Nicotinamide coenzyme cycle regeneration engineering strain and application thereof
By heterologously expressing nicotinamide phosphoribosyltransferase and nicotinamide mononucleotide adenylate transferase in Escherichia coli and combining them with CRISPR-Cas9 gene editing technology, the supply of NAD(H) synthesis precursors and energy supply is enhanced, solving the problem of low NAD(H) synthesis efficiency in E. coli. This achieves efficient nicotinamide coenzyme recycling and promotes the industrial application of oxidoreductases.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-17
- Publication Date
- 2026-03-31
AI Technical Summary
Existing technologies make it difficult to efficiently synthesize nicotinamide coenzyme NAD(H) in Escherichia coli. This is because the endogenous NAD(H) level is low, the cost of exogenous addition is high, and nicotinic acid, as a precursor, has a negative impact on the pH of the culture medium and biological metabolism, which limits the application of oxidoreductases in industrial production.
Heterologous expression of nicotinamide phosphoribosyltransferase from Variovorax sp. and nicotinamide mononucleotide adenylate transferase from Stutzeri stutzeri in Escherichia coli enhances the supply of precursors for synthesis, knocks out genes related to the NAD(H) degradation pathway, and enhances the energy supply of the NAD(H) synthesis pathway. The host strain was modified by CRISPR-Cas9 gene editing technology.
This method achieves high production of endogenous NAD(H) in Escherichia coli, avoids the influence of nicotinic acid on the pH of the culture medium, meets the needs of large-scale production, improves the NAD(H) synthesis efficiency, and promotes the industrial application of oxidoreductases.
Smart Images

Figure SMS_2 
Figure SMS_3 
Figure SMS_4
Abstract
Description
Technical Field
[0001] This invention pertains to genetically engineered bacteria, specifically relating to a nicotinamide coenzyme recycling strain and its applications. Background Technology
[0002] Oxidoreductases are an important class of biocatalysts widely used in pharmaceuticals, chiral material production, and other fields. The catalytic process of oxidoreductases often requires the participation of nicotinamide coenzyme NAD(H). To ensure a continuous supply of this cofactor, reactions involving NAD(H) as a cofactor often employ whole-cell biocatalysis (Han Q, et al. J. Ind. Microbiol. Biotechnol., 2018, 45: 939–950). However, the endogenous NAD(H) level in host cells is low, making it difficult to meet the needs of overexpressed oxidoreductases, resulting in low catalytic efficiency. Furthermore, the high cost of exogenous NAD(H) addition limits the application of oxidoreductases in industrial production. Therefore, constructing high-yield nicotinamide coenzyme recycling strains is of profound significance for promoting the industrial production of oxidoreductases.
[0003] Lactococcus, Enterobacter aerogenes, and Escherichia coli, etc. SJ, et al. Metab. Eng., 2002, 4:238-247) can all produce NAD(H). Compared to other strains, *E. coli* is widely used in the modification of nicotinamide coenzyme recycling strains due to its clear genetic background, ease of operation and regulation, simple culture requirements, and short growth cycle. There are two NAD(H) synthesis pathways in *E. coli*: one begins with aspartic acid oxidation, called the de novo pathway; the other mainly utilizes nicotinic acid as a precursor, called the Preiss-Handler pathway (Dong WR, et al. BMC Microbiol., 2014, 14:29). Compared to the de novo synthesis pathway, the Preiss-Handler pathway has higher NAD(H) synthesis activity; therefore, current strategies for constructing nicotinamide coenzyme recycling strains are mostly aimed at the Preiss-Handler pathway using nicotinic acid as a precursor.
[0004] However, adding nicotinic acid as a precursor to the culture medium makes the medium acidic, affecting the growth of *E. coli* and the expression of related enzymes. Furthermore, nicotinic acid is only slightly soluble in water, limiting the development of large-scale production (Huang Z, et al. ACSSynth. Biol., 2022, 11:2979-2988). Using nicotinamide as a precursor for NAD(H) synthesis avoids the impact on culture medium pH and biological metabolism, overcoming the limitation of nicotinic acid's slight solubility and better meeting the needs of large-scale production. Currently, there are no reports on reconstructing the NAD metabolic pathway in *E. coli* using nicotinamide (NAM) as a precursor.
