthy controls shows that the composition and detection method described in this application can sensitively and specifically detect gastric cancer, ensuring the accuracy and reliability of the detection results. Therefore, this application provides a composition and detection method for in vitro detection of gastric cancer, which has significant clinical application value.

[0104] Other features and advantages of this application will be described in detail in the following specific description and claims.

[0105] The effects of the invention

[0106] This application utilizes epigenomics and bioinformatics techniques to analyze genomic methylation data of gastric cancer, identify multiple methylation genes associated with gastric cancer, and determine the target sequences for abnormal methylation of gastric cancer methylation genes. Furthermore, by using the target sequences of these methylation genes, the methylation status of the genes can be detected sensitively and specifically, thereby enabling the detection of cell-free DNA in gastric tissue and peripheral blood.

[0107] The composition described in this application enables non-invasive screening of asymptomatic individuals, reducing the harm caused by invasive testing. The composition has higher sensitivity and accuracy, and can achieve real-time monitoring. Detailed Implementation

[0108] The present application will now be described in detail. While specific embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0109] Unless otherwise stated, the implementation of this application will employ conventional molecular biology (including recombinant technology), microbiology, cell biology, biochemistry, and genetics techniques, all of which fall within the scope of conventional techniques in the art. Such techniques are described in detail in the literature, such as *Molecular Cloning: A Laboratory Manual, 2nd Edition* (Sambrook et al., 1989); *Oligonucleotide Synthesis* (MJ Gait, 1984); *Animal Cell Culture* (RI Freshney, 1987); *Methods in Enzymology* (American Academic Publishing Co., Ltd.); *Current Protocols in Molecular Biology* (FMAusubel et al., 1987, and regularly updated); and *PCR: The Polymerase Chain Reaction* (Mullis et al., 1994). The primers, probes, blocking agents, and kits used in this application can be prepared using standard techniques known in the art.

[0110] Unless otherwise defined, the technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0111] definition

[0112] In this application, "precancerous" refers to cells that are in the early stages of transforming into cancer cells or that are prone to transforming into cancer cells. Such cells may exhibit one or more phenotypic traits characteristic of cancer cells.

[0113] In this application, "stringent hybridization conditions" and "highly stringent" refer to the conditions under which the probe hybridizes with its target sequence, typically in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and vary under different environments. Longer sequences hybridize specifically at higher temperatures. Detailed guidance on nucleic acid hybridization can be found in Tijssen, Biochemistry and Molecular Biology Techniques – Nucleic Acid Probe Hybridization, “A Review of Hybridization Principles and Nucleic Acid Assay Strategies.” Typically, stringent conditions are approximately 5-10°C below the melting point (Tm) of the specific nucleic acid at a defined ionic strength and pH. At Tm (at the defined ionic strength, pH, and nucleic acid concentration), 50% of the probe complementary to the target sequence hybridizes uniformly with the target sequence. Stringent conditions can also be achieved by adding a destabilizing agent. For selective or specific hybridization, the positive signal is twice, preferably ten times, the background hybridization. Exemplary stringent hybridization conditions are as follows: hybridization at 42°C in a solution of 50% formamide, 5x SSC and 1% SDS, or hybridization at 65°C in a solution of 5x SSC and 1% SDS, followed by washing at 65°C in a solution of 0.2x SSC and 0.1% SDS.

[0114] Furthermore, if the peptides encoded by the nucleic acids are substantially similar, the nucleic acids that cannot hybridize under stringent conditions are still substantially similar. In this case, typically, the nucleic acids are hybridized under moderately stringent hybridization conditions. As an example, “moderately stringent hybridization conditions” include hybridization at 37°C in a solution of 40% formamide, 1M sodium chloride, and 1% SDS, followed by washing at 45°C in a solution of 1xSSC. Those skilled in the art will readily obtain guidance in the prior art for achieving conditions with the same stringency. For PCR, temperatures around 36°C are typically suitable for low-stringency amplification, while annealing temperatures range from 32°C to 48°C depending on primer length. For highly stringent PCR amplification, it is generally at 62°C, while annealing temperatures for highly stringent hybridization range from 50°C to 65°C depending on primer length and specificity. Typical cycling conditions for both high-strict and low-strict amplification include: a sustained denaturation phase of 30 seconds to 2 minutes at 90–95°C, a sustained annealing phase of 30 seconds to 2 minutes, and a sustained expansion phase of 1 to 2 minutes at approximately 72°C. Tools and instructions for low- and high-strict amplification reactions are available in the prior art.

[0115] In this application, "oligonucleotide" refers to a molecule composed of two or more nucleotides, preferably three or more nucleotides. Its precise size can depend on many factors, which in turn are determined by the final function and use of the oligonucleotide. In some embodiments, the oligonucleotide may comprise a length of 10 to 100 nucleotides. In some embodiments, the oligonucleotide may comprise a length of 10 to 30 nucleotides, or may have a length of 20 or 25 nucleotides. In some specific embodiments, oligonucleotides shorter than these lengths are also suitable.

[0116] In this application, "primer" refers to an oligonucleotide that, when placed under conditions that induce the synthesis of a primer extension complementary to a nucleic acid strand—namely, in the presence of nucleotides and an inducer such as a DNA or RNA polymerase and at suitable temperature and pH—can serve as a starting point for synthesis, whether it is naturally occurring in purified restriction digests or synthetically produced. Primers can be single-stranded or double-stranded and must be long enough to initiate the synthesis of the desired extension in the presence of an inducer. The exact length of a primer depends on a variety of factors, including temperature, primer source, and the method used. For example, for diagnostic and prognostic applications, oligonucleotide primers typically contain at least or more than about 9, 10, 15, 20, or 25 or more nucleotides, depending on the complexity of the target sequence, but they may contain fewer or more nucleotides. Factors involved in determining the appropriate primer length are well known to those skilled in the art.

[0117] In this application, "primer pair" refers to a primer pair that hybridizes with the opposite strand of the target DNA molecule or with a target DNA region flanking the nucleotide sequence to be amplified.

[0118] In this application, "primer site" refers to the region of the target DNA or other nucleic acid to which the primer hybridizes.

[0119] In this application, the term "probe," when referring to a nucleic acid sequence, is used in its usual sense to mean a selected nucleic acid sequence that can hybridize with a target sequence under specified conditions and can be used to detect the presence of the target sequence. Those skilled in the art will understand that, in certain circumstances, a probe can also be used as a primer, and a primer can be used as a probe.

[0120] In this application, "DNA methylation" refers to the addition of a methyl group to the 5th position of cytosine (C), which is typically (but not necessarily) in the case of a CpG (cytosine followed by guanine) dinucleotide. As used herein, "increased degree of methylation" or "significant degree of methylation" refers to the presence of at least one methylated cytosine nucleotide in a DNA sequence, wherein the corresponding C in a normal control sample (e.g., a DNA sample extracted from a non-cancer cell or tissue sample, or a DNA sample treated for methylation of DNA residues) is unmethylated. In some embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more Cs may be methylated, wherein the Cs at these positions in the control DNA sample are unmethylated.

[0121] In the implementation scheme, a variety of different methods can be used to detect DNA methylation alterations. Methods for detecting DNA methylation include, for example, methylation-sensitive restriction endonuclease (MSRE) assays using Southern or polymerase chain reaction (PCR) analysis, methylation-specific or methylation-sensitive PCR (MS-PCR), methylation-sensitive single nucleotide primer extension (Ms-SnuPE), high-resolution melting (HRM) analysis, bisulfite sequencing, pyrosequencing, methylation-specific single-strand conformation analysis (MS-SSCA), combined bisulfite restriction analysis (COBRA), methylation-specific denaturing gradient gel electrophoresis (MS-DGGE), methylation-specific melting curve analysis (MS-MCA), methylation-specific denaturing high-performance liquid chromatography (MS-DHPLC), and methylation-specific microarrays (MSO). These assays can be PCR analysis, quantitative analysis using fluorescent labels, or Southern blot analysis.

[0122] In this application, "methylation assay" refers to any assay that determines the methylation status of one or more CpG dinucleotide sequences within a DNA sequence.

[0123] In this application, "detection" refers to any process of observing a biomarker or biomarker alteration (e.g., a change in the methylation state of a biomarker or the expression level of a nucleic acid or protein sequence) in a biological sample, regardless of whether the biomarker or biomarker alteration is actually detected. In other words, the act of detecting a biomarker or biomarker alteration in a sample is "detection," even if the biomarker is determined to be absent or below a sensitivity level. Detection can be a quantitative, semi-quantitative, or non-quantitative observation and can be based on comparison with one or more control samples. It should be understood that detecting gastric cancer as disclosed herein includes detecting precancerous cells that have begun to develop into gastric cancer cells or are about to develop into gastric cancer cells, or have an increased tendency to develop into gastric cancer cells. Detection of gastric cancer may also include detecting the probability of possible death or the possible prognosis of a disease condition.

[0124] In this application, "homology," "identity," and "similarity" refer to the sequence similarity between two nucleic acid molecules. Homology, identity, or similarity can be determined by comparing positions in each sequence, and the sequences can be aligned for comparison purposes. When equivalent positions in the compared sequences are occupied by the same bases, the molecules are identical at that position; when equivalent sites are occupied by the same or similar amino acid residues (e.g., similar in spatial or electrical properties), the molecules can be considered homologous (similar) at that position. The expression of homology / similarity or identity percentage refers to the number of identical or similar amino acids at shared positions in the compared sequences. "Irrelevant" or "non-homologous" sequences share less than 40% identity with the sequences of this application, preferably less than 25%. The absence or presence of extra residues (amino acids or nucleic acids) also reduces identity and homology / similarity when comparing two sequences. In specific implementations, for two or more sequences or subsequences, determined by using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below, or by manual alignment and visual inspection provided online, for example, by the National Center for Biotechnology Information (NCBI), if their sequences exhibit approximately 60% identity in the specified region, or approximately 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher, when compared and aligned for maximum correspondence within a comparison window or specified region, they can be considered substantially or significantly homologous, similar, or identical. This definition also relates to or can be used to test sequence complements. Therefore, to the extent permitted by the context of this paper, for example, if a nucleotide sequence can be predicted to be naturally present in a DNA duplex, or can be naturally present as one or both of the complementary strands, then a nucleotide sequence complementary to the specified target sequence or a variant thereof is itself considered "similar" to the target sequence, and when "similar" nucleic acid sequences are involved, this includes single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences capable of encoding the same or similar polypeptide products, and any permissible variants of any of the foregoing. Similarity must be limited to analyses of single nucleic acid strand sequences, which may include, for example, the detection and quantification of the expression of a specific RNA sequence or coding sequence in a cell. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions.In the implementation scheme, identity or similarity may be in regions of at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23, 24, 25 or more nucleotides, or in regions of more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or more nucleotides.

[0125] In this application, "amplification" refers to the process of obtaining multiple copies of a nucleic acid from a specific locus, such as genomic DNA or cDNA. Amplification can be achieved using any of a variety of known methods, including but not limited to polymerase chain reaction (PCR), transcription-based amplification, and strand displacement amplification (SDA).

[0126] This application's "fluorescence-based real-time PCR" describes a method that involves adding a fluorescent group to the PCR reaction system, using the accumulation of fluorescence signals to monitor the entire PCR process in real time, and finally performing quantitative analysis of unknown templates using a standard curve. A crucial concept in this PCR technique is the cycle threshold, also known as the Ct value. C stands for Cycle, and t stands for threshold. The Ct value represents the number of cycles required for the fluorescence signal in each reaction tube to reach a set threshold. For example, the fluorescence threshold can be set as follows: the fluorescence signal from the first 15 cycles of the PCR reaction is used as the fluorescence background signal, and the default setting for the fluorescence threshold is 10 times the standard deviation of the fluorescence signal from 3 to 15 cycles.

[0127] The "cut-off value" of real-time PCR in this application refers to a critical Ct value for determining the positivity or positivity of a sample for a specific biomarker. According to certain specific real-time methods in this application, "the critical Ct value (Cut-off value) is obtained based on a certain number of sample data and statistical processing," and this critical Ct value can vary depending on the required sensitivity or specificity.

[0128] In this application, "sensitivity" refers to the proportion of cancer detected in a certain cancer sample, and its calculation formula is: Sensitivity = (detected cancers / all cancers), while "specificity" refers to the proportion of normal samples detected in a certain normal sample, and its calculation formula is: Specificity = (detected negatives / total negatives).

[0129] The “label” or “detectable part” in this application refers to a component that can be detected by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., enzymes commonly used in ELISA), biotin, digoxigenin, or haptens, and proteins that can be prepared as detectable proteins, for example, by incorporating radiolabels into peptides or antibodies for detecting peptide-specific reactions.

[0130] Nucleic acid molecules can be detected using a variety of different methods. Nucleic acid detection methods include, for example, PCR and nucleic acid hybridization (e.g., Southern blotting, Northern blotting, or in situ hybridization). Specifically, oligonucleotides capable of amplifying target nucleic acids (e.g., oligonucleotide primers) can be used in PCR reactions. PCR methods typically include the following steps: obtaining a sample, isolating nucleic acids (e.g., DNA, RNA, or both) from the sample, and contacting the nucleic acids with one or more oligonucleotide primers that specifically hybridize with the template nucleic acid under conditions that allow amplification of the template nucleic acid to occur. In the presence of the template nucleic acid, an amplification product is generated. The conditions for nucleic acid amplification and detection of the amplification product are known to those skilled in the art. Various improvements to basic PCR techniques have been developed, including but not limited to anchored PCR, RACE PCR, RT-PCR, and ligase chain reaction (LCR). In the amplification reaction, the primer pair must anneal to the opposite strands of the template nucleic acid and should be kept at an appropriate distance from each other so that the polymerase can efficiently polymerize across regions and so that the amplification product can be easily detected, for example, by electrophoresis. For example, computer programs such as OLIGO (Molecular Biology Insights Inc., Cascade, Colo.) can be used to design oligonucleotide primers to facilitate the design of primers with similar melting temperatures. Typically, oligonucleotide primers are 9–30, 40, or 50 nucleotides in length (e.g., lengths of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides), but oligonucleotide primers can be longer or shorter, provided appropriate amplification conditions are used.

[0131] Detection of amplification products or hybridization complexes is typically achieved using detectable labels. The term "label," when referring to nucleic acids, is intended to include both direct labeling of nucleic acids by coupling (i.e., physically linking) a detectable substance to the nucleic acid, and indirect labeling of nucleic acids by reacting with another reagent that has directly labeled the detectable substance. Detectable substances include a variety of enzymes, prosthetic groups, fluorescent materials, cryoluminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include avidin / streptin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, luciferin, luciferin isothiocyanate, rhodamine, dichlorotriazineamine luciferin, dansyl chloride, or phycoerythrin; examples of cryoluminescent materials include luminol; and examples of bioluminescent materials include luciferase, insect luciferin, and jellyfish protein. Examples of indirect labeling include end-labeling of nucleic acids with biotin, making the nucleic acid detectable using fluorescently labeled avidin streptavidin.

[0132] Detailed Explanation

[0133] On one hand, this application provides a composition for in vitro detection of gastric cancer, the composition comprising nucleic acid for detecting the methylation state within a target sequence of a target gene, wherein the methylation state of the target gene is characterized by the methylation of the target sequence of the target gene, wherein the target gene is any one or more of ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12.

[0134] This application provides a set of target sequences for genes that emit abnormal methylation in gastric cancer, including target sequences of the ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12 genes. In some embodiments, the target sequences for gastric cancer are sequences of the promoter regions of any one or more of the ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12 genes. In some embodiments, the target sequence for the ARL10 gene is shown in SEQ ID NO: 19, the target sequence for the EGR3 gene is shown in SEQ ID NO: 20, the target sequence for the ST8SIA4 gene is shown in SEQ ID NO: 21, the target sequence for the BCAT1 gene is shown in SEQ ID NO: 22, the target sequence for the THBD gene is shown in SEQ ID NO: 23, and the target sequence for the KCNJ12 gene is shown in SEQ ID NO: 24.