[0005]
[0006] As shown in the above equation, under the catalysis of nicotinamide phosphoribosyltransferase (NAMPT), nicotinamide and PRPP condense to form β-nicotinamide mononucleotide (NMN), and nicotinamide mononucleotide adenylate transferase (NadR) further catalyzes the condensation of NMN with the AMP portion of ATP to form NAD(H). However, there is no endogenous NAMPT in *E. coli*, and the existing NadR has low catalytic efficiency. Furthermore, high NAD(H) production is often limited by multiple factors in the synthetic pathway (Pontrelli S, et al. *Metab. Eng. Host Org. Spec. Issue, 2018, 50:16-46), such as a shortage of precursors like PRPP required for NAD(H) synthesis, insufficient energy supply in the synthetic pathway, and inhibition of NAD(H) levels by key enzyme genes in the NAD(H) degradation pathway. If regulation remains at the level of a single factor, it is difficult to increase NAD(H) levels. Based on the foregoing, existing technologies cannot achieve high NAD(H) production. Summary of the Invention
[0007] This study aims to reconstruct the NAD(H) metabolic pathway using nicotinamide as a synthetic precursor. It seeks to achieve NAD(H) accumulation in *E. coli* by enhancing the supply of synthetic precursors, knocking out genes related to the degradation pathway, and enhancing the energy supply for the synthetic pathway, thereby developing a high-yield nicotinamide-coenzyme recycling strain, *E. coli*-NAD(H). To achieve the above objectives, the specific technical solution adopted in this invention is as follows:
[0008] 1) The nicotinamide phosphoribosyltransferase is VsNAMPT derived from Variovorax sp. (nucleotide sequence as shown in SEQ ID NO:1).
[0009] 2) The nicotinamide mononucleotide adenylate transferase is SsNadR (nucleotide sequence shown in SEQ ID NO:2) derived from Stutzeri as Stutzerimonas stutzeri.
[0010] 4) Nicotinamide phosphoribosyltransferase and nicotinamide mononucleotide adenylate transferase were used to construct plasmids.
[0011] 5) Nicotinamide phosphoribosyltransferase and nicotinamide mononucleotide adenylate transferase can be expressed independently or co-expressed in E.coli BL21(DE3) to reconstruct the NAD(H) metabolic pathway with nicotinamide as a precursor. This heterologous expression host is only an example and does not limit the scope of the present invention. Nicotinamide phosphoribosyltransferase and nicotinamide mononucleotide adenylate transferase can also be expressed in lactic acid bacteria, Streptomyces, yeast, Bacillus subtilis, etc.
[0012] 6) Enhance the supply of NAD(H) synthesis precursors
[0013] Overexpression of the prs gene (nucleotide sequence shown in SEQ ID NO:3) encoding 5-phosphoribose-1-pyrophosphate (PRPP) synthase increases intracellular PRPP concentration and promotes NAD(H) synthesis.
[0014] 7) Knock out NAD(H) degradation-related genes to achieve NAD(H) accumulation.
[0015] Using CRISPR-Cas9 gene editing technology, E. coli BL21(DE3) was modified to knock out deoD, ushA, nudC, and mazG, thereby blocking the NAD(H) degradation pathway.
[0016] 8) Enhance the energy supply of the NAD(H) synthesis pathway to achieve NAD(H) accumulation.
[0017] By using CRISPR-Cas9 gene editing technology to modify E. coli BL21(DE3) and knock out amn and add, the adenine metabolic pathway is regulated, indirectly achieving ATP accumulation and providing energy for NAD(H) synthesis.
[0018]
[0019] The reaction formula of this invention
[0020] The application of the nicotinamide coenzyme cyclic regeneration engineered strain is characterized by using nicotinamide as a donor to synthesize NAD(H) through the nicotinamide coenzyme cyclic regeneration engineered strain.
[0021] Beneficial effects:
[0022] This invention utilizes bioinformatics techniques to discover NAMPT and NadR, and successfully expresses them heterologously in *E. coli*. Based on the analysis of the NAD+ synthesis regulatory network, this invention improves the endogenous NAD(H) synthesis level in *E. coli* from three aspects: enhancing precursor supply, knocking out key enzyme genes in the NAD(H) degradation pathway, and enhancing the energy supply of the NAD(H) synthesis pathway. A nicotinamide coenzyme-regenerating strain was constructed, overcoming the limitations of many factors in the synthesis pathway and achieving high NAD(H) production.
[0023] Specifically:
[0024] This invention heterologously expresses nicotinamide phosphoribosyltransferase from Variovorax sp. and nicotinamide mononucleotide adenylate transferase from Stutzeri aspergillus stutzeri in Escherichia coli, reconstructing the NAD(H) metabolic pathway in E. coli using nicotinamide (NAM) as a precursor. Compared to previously reported nicotinamide coenzyme recycling strains, the nicotinamide coenzyme recycling strain constructed in this invention uses nicotinamide as the NAD(H) precursor, avoiding the impact of adding nicotinic acid on the pH of the culture medium and biological metabolism, overcoming the constraint of nicotinic acid's slight solubility, and better meeting the needs of large-scale production.