[0135] Those skilled in the art will also understand that the target sequences of the ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12 genes are not limited to the specific sequences listed above. The target sequence of the ARL10 gene should encompass sequences containing one, two, or three or more nucleotide mutations compared to SEQ ID NO: 19, but which are substantially functionally identical, and also sequences having 95%, 96%, 97%, 98%, or 99% sequence identity compared to SEQ ID NO: 19. The target sequence of the EGR3 gene should encompass sequences containing one, two, or three or more nucleotide mutations compared to SEQ ID NO: 20, but which are substantially functionally identical, and also sequences having 95%, 96%, 97%, 98%, or 99% sequence identity compared to SEQ ID NO: 20. The target sequences of the ST8SIA4 gene should include sequences containing one, two, or three or more nucleotide mutations compared to SEQ ID NO: 21, but which are substantially functionally identical, and also include sequences with 95%, 96%, 97%, 98%, or 99% sequence identity compared to SEQ ID NO: 21. The target sequences of the BCAT1 gene should include sequences containing one, two, or three or more nucleotide mutations compared to SEQ ID NO: 22, but which are substantially functionally identical, and also include sequences with 95%, 96%, 97%, 98%, or 99% sequence identity compared to SEQ ID NO: 22. The target sequences of the THBD gene should include sequences containing one, two, or three or more nucleotide mutations compared to SEQ ID NO: 23, but which are substantially functionally identical, and also include sequences with 95%, 96%, 97%, 98%, or 99% sequence identity compared to SEQ ID NO: 23. The target sequence of the KCNJ12 gene should include sequences that contain one, two, or three or more nucleotide mutations compared to SEQ ID NO: 24, but are substantially the same as its functional sequence, and also include sequences that have 95%, 96%, 97%, 98%, or 99% sequence identity compared to SEQ ID NO: 24.

[0136] The target sequence (5'-3') of the ARL10 gene is as follows:

[0137] SEQ ID NO: 19

[0138] CTCTTCATCCTCTGGAAGACCTACTTCGGCCGCGGCCGAGAGCGGCGCTGGGACCGGGGAGAGGCCTGGTGGGGCGCGGAGGCTGCCCGCCTCCCCGAGTGGGACGAGTGGGACGTGAGTGCCGGGCCGAGGCCTGCGGAAGGGCGGGCAGGCTGGGCTGCGACTCCGCGCATGTGGCCAAGGGGTGTGACCACGGAACGGCCCTGCTGGTGCCGGGAGCTTGGGGGGTCGAGGGCTTGGCAGCCGCAGCGCACAGGCCCCGCGCGGGTGGGCGGTCAG

[0139] The sequence of the target sequence of the ARL10 gene after bisulfite treatment (5'-3') is as follows:

[0140] SEQ ID NO: 25

[0141] TTTTTTATTTTTTGGAAGATTTATTTCGGTCGCGGTCGAGAGCGGCGTTGGGATCGGGGAGAGGTTTGGTGGGGCGCGGAGGTTGTTCGTTTTTTCGAGTGGGACGAGTGGGACGTGAGTGTCGGGTCGAGGTTTGCGGAAGGGCGGGTAGGTTGGGTTGCGATTTCGCGTATGTGGTTAAGGGGTGTGATTACGGAACGGTTTTGTTGGTGTCGGGAGTTTGGGGGGTCGAGGGTTTGGTAGTCGTAGCGTATAGGTTTCGCGCGGGTGGGCGGTTAG

[0142] The reverse complementary sequence of the target sequence of the ARL10 gene (5'-3') is as follows:

[0143] SEQ ID NO: 26

[0144] CTGACCGCCCACCCGCGCGGGGCCTGTGCGCTGCGGCTGCCAAGCCCTCGACCCCCCAAGCTCCCGGCACCAGCAGGGCCGTTCCGTGGTCACACCCCTTGGCCACATGCGCGGAGTCGCAGCCCAGCCTGCCCGCCCTTCCGCAGGCCTCGGCCCGGCACTCACGTCCCACTCGTCCCACTCGGGGAGGCGGGCAGCCTCCGCGCCCCACCAGGCCTCTCCCCGGTCCCAGCGCCGCTCTCGGCCGCGGCCGAAGTAGGTCTTCCAGAGGATGAAGAG

[0145] The reverse complementary sequence of the target sequence of the ARL10 gene after bisulfite treatment (5'-3') is as follows:

[0146] SEQ ID NO: 37

[0147] TTGATCGTTTATTCGCGCGGGGTTTGTGCGTTGCGGTTGTTAAGTTTTCGATTTTTTAAGTTTTCGGTATTAGTAGGGTCGTTTCGTGGTTATATTTTTTGGTTATATGCGCGGAGTCGTAGTTTAGTTTGTTCGTTTTTTCGTAGGTTTCGGTTCGGTATTTACGTTTTATTCGTTTTATTCGGGGAGGCGGGTAGTTTTCGCGTTTTATTAGGTTTTTTTTCGGTTTTAGCGTCGTTTTCGGTCGCGGTCGAAGTAGGTTTTTTAGAGGATGAAGAG

[0148] The target sequence of the EGR3 gene (5'-3') is as follows:

[0149] SEQ ID NO: 20

[0150] GCGGGAGAGGCCGCCCTTCCCCAGCTCCCCGGCCCCGGGATCGTTCCCCGTGGCAGGCCCTCGCCCCGCGGGTGAACCCCCTCCTTCTCCCCGCCGTCCCCACACCCCCACGGCTTTGCTGAACGCCCCGGAAAGGCAGCGTCGCAGTACCTCTCCCACCGCGGGGACTCCACGCCGCACATGGCTCCATCCCGGGTGGGAGGCTGAGGGAGTAAGGGGGGAGAGCGCGGGTGAAAAAGACGCCGGGCTCCTCCCGGGAAGAGGGCGACAGCACCACGC

[0151] The sequence of the target sequence of the EGR3 gene after bisulfite treatment (5'-3') is as follows:

[0152] SEQ ID NO: 27

[0153] GCGGGAGAGGTCGTTTTTTTTTAGTTTTTCGGTTTCGGGATCGTTTTTCGTGGTAGGTTTTCGTTTCGCGGGTGAATTTTTTTTTTTTTTTCGTCGTTTTTATATTTTTACGGTTTTGTTGAACGTTTCGGAAAGGTAGCGTCGTAGTATTTTTTTTATCGCGGGGATTTTACGTCGTATATGGTTTTATTTCGGGTGGGAGGTTGAGGGAGTAAGGGGGGAGAGCGCGGGTGAAAAAGACGTCGGGTTTTTTTCGGGAAGAGGGCGATAGTATTACGT

[0154] The reverse complementary sequence of the target sequence of the EGR3 gene (5'-3') is as follows:

[0155] SEQ ID NO: 28

[0156] GCGTGGTGCTGTCGCCCTCTTCCCGGGAGGAGCCCGGCGTCTTTTTCACCCGCGCTCTCCCCCCTTACTCCCTCAGCCTCCCACCCGGGATGGAGCCATGTGCGGCGTGGAGTCCCCGCGGTGGGAGAGGTACTGCGACGCTGCCTTTCCGGGGCGTTCAGCAAAGCCGTGGGGGTGTGGGGACGGCGGGGAGAAGGAGGGGGTTCACCCGCGGGGCGAGGGCCTGCCACGGGGAACGATCCCGGGGCCGGGGAGCTGGGGAAGGGCGGCCTCTCCCGC

[0157] The reverse complementary sequence of the target sequence of the EGR3 gene after bisulfite treatment (5'-3') is as follows:

[0158] SEQ ID NO: 38

[0159] GCGTGGTGTTGTCGTTTTTTTTTCGGGAGGAGTTCGGCGTTTTTTTTATTCGCGTTTTTTTTTTTTATTTTTTTAGTTTTTTATTCGGGATGGAGTTATGTGCGGCGTGGAGTTTTCGCGGTGGGAGAGGTATTGCGACGTTGTTTTTTCGGGGCGTTTAGTAAAGTCGTGGGGGTGTGGGGACGGCGGGGAGAAGGAGGGGGTTTATTCGCGGGGCGAGGGTTTGTTACGGGGAACGATTTCGGGGTCGGGGAGTTGGGGAAGGGCGGTTTTTTTCGT

[0160] The target sequence of the ST8SIA4 gene (5'-3') is as follows:

[0161] SEQ ID NO: 21

[0162] GCCCCAACGCCTTCTCAGTCAAGCTGGGAGGAAACTGCTTCAGCTTGAAAAGGATGCGGGCAAAAGCCCAGCCCGACTAGCTCAACCGCCGCGCCAGTGCCCGCCTCCTCTTCCTTAACGCCTAGGGCTGCGCCCACCAGCCGGCAACGTCCAGGAAAGGGCCACAGGAGAAATGACACCCGTGCAATGCGGAGTGTCCCGGCTCCGCTTCCCCGCAGGGACTCGAGGTGCGCTCCTTTTCCTGGCCACGGTTTAGGGAGGCTCGGAGATGGACACCTCGGCAGTATCTGGCGACCCTCTTC

[0163] The sequence (5'-3') of the target sequence of the ST8SIA4 gene after bisulfite treatment is as follows:

[0164] SEQ ID NO: 29

[0165] GTTTTAACGTTTTTTTAGTTAAGTTGGGAGGAAATTGTTTTAGTTTGAAAAGGATGCGGGTAAAAGTTTAGTTCGATTAGTTTAATCGTCGCGTTAGTGTTCGTTTTTTTTTTTTTAACGTTTAGGGTTGCGTTTATTAGTCGGTAACGTTTAGGAAAGGGTTATAGGAGAAATGATATTCGTGTAATGCGGAGTGTTTCGGTTTCGTTTTTTCGTAGGGATTCGAGGTGCGTTTTTTTTTTTGGTTACGGTTTAGGGAGGTTCGGAGATGGATATTTCGGTAGTATTTGGCGATTTTTTTT

[0166] The reverse complementary sequence (5'-3') of the target sequence of the ST8SIA4 gene is as follows:

[0167] SEQ ID NO: 30

[0168] GAAGAGGGTCGCCAGATACTGCCGAGGTGTCCATCTCCGAGCCTCCCTAAACCGTGGCCAGGAAAAGGAGCGCACCTCGAGTCCCTGCGGGGAAGCGGAGCCGGGACACTCCGCATTGCACGGGTGTCATTTCTCCTGTGGCCCTTTCCTGGACGTTGCCGGCTGGTGGGCGCAGCCCTAGGCGTTAAGGAAGAGGAGGCGGGCACTGGCGCGGCGGTTGAGCTAGTCGGGCTGGGCTTTTGCCCGCATCCTTTTCAAGCTGAAGCAGTTTCCTCCCAGCTTGACTGAGAAGGCGTTGGGGC

[0169] The reverse complementary sequence of the target sequence of the ST8SIA4 gene after bisulfite treatment (5'-3') is as follows:

[0170] SEQ ID NO: 39

[0171] GAAGAGGGTCGTTAGATATTGTCGAGGTGTTTATTTTCGAGTTTTTTTAAATCGTGGTTAGGAAAAGGAGCGTATTTCGAGTTTTTGCGGGGAAGCGGAGTCGGGATATTTCGTATTGTACGGGTGTTATTTTTTTTGTGGTTTTTTTTTGGACGTTGTCGGTTGGTGGGCGTAGTTTTAGGCGTTAAGGAAGAGGAGGCGGGTATTGGCGCGGCGGTTGAGTTAGTCGGGTTGGGTTTTTGTTCGTATTTTTTTTAAGTTGAAGTAGTTTTTTTTTAGTTTGATTGAGAAGGCGTTGGGGT

[0172] The target sequence of the BCAT1 gene (5'-3') is as follows:

[0173] SEQ ID NO: 22

[0174] CGTCGGCCACGAGGGAAGCTCGAGCTGAGCGGAGGGCAGATCCCAAGGGTCGTAGCCCCTGGCCGTGTGGACCGGGTCTGCGGCTGCAGAGCGCGGTCCCGGCTGCAGCAAGACCTGGGGCAGTGCCCGAGGCGGCGGCGAGTACACGTGGCGGGCTGGATTGCAGACCGGCCCTCTCGCGGCGGAGACTCGCGACCTAGCGGATTGCATCAGCAGGAAGACACTAAGGCTGCTCCCCCAGGCCGCCCCCAGATGGTGGAGTCTCTCCCAGCCCGAAGATTCGGAGCCAGCGCCCAGACCCGAGCCTCACTCACTGCTCACTCCCGGGGTGCAGGGCA

[0175] The sequence (5'-3') of the target sequence of the BCAT1 gene after bisulfite treatment is as follows:

[0176] SEQ ID NO: 31:

[0177] CGTCGGTTACGAGGGAAGTTCGAGTTGAGCGGAGGGTAGATTTTAAGGGTCGTAGTTTTTGGTCGTGTGGATCGGGTTTGCGGTTGTAGAGCGCGGTTTCGGTTGTAGTAAGATTTGGGGTAGTGTTCGAGGCGGCGGCGAGTATACGTGGCGGGTTGGATTGTAGATCGGTTTTTTCGCGGCGGAGATTCGCGATTTAGCGGATTGTATTAGTAGGAAGATATTAAGGTTGTTTTTTTAGGTCGTTTTTAGATGGTGGAGTTTTTTTTAGTTCGAAGATTCGGAGTTAGCGTTTAGATTCGAGTTTTATTTATTGTTTATTTTCGGGGTGTAGGGTA

[0178] The reverse complementary sequence (5'-3') of the target sequence of the BCAT1 gene is as follows:

[0179] SEQ ID NO: 32

[0180] TGCCCTGCACCCCGGGAGTGAGCAGTGAGTGAGGCTCGGGTCTGGGCGCTGGCTCCGAATCTTCGGGCTGGGAGAGACTCCACCATCTGGGGGCGGCCTGGGGGAGCAGCCTTAGTGTCTTCCTGCTGATGCAATCCGCTAGGTCGCGAGTCTCCGCCGCGAGAGGGCCGGTCTGCAATCCAGCCCGCCACGTGTACTCGCCGCCGCCTCGGGCACTGCCCCAGGTCTTGCTGCAGCCGGGACCGCGCTCTGCAGCCGCAGACCCGGTCCACACGGCCAGGGGCTACGACCCTTGGGATCTGCCCTCCGCTCAGCTCGAGCTTCCCTCGTGGCCGACG

[0181] The reverse complementary sequence of the target sequence of the BCAT1 gene after bisulfite treatment (5'-3') is as follows:

[0182] SEQ ID NO: 40

[0183] TGTTTTGTATTTCGGGAGTGAGTAGTGAGTGAGGTTCGGGTTTGGGCGTTGGTTTCGAATTTTCGGGTTGGGAGAGATTTTATTATTTGGGGGCGGTTTGGGGGAGTAGTTTTAGTGTTTTTTTGTTGATGTAATTCGTTAGGTCGCGAGTTTTCGTCGCGAGAGGGTCGGTTTGTAATTTAGTTCGTTACGTGTATTCGTCGTCGTTTCGGGTATTGTTTTAGGTTTTGTTGTAGTCGGGATCGCGTTTTGTAGTCGTAGATTCGGTTTATACGGTTAGGGGTTACGATTTTTGGGATTTGTTTTTCGTTTAGTTCGAGTTTTTTTCGTGGTCGACG

[0184] The target sequence of the THBD gene (5'-3') is as follows:

[0185] SEQ ID NO: 23

[0186] CCAGATCGGCTCGCTGGGCACAGTGGCCTCAGCAGCGGAGACAGCGACGCACAACGGGCCGCAGAGGGGAGCCCCATTGAGGTCGAGCCGTGCCCACCTGCTATAGCTGGTGTTGTTGTCTCCCGTAACCCACTGGAAGCCGCGCAGGGGCCCGAGGCGCTTGGGGTCGCCGCAGCCGGGTGGCAGCTGCAGGCCGATCCAGAGGCGCCGGCGGCCAACGCCGCCGTCGCCGTTCAGTAGCAAGGAAATGACATCGGCAGCCACCGAGGAGCGCACTGTCATTAGGTGGCCCCGCAGTCCGTCGCAGAT

[0187] The target sequence of the THBD gene after bisulfite treatment (5'-3') is as follows:

[0188] SEQ ID NO: 33 [[ID=​​​​​​​​​ATCTGCGACGGACTGCGGGGCCACCTAATGACAGTGCGCTCCTCGGTGGCTGCCGATGTCATTTCCTTGCTACTGAACGGCGACGGCGGCGTTGGCCGCCGGCGCCTCTGGATCGGCCTGCAGCTGCCACCCGGCTGCGGCGACCCCAAGCGCCTCGGGCCCCTGCGCGGCTTCCAGTGGGTTACGGGAGACAACAACACCAGCTATAGCAGGTGGGCACGGCTCGACCTCAATGGGGCTCCCCTCTGCGGCCCGTTGTGCGTCGCTGTCTCCGCTGCTGAGGCCACTGTGCCCAGCGAGCCGATCTGG

[0193] The reverse complementary sequence of the target sequence of the THBD gene after bisulfite treatment (5'-3') is as follows:

[0194] SEQ ID NO: 41

[0195] ATTTGCGACGGATTGCGGGGTTATTTAATGATAGTGCGTTTTTCGGTGGTTGTCGATGTTATTTTTTTGTTATTGAACGGCGACGGCGGCGTTGGTCGTCGGCGTTTTTGGATCGGTTTGTAGTTGTTATTCGGTTGCGGCGATTTTAAGCGTTTCGGGTTTTTGCGCGGTTTTTAGTGGGTTACGGGAGATAATAATATTAGTTATAGTAGGTGGGTACGGTTCGATTTTAATGGGGTTTTTTTTTGCGGTTCGTTGTGCGTCGTTGTTTTCGTTGTTGAGGTTATTGTGTTTAGCGAGTCGATTTGG

[0196] The target sequence of the KCNJ12 gene (5'-3') is as follows:

[0197] SEQ ID NO: 24

[0198] GGTAATGAACATCGTTCCCTGTTCGTCTTTAGTGAATTAAGGGCCGGATGAGGAAGTGGGAAATAGGAGGAAGCIGTGCCTCCCCGGAGGAGCACGTGCCCTCAGAGCCATAAGGCAGGAGCAGAGGCTGCCTGAGTTTGCAGCGCGAGGCCAGGGGGCTTCCCTGGGACTCGGCGACCGCCCTGTGCGCTCGGACGCGCAGGCAAATCCCCGCTCCGCTGCGCCTGGTGTGCACGGAGCCCTCCTACTTGCTTCCTACGCCGCTTATCCGTTTATCTGCATCGTAAAAGCCAGCGTTACTTTGTTTTCGT

[0199] The sequence (5'-3') of the target sequence of the KCNJ12 gene after bisulfite treatment is as follows:

[0200] SEQ ID NO: 35

[0201] GGTAATGAATATCGTTTTTTGTTCGTTTTTAGTGAATTAAGGGTCGGATGAGGAAGTGGGAAATAGGAGGAAGTTGTGTTTTTTCGGAGGAGTACGTGTTTTTAGAGTTATAAGGTAGGAGTAGAGGTTGTTTGAGTTTGTAGCGCGAGGTTAGGGGGTTTTTTTGGGATTCGGCGATCGTTTTGTGCGTTCGGACGCGTAGGTAAATTTTCGTTTCGTTGCGTTTGGTGTGTACGGAGTTTTTTTATTTGTTTTTTACGTCGTTTATTCGTTTATTTGTATCGTAAAAGTTAGCGTTATTTTGTTTTCGT

[0202] The reverse complementary sequence (5'-3') of the target sequence of the KCNJ12 gene is as follows:

[0203] SEQ ID NO: 36

[0204] ACGAAAACAAAGTAACGCTGGCTTTTACGATGCAGATAAACGGATAAGCGGCGTAGGAAGCAAGTAGGAGGGCTCCGTGCACACCAGGCGCAGCGGAGCGGGGATTTGCCTGCGCGTCCGAGCGCACAGGGCGGTCGCCGAGTCCCAGGGAAGCC CCCTGGCCTCGCGCTGCAAACTCAGGCAGCCTCTGCTCCTGCCTATGGCTCTGAGGGCACGTGCTCCTCCGGGGAGGCACAGCTTCCTCCTATTTCCCACTTCCTCATCCGGCCCTTAATTCACTAAAGACGAACAGGGAACGATGTTCATTACC

[0205] The reverse complementary sequence of the target sequence of the KCNJ12 gene after bisulfite treatment (5'-3') is as follows:

[0206] SEQ ID NO: 42

[0207] ACGAAAATAAAGTAACGTTGGTTTTTACGATGTAGATAAACGGATAAGCGGCGTAGGAAGTAAGTAGGAGGGTTTCGTGTATATTAGGCGTAGCGGAGCGGGGATTTGTTTGCGCGTTCGAGCGTATAGGGCGGTCGTCGAGTTTTAGGGAAGTT TTTTGGTTTCGCGTTGTAAATTTAGGTAGTTTTTGTTTTTGTTTTATGGTTTTGAGGGTACGTGTTTTTTCGGGGAGGTATAGTTTTTTTTTATTTTTTATTTTTTTATTCGGTTTTTAATTTATTAAAGACGAATAGGGAACGATGTTTTATTATT

[0208] The target sequences and related sequences of the ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12 genes are shown in Table 1.

[0209] Table 1: Target sequences and related sequences of ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12 genes.

[0210]

[0211]

[0212] Preferably, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 9 nucleotides from the target sequence of the target gene, wherein the fragment contains at least one CpG dinucleotide sequence. In some preferred embodiments, such as when bisulfite is used to transform the DNA of the test sample, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 9 nucleotides from the bisulfite-converted sequence of the target sequence of the target gene, preferably a fragment of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence.

[0213] More preferably, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 15 nucleotides hybridized to the target sequence of the target gene under moderately or strictly controlled conditions, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence. In some preferred embodiments, such as when bisulfite is used to transform the DNA of the test sample, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 15 nucleotides hybridized to the target sequence of the target gene after bisulfite transformation under moderately or strictly controlled conditions, preferably a fragment of at least 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence.

[0214] Preferably, the composition further includes a reagent for converting the 5-position unmethylated cytosine base of the target sequence of the target gene into uracil. More preferably, the reagent is a bisulfite.

[0215] Nucleic acids used to detect the methylation status of a target gene may also include blocking agents that preferentially bind to DNA in an unmethylated state.

[0216] Preferably, the composition comprises one or more primers and probes as shown in Table 2:

[0217] Table 2 Primer and probe sequences used in this application

[0218]

[0219]

[0220] In Table 2, “F” represents the forward primer; “R” represents the reverse primer; and “P” represents the probe.

[0221] Preferably, the fluorescent labeling method of the probe sequence used in this application is shown in Table 3.

[0222] Table 3. One fluorescent labeling method for the probe sequences used in this application.

[0223]

[0224] In some embodiments, the composition further includes a reagent for converting the unmethylated cytosine base at carbon 5 of the gene into uracil. Preferably, this reagent is a bisulfite. Bisulfite modification of DNA is a known tool for assessing CpG methylation status. In eukaryotic DNA, 5-methylcytosine is the most common covalent base modification. 5-methylcytosine cannot be identified by sequencing because it has the same base-pairing behavior as cytosine. Furthermore, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification. The most common method for analyzing the presence of 5-methylcytosine in DNA is based on the specific reaction of bisulfite with cytosine; after subsequent alkaline hydrolysis, the unmethylated cytosine is converted into uracil, which corresponds to thymine in its pairing behavior; however, under these conditions, 5-methylcytosine remains unmodified. The original DNA is thus transformed in this way, making 5-methylcytosine, which was previously indistinguishable from cytosine in its hybridization behavior, now detectable as the only remaining cytosine by conventional known molecular biology techniques, such as amplification and hybridization. All these techniques, based on different base-pairing properties, can now be fully utilized. Therefore, typically, this application provides the combined use of bisulfite techniques with one or more methylation assays to determine the methylation status of a CpG dinucleotide sequence within a target sequence of a target gene. Furthermore, the methods of this application are suitable for analyzing heterogeneous biological samples, such as low concentrations of tumor cells in blood or feces. Therefore, when analyzing the methylation status of a CpG dinucleotide sequence in such a sample, those skilled in the art can use quantitative assays to determine the methylation level (e.g., percentage, fraction, ratio, proportion, or extent) of a specific CpG dinucleotide sequence, rather than the methylation status. Accordingly, the term methylation status or methylation state should also be considered as referring to a value reflecting the methylation status of a CpG dinucleotide sequence.

[0225] On the other hand, this application provides oligonucleotides for in vitro detection of gastric cancer, such as oligonucleotides for detection in biopsy tissue samples or peripheral blood samples, comprising: a fragment of at least 9 nucleotides in SEQ ID NO: 19 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in SEQ ID NO: 20 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in SEQ ID NO: 21 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in SEQ ID NO: 22 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in SEQ ID NO: 23 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in SEQ ID NO: 24 or its complementary sequence and containing at least one CpG dinucleotide sequence.

[0226] Preferably, the oligonucleotide for in vitro detection of gastric cancer comprises: a fragment of at least 9 nucleotides in a sequence obtained by bisulfite conversion of SEQ ID NO: 19 or its complementary sequence; and / or a fragment of at least 9 nucleotides in a sequence obtained by bisulfite conversion of SEQ ID NO: 20 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in a sequence obtained by bisulfite conversion of SEQ ID NO: 21 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in a sequence obtained by bisulfite conversion of SEQ ID NO: 22 or its complementary sequence; and / or a fragment of at least 9 nucleotides in a sequence obtained by bisulfite conversion of SEQ ID NO: 23 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in a sequence obtained by bisulfite conversion of SEQ ID NO: 24 or its complementary sequence and containing at least one CpG dinucleotide sequence.

[0227] The oligonucleotide for in vitro detection of gastric cancer of this application further comprises: a fragment hybridized to at least 15 nucleotides of SEQ ID NO: 19 or its complementary sequence under moderately or strictly controlled conditions and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized to at least 15 nucleotides of SEQ ID NO: 20 or its complementary sequence under moderately or strictly controlled conditions and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized to at least 15 nucleotides of SEQ ID NO: 21 or its complementary sequence under moderately or strictly controlled conditions and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized to at least 15 nucleotides of SEQ ID NO: 22 or its complementary sequence under moderately or strictly controlled conditions and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized to at least 15 nucleotides of SEQ ID NO: 23 or its complementary sequence under moderately or strictly controlled conditions and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized to SEQ ID NO: 19 or its complementary sequence under moderately or strictly controlled conditions and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized to SEQ ID NO: 20 or its complementary sequence under moderately or strictly controlled conditions and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized to at least 15 nucleotides of SEQ ID NO: 23 or its complementary sequence under moderately or strictly controlled conditions and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized to at least 15 nucleotides of SEQ ID NO: 20 or its complementary sequence under moderately or strictly controlled conditions and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized to at least 15 nucleotides of SEQ ID NO: 21 or its complementary sequence under moderately or strictly controlled conditions and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized to at least 15 nucleotides of SEQ ID NO: 22 or its complementary sequence under moderately or strictly controlled A fragment consisting of at least 15 nucleotides of NO:24 or its complementary sequence and containing at least one CpG dinucleotide sequence.

[0228] Preferably, the oligonucleotide for in vitro detection of gastric cancer comprises: a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of a sequence derived from the bisulfite conversion of SEQ ID NO: 19 or its complementary sequence, and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of a sequence derived from the bisulfite conversion of SEQ ID NO: 20 or its complementary sequence, and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of a sequence derived from the bisulfite conversion of SEQ ID NO: 21 or its complementary sequence, and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of a sequence derived from the bisulfite conversion of SEQ ID NO: 2 ...0 or its complementary sequence, and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of a sequence derived from the bisulfite conversion of SEQ ID NO: 21 or its complementary sequence, and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of a sequence derived from the bisulfite conversion of SEQ ID NO: 22 or its complementary sequence, and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of a sequence derived A fragment of at least 15 nucleotides containing at least one CpG dinucleotide sequence in the sequence of SEQ ID NO: 23 or its complementary sequence after bisulfite conversion; and / or hybridized under moderate or severe conditions to a fragment of at least 15 nucleotides containing at least one CpG dinucleotide sequence in the sequence of SEQ ID NO: 24 or its complementary sequence after bisulfite conversion.

[0229] The oligonucleotide for in vitro detection of gastric cancer of this application may further include: an inhibitor that preferentially binds to DNA in an unmethylated state.

[0230] In one specific embodiment, the oligonucleotide for in vitro detection of gastric cancer comprises the sequences of SEQ ID NO: 1 and SEQ ID NO: 2. It also includes the sequence of SEQ ID NO: 3.

[0231] In another specific embodiment, the oligonucleotide for in vitro detection of gastric cancer includes the sequences of SEQ ID NO: 4 and SEQ ID NO: 5. It also includes the sequence of SEQ ID NO: 6.

[0232] In another specific embodiment, the oligonucleotide for in vitro detection of gastric cancer includes the sequences of SEQ ID NO: 7 and SEQ ID NO: 8, and further includes the sequence of SEQ ID NO: 9.

[0233] In another specific embodiment, the oligonucleotide for in vitro detection of gastric cancer includes the sequences of SEQ ID NO: 10 and SEQ ID NO: 11, and further includes the sequence of SEQ ID NO: 12.

[0234] In another specific embodiment, the oligonucleotide for in vitro detection of gastric cancer includes the sequences of SEQ ID NO: 13 and SEQ ID NO: 14, and further includes the sequence of SEQ ID NO: 15.

[0235] In another specific embodiment, the oligonucleotide for in vitro detection of gastric cancer includes the sequences of SEQ ID NO: 16 and SEQ ID NO: 17, and further includes the sequence of SEQ ID NO: 18.

[0236] On the other hand, this application provides a kit comprising the aforementioned composition. The kit also contains at least one other component selected from: nucleoside triphosphate, DNA polymerase, and a buffer required for the function of the DNA polymerase.

[0237] Typically, the kit also includes a container for holding the patient's biological sample. Furthermore, the kit also includes instructions for using and interpreting the test results.

[0238] This application also relates to the use of the above-described composition and oligonucleotides in the preparation of a kit for in vitro detection of gastric cancer.

[0239] This application also relates to the use of any one or more of the ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12 genes in the preparation of a kit for the in vitro detection of gastric cancer.

[0240] The ARL10 gene, namely the human ADP ribosylation factor-like GTPase 10 gene, is predicted to activate GTP binding activity and GTPase activity. Its gene ID number in NCBI is 285598.

[0241] The EGR3 gene, or Early Growth Response 3 (EGR3) gene, encodes a transcriptional regulator belonging to the EGR family of C2H2 zinc finger proteins. The protein encoded by this gene participates in the transcriptional regulation of genes related to circadian rhythms. Furthermore, it plays a role in various processes, including muscle development, lymphocyte development, endothelial cell growth and migration, and selective splicing in neuronal development. Its gene ID number in NCBI is 1960.

[0242] The ST8SIA4 gene, or human polysialic acid transferase gene (ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4, ST8SIA4), is predicted to encode a protein that participates in the polymerization of sialic acid to form polysialic acid, thereby regulating the adhesive properties of nerve cell adhesion molecules. This gene has the NCBI gene ID number 7903.

[0243] The BCAT1 gene, or branched chain amino-acid transaminase 1 (cytosolic) gene, encodes a transaminase that reversibly regulates the transamination between branched α-keto acids and branched L-amino acids, thereby providing the L-amino acids essential for cell growth. This gene has the NCBI gene ID number 586.

[0244] The THBD gene, or human thrombomodulin (THBD) gene, encodes a type I endothelial-specific membrane receptor that binds to thrombin, thereby activating protein C, reducing coagulation factors Va and VIIIa, and decreasing thrombin synthesis. This gene has the NCBI gene ID number 7056.

[0245] The KCNJ12 gene, namely the potassium inwardly-rectifying channel (subfamily J, member 12, KCNJ12), is predicted to encode a protein that may be involved in potassium ion influx. The gene has the NCBI ID number 3768.

[0246] Furthermore, this application provides a method for in vitro detection of gastric cancer, the method comprising the following steps:

[0247] 1) Isolate the target sequence or fragment of the target gene from the biological sample to be tested;

[0248] 2) Determine the methylation status of the target sequence of the target gene;

[0249] 3) The state of the biological sample is determined by the detection results of the methylation status of the target sequence of the target gene, thereby realizing the in vitro detection of gastric cancer.

[0250] According to certain preferred embodiments, the method further includes the following steps:

[0251] 1) Extract genomic DNA from the biological sample to be tested;

[0252] 2) Treat the DNA sample obtained in step 1) with reagents to convert the unmethylated cytosine base at carbon 5 to uracil or other bases. That is, the unmethylated cytosine base at carbon 5 of the target sequence of the target gene is converted to uracil or other bases. The converted bases are different from the unmethylated cytosine bases at carbon 5 in terms of hybridization performance and are detectable.

[0253] 3) The DNA sample treated in step 2) is contacted with DNA polymerase and primers for the target sequence of the target gene, so that the target sequence of the treated target gene is amplified to produce an amplification product or is not amplified; if the target sequence of the treated target gene undergoes DNA polymerization, an amplification product will be produced; if the target sequence of the treated target gene does not undergo DNA polymerization, it will not be amplified.

[0254] 4) Detect the amplification products using probes; and

[0255] 5) Based on the presence or absence of the amplification product, determine the methylation status of at least one CpG dinucleotide of the target sequence of the target gene.

[0256] Preferably, the primers typically comprise fragments of the target sequence of the target gene, the target sequence fragment comprising fragments of at least 9 nucleotides that are respectively equivalent to, complementary to, or hybridized under moderate or severe conditions to any one of SEQ ID NO: 19 to 42.

[0257] Preferably, a typical probe comprises a fragment of the target sequence of the target gene, the fragment of the target sequence comprising a fragment of at least 15 nucleotides that are respectively equivalent to, complementary to, or hybridized under moderate or severe conditions to any one of SEQ ID NO: 19 to 42.

[0258] Preferably, one or more of the primers and probes are as shown in Table 2 above.

[0259] Furthermore, the contact or amplification includes using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme, using a polymerase lacking 5'-3' exonuclease activity, using polymerase chain reaction (PCR), and generating amplified nucleic acid molecules with detectable labels.

[0260] Preferably, PCR is used to determine methylation status. Methods such as fluorescence-based real-time PCR, methylation-sensitive single nucleotide primer extension reaction (Ms-SNuPE), methylation-specific PCR (MSP), and methylation CpG island amplification (MCA) are used to determine the methylation status of at least one CpG dinucleotide of the target sequence of a target gene. Among these, fluorescence-based real-time PCR is a high-throughput quantitative methylation assay that uses fluorescence-based real-time PCR (TaqMan) technology and requires no further processing after the PCR step. In short, the fluorescence-based real-time PCR method begins with a mixed sample of genomic DNA, which is converted into a pool of methylation-dependent sequence differences in a sodium bisulfite reaction according to standard procedures. Fluorescence-based PCR is then performed in a biased reaction (using PCR primers with overlapping known CpG dinucleotides). Sequence differences can be generated at both the amplification level and the fluorescence detection amplification level. The fluorescence-based real-time PCR assay can be used as a quantitative test for the methylation status of genomic DNA samples, where sequence differentiation occurs at the probe hybridization level. In this quantitative approach, the PCR reaction provides methylation-specific amplification in the presence of a fluorescent probe overlapping a specific CpG dinucleotide. A no-offset control for the amount of starting DNA is provided by a reaction in which neither the primer nor the probe covers any CpG dinucleotide. The "fluorescence-based real-time PCR" method can be used with any suitable probe, such as TaqMan, Lightcycler, etc. TaqMan probes are dual-labeled with a fluorescent reporter (RTSPYL5rter) and a quencher molecule (Quencher) and are designed to be specific to regions with relatively high GC content, such that they melt in PCR cycles at a temperature approximately 10°C higher than the forward or reverse primers. This allows the TaqMan probe to remain fully hybridized during the PCR annealing / extension steps. When Taq polymerase synthesizes new strands in PCR, it eventually encounters the annealed TaqMan probe. The Taq polymerase 5' to 3' endonuclease activity then replaces the TaqMan probe by digesting it, releasing the fluorescent reporter molecule for quantification using a real-time fluorescence detection system to detect the signal that is no longer quenched. Typical reagents used for fluorescence-based real-time PCR analysis may include, but are not limited to: target sequence PCR primers for the target gene; nonspecific amplification blocking agents; TaqMan or Lightcycler probes; optimized PCR buffers and deoxynucleotides; and Taq polymerase, etc.

[0261] In some preferred embodiments, the methylation status of at least one CpG dinucleotide in the target sequence of the target gene is determined by the critical Ct value of the real-time PCR reaction. By utilizing real-time PCR to analyze DNA in biological samples, the methylation status of the target sequence of the target gene can be conveniently detected, and the positivity of the tested sample can be quickly and easily determined based on the critical Ct value of the PCR reaction, thus providing a non-invasive and rapid in vitro detection method for gastric cancer.

[0262] The biological sample is selected from cell lines, histological sections, tissue biopsies / paraffin-embedded tissues, body fluids, feces, colonic effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof. Plasma is the preferred biological sample.

[0263] The inventors of this application have discovered a significant difference in the methylation status of the target sequences of the ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12 genes between gastric cancer tissue and normal gastric tissue: in gastric cancer tissue, the target sequences of the ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12 genes are methylated, while in normal gastric tissue, these target sequences are not methylated. Therefore, this application provides a method for in vitro detection of gastric cancer by detecting the methylation status of the target sequences of the ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12 genes in a sample. The method provided by this application can detect gastric cancer non-invasively and rapidly.

[0264] Example

[0265] This application provides a general and / or specific description of the materials and test methods used in the experiments. In the following examples, unless otherwise specified, % represents wt%, i.e., weight percentage. Reagents or instruments used, unless otherwise specified, are all commercially available conventional reagent products.

[0266] Example 1: Screening Markers

[0267] The methylation status of ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12 genes in gDNA (genomic DNA) extracted from 26 gastric cancer tissues and 24 normal gastric tissues was detected. First, the gDNA was transformed using a sulfite conversion kit. 10 ng of BisDNA (sulfite-converted DNA) was then detected by real-time fluorescence mPCR (real-time quantitative methylation PCR, which converts cytosine in the sample to uracil using sulfite before real-time fluorescence quantitative PCR). The Ct value of each sample was read. A Ct value greater than 38 was considered negative, and a Ct value less than 38 was considered positive.

[0268] The mPCR reaction system (1) is as follows:

[0269] Volume (μl) Final concentration Taq DNA Polymerase (Biochain) 11.9 4.2×buffer(Biochain) 1.2 1× ARL10_F(10μM) 1 200nM ARL10_R(10μM) 1 200nM ARL10_P(10μM) 0.75 150nM EGR3_F(10μM) 1 200nM EGR3_R(10μM) 1 200nM EGR3_P(10μM) 0.75 150nM ST8SIA4_F(10μM) 1 200nM ST8SIA4_R(10μM) 1 200nM ST8SIA4_P(10μM) 0.75 150nM H2O 26.65 BisDNA (5 ng / μl) 2 10ng

[0270] The mPCR reaction system (2) is as follows:

[0271] Volume (μl) Final concentration Taq DNA Polymerase (Biochain) 11.9 4.2×buffer(Biochain) 1.2 1× BCAT1_F(10μM) 1 200nM BCAT1_R(10μM) 1 200nM BCAT1_P(10μM) 0.75 150nM THBD_F(10μM) 1 200nM THBD_R(10μM) 1 200nM THBD_P(10μM) 0.75 150nM KCNJ12_F(10μM) 1 200nM KCNJ12_R(10μM) 1 200nM KCNJ12_P(10μM) 0.75 150nM H2O 26.65 BisDNA (5 ng / μl) 2 10ng

[0272] The mPCR reaction procedure is as follows:

[0273] 94℃, 20min; (62℃, 5s, 55.5℃, 35s - read fluorescence signal, 93℃, 30s) 50 cycles; 40℃, 10s

[0274] Of the 26 gastric cancer tissue samples tested, 16 were positive for the ARL10 gene mPCR and 10 were negative; 12 were positive for the EGR3 gene mPCR and 14 were negative; 11 were positive for the ST8SIA4 gene mPCR and 15 were negative; 19 were positive for the BCAT1 gene mPCR and 7 were negative; 20 were positive for the THBD gene mPCR and 6 were negative; and 8 were positive for the KCNJ12 gene mPCR and 18 were negative.

[0275] Of the 24 normal gastric tissue samples tested, 2 were positive for ARL10 gene mPCR and 22 were negative; 2 were positive for EGR3 gene mPCR and 22 were negative; 1 was positive for ST8SIA4 gene mPCR and 23 were negative; 3 were positive for BCAT1 gene mPCR and 21 were negative; 3 were positive for THBD gene mPCR and 21 were negative; and 0 were positive for KCNJ12 gene mPCR and 24 were negative.

[0276] The ARL10 gene showed a sensitivity of 61.5% and a specificity of 91.6% for detecting gastric cancer tissue using this PCR system. The EGR3 gene showed a sensitivity of 46.1% and a specificity of 91.6% for detecting gastric cancer tissue using this PCR system. The ST8SIA4 gene showed a sensitivity of 42.3% and a specificity of 95.8% for detecting gastric cancer tissue using this PCR system. The BCAT1 gene showed a sensitivity of 73.1% and a specificity of 87.5% for detecting gastric cancer tissue using this PCR system. The THBD gene showed a sensitivity of 76.9% and a specificity of 87.5% for detecting gastric cancer tissue using this PCR system. The KCNJ12 gene showed a sensitivity of 30.7% and a specificity of 100% for detecting gastric cancer tissue using this PCR system. Details are shown in the table below.

[0277]

[0278] Example 2: cfDNA detection

[0279] The methylation status of cell-free DNA (cfDNA) genes ARL10, EGR3, ST8SIA4, BCAT1, THBD, and KCNJ12 in 17 gastric cancer patients and 29 healthy individuals was detected. 10 ml of venous blood was drawn from each participant, and plasma was separated within 4 hours. cfDNA was extracted according to the instructions of the Biochain plasma cell-free DNA extraction kit. The cfDNA was transformed using a sulfite conversion kit, and real-time fluorescent mPCR was performed on the cfDNA. The Ct value of each sample was read; a Ct value greater than 41 was considered negative, and a Ct value less than 41 was considered positive.

[0280] The mPCR reaction system and reaction procedure are the same as in Example 1.

[0281] In a study of 17 gastric cancer patients, 8 samples tested positive for the ARL10 gene and 9 samples tested negative using cfDNA mPCR; 6 samples tested positive for the EGR3 gene and 11 samples tested negative using cfDNA mPCR; 5 samples tested positive for the ST8SIA4 gene and 12 samples tested negative using cfDNA mPCR; 8 samples tested positive for the BCAT1 gene and 9 samples tested negative using cfDNA mPCR; 9 samples tested positive for the THBD gene and 8 samples tested negative using cfDNA mPCR; and 6 samples tested positive for the KCNJ12 gene and 11 samples tested negative using cfDNA mPCR.

[0282] In the cfDNA tests of 29 healthy individuals, 3 samples were positive for the ARL10 gene mPCR and 26 were negative; 2 samples were positive for the EGR3 gene mPCR and 27 were negative; 2 samples were positive for the ST8SIA4 gene mPCR and 27 were negative; 4 samples were positive for the BCAT1 gene mPCR and 25 were negative; 4 samples were positive for the THBD gene mPCR and 25 were negative; and 1 sample was positive for the KCNJ12 gene mPCR and 28 were negative.

[0283] The ARL10 gene showed a sensitivity of 47% and a specificity of 89.6% for detecting cfDNA in gastric cancer patients using this PCR system. The EGR3 gene showed a sensitivity of 35.3% and a specificity of 93.1% for detecting cfDNA in gastric cancer patients using this PCR system. The ST8SIA4 gene showed a sensitivity of 29.4% and a specificity of 93.1% for detecting cfDNA in gastric cancer patients using this PCR system. The BCAT1 gene showed a sensitivity of 47.1% and a specificity of 86.2% for detecting cfDNA in gastric cancer patients using this PCR system. The THBD gene showed a sensitivity of 52.9% and a specificity of 87.5% for detecting cfDNA in gastric cancer patients using this PCR system. The KCNJ12 gene showed a sensitivity of 35.3% and a specificity of 96.5% for detecting cfDNA in gastric cancer patients using this PCR system. Specific details are shown in the table below.

[0284]

[0285]

[0286] The above experimental results demonstrate that methylated DNA of the target sequence of the target gene is a marker of gastric cancer. By detecting methylated DNA of the target sequence of the target gene in this application, gastric cancer can be detected through gastric biopsy tissue and via non-invasive in vitro methods, thereby improving the detection rate of gastric cancer.

[0287] In summary, this application utilizes the composition, nucleic acid sequence, kit, and their uses described above, as well as the detection method described above, to detect gastric cancer in vitro by detecting the methylated nucleic acid sequence of the target gene and its fragments, thereby effectively improving the sensitivity and specificity of gastric cancer in vitro detection.

[0288] The above description is merely a preferred embodiment of this application and is not intended to limit the application in any other way. Any person skilled in the art may make changes or modifications to the disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of this application without departing from the scope of the technical solution of this application shall still fall within the protection scope of this application.

Claims

1. A composition for in vitro detection of gastric cancer, said composition comprising a target sequence for detecting the methylation level of the ARL10 gene and primers and probes for detecting it; wherein, The methylation level of the ARL10 gene is characterized by the methylation of the target sequence of the ARL10 gene. The target sequence of the ARL10 gene is a polynucleotide sequence selected from any of the following: SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:26 and SEQ ID NO:

37.

2. The composition according to claim 1, wherein, The primer is a fragment of at least 15 nucleotides from the target sequence of the ARL10 gene, the fragment containing at least one CpG dinucleotide sequence.

3. The composition according to any one of claims 1 to 2, wherein, The probe is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the ARL10 gene under moderately or strictly controlled conditions, the fragment containing at least one CpG dinucleotide sequence.

4. The composition according to any one of claims 1 to 2, further comprising: A reagent that converts the unmethylated cytosine base at carbon 5 of the target sequence of the ARL10 gene into uracil.

5. The composition according to claim 3, further comprising: A reagent that converts the unmethylated cytosine base at carbon 5 of the target sequence of the ARL10 gene into uracil.

6. The composition according to claim 3, wherein the nucleic acid for detecting the methylation level of the ARL10 gene further comprises: Blockers that preferentially bind to target sequences in an unmethylated state.

7. The composition according to claim 4, wherein the nucleic acid for detecting the methylation level of the ARL10 gene further comprises: Blockers that preferentially bind to target sequences in an unmethylated state.

8. The composition according to claim 4, wherein, Primer fragments of at least 15 nucleotides are sequences of SEQ ID NO: 1 and SEQ ID NO: 2; The probe fragment of at least 15 nucleotides is the sequence of SEQ ID NO:

3.

9. The composition according to claim 6, wherein, Primer fragments of at least 15 nucleotides are sequences of SEQ ID NO: 1 and SEQ ID NO: 2; The probe fragment of at least 15 nucleotides is the sequence of SEQ ID NO:

3.

10. An oligonucleotide for in vitro detection of gastric cancer, comprising: A fragment of at least 15 nucleotides of SEQ ID NO: 19 or any two of its complementary sequences, and containing at least one CpG dinucleotide sequence.

11. The oligonucleotide of claim 10, further comprising: A fragment comprising at least 15 nucleotides hybridized to any one or more of the complementary sequences of SEQ ID NO: 19 or thereof under moderately or strictly controlled conditions, and containing at least one CpG dinucleotide sequence.

12. The oligonucleotide of claim 10, further comprising: Blockers that preferentially bind to target sequences in an unmethylated state.

13. An oligonucleotide for in vitro detection of gastric cancer, comprising: The sequences of SEQ ID NO: 1-SEQ ID NO:

3.

14. Use of reagents for detecting ARL10 gene methylation levels in the preparation of kits for in vitro detection of gastric cancer.

15. A kit comprising the composition of any one of claims 1-9 or comprising the oligonucleotide of any one of claims 10-13.

16. The kit according to claim 15, further comprising other components selected from: Nucleoside triphosphate, DNA polymerase, and the buffer solution required for said DNA polymerase.

17. The kit according to claim 15 or 16, further comprising: instructions.

18. Use of the composition according to any one of claims 1 to 9 or the oligonucleotide according to any one of claims 10 to 13 in the preparation of a kit for in vitro detection of gastric cancer.

19. The use according to claim 14 or 18, wherein, The kit for in vitro detection of gastric cancer detects gastric cancer by means of the following steps: 1) Isolate DNA samples containing the target sequence of the ARL10 gene or fragments thereof from the biological samples to be tested; 2) Determine the methylation level of the target sequence of the ARL10 gene; 3) The state of biological samples is determined by the detection results of the methylation level of the target sequence of the ARL10 gene, thereby realizing the in vitro detection of gastric cancer.

20. The use according to claim 19, wherein, The method includes the following steps: Extract genomic DNA from the biological sample to be tested; The extracted genomic DNA was treated with a reagent to convert the unmethylated cytosine base at carbon 5 into uracil or other bases. The reagent-treated DNA sample is contacted with DNA polymerase and primers targeting the ARL10 gene sequence to carry out DNA polymerization. Detect the amplification products using probes; as well as Based on the presence or absence of the amplification product, the methylation level of at least one CpG dinucleotide of the target sequence of the ARL10 gene is determined.

21. The use according to claim 20, wherein, The reagent is a bisulfite reagent.