[0025] This invention, based on the "open source and cost-saving" strategy of enhancing the supply of synthetic precursors and knocking out genes related to degradation pathways, incorporates new considerations for the energy supply of the NAD(H) synthesis pathway, further achieving efficient accumulation of endogenous NAD(H) in Escherichia coli, and finally obtaining a high-yield nicotinamide coenzyme recycling strain E.coli-NAD(H), providing a new means to solve the problem of oxidoreductase coenzyme source and actively promoting the industrial application of oxidoreductase. Detailed Implementation
[0026] The specific steps of the present invention are illustrated below through examples, but the scope of the present invention is not limited to these examples.
[0027] Example 1: Enzyme cycling method for detecting NAD(H) content
[0028] Establishment of the standard curve: 0, 0.01 nmol / L, 0.02 nmol / L, 0.03 nmol / L, 0.04 nmol / L, and 0.05 nmol / L NAD+ were added to the above enzyme cycling reaction system, respectively. + The standard sample was tested using a spectrophotometer, and the OD value was measured over the reaction period of 0-300 seconds. 570 Calculate the changes in NAD at different concentrations. + The reaction rate of the standard was used to obtain NAD. + The standard curve for concentration versus reaction rate is y = 0.2953x - 0.0011(R).2 =0.9982). The NAD(H) detection method is the same as above, and the standard curve is y = 0.3963x - 0.0008 (R = 0.9982). 2 =0.9961).
[0029] Extraction of NAD(H) from the sample: After bacterial culture, add 1 mL of culture to two centrifuge tubes respectively, centrifuge at 20000g for 1 min, collect the bacterial cells into the centrifuge tubes, wash with ultrapure water, centrifuge, and discard the supernatant. Add 250 μL of 0.2M HCl (for NAD). + Extraction: Add 250 μL of 0.2 M NaOH (for NADH extraction) and incubate in a 50 °C water bath for 10 min. After cooling in an ice bath, neutralize the sample with 0.1 M NaOH or 0.1 M HCl, centrifuge at 20000 g for 5 min, collect the supernatant, detect the reaction rate using an enzyme cycling reaction system, and calculate the coenzyme concentration using a standard curve.
[0030] Table 1. Enzyme cycling reaction system
[0031] Composition Specification Volume / μL Bicinebuffer 0.1 mol / L (pH 7.4) 400 PES 4.0g / L 40 MTT 5.0g / L 20 EtOH Analytical Pure 15 Sample to be tested — 10 alcohol dehydrogenase 100U 4
[0032] Example 2: Detection of NMN content using fluorescence method
[0033] Establishment of the standard curve: A 25 mg / L NMN solution was prepared using NMN standard. This solution was then diluted to obtain a series of NMN standard solutions with concentrations of 0.1 mg / L, 1 mg / L, 2.5 mg / L, 5 mg / L, 10 mg / L, 20 mg / L, and 25 mg / L. These standard solutions were added to the fluorescence reaction system described above. Fluorescence was measured using a Tecan multi-mode microplate reader at excitation light of 382 nm and emission light of 445 nm. The resulting standard curve of fluorescence intensity versus NMN concentration was y = 3564376139x + 430211(R²). 2 =0.9936).
[0034] Table 2. Reaction system for fluorescence method
[0035]
[0036] NMN extraction from samples: For extracellular NMN extraction, after bacterial culture, 1 mL of culture was centrifuged at 15700g for 5 min at 4℃, and the supernatant was collected for analysis. For intracellular NMN extraction, the precipitate was resuspended in 1 mL of ultrapure water, and the mixture was ultrasonically disrupted (ice bath, power 120W. Sonication for 2 seconds, interval 4 seconds, repeated 30 times), centrifuged at 15700g for 5 min at 4℃, and the supernatant was collected for analysis. The fluorescence intensity of the intracellular and extracellular NMN solutions was detected by fluorescence method, and the NMN concentration was determined using a standard curve.
[0037] Example 3: Gene Knockout Strategy of CRISPR / Cas9 Gene Editing System
[0038] The principle of the knockout strategy: The C1 and C2 segments of the upstream and downstream 500bp homologous arms of the Escherichia coli BL21(DE3) genome do not contain the deoD gene. The deoD gene of Escherichia coli BL21(DE3) is deleted by homologous recombination through gene editing technology.
[0039] Preparation of E. coli BL21(DE3) / pCas electrocompetent cells: pCas cells containing Cas9 protein were plasmidized and transformed into E. coli BL21(DE3) competent cells. The cells were then plated onto solid LB medium containing 50 μg / mL kanamycin and cultured at 30°C for 12-14 h. Single colonies were selected and inoculated into liquid LB medium containing kanamycin and cultured at 30°C and 220 rpm for 12 h as seed culture. The seed culture was then transferred to 50 mL of medium at a 2% inoculation rate and cultured at 30°C and 220 rpm until the OD600 reached 0.1-0.2. L-arabinose was added to a final concentration of 100 mM to induce culturing until the OD reached 0.5-0.6. Cells were harvested to prepare electrocompetent cells. The cells were washed twice with 10% sterile glycerol, then resuspended in 2 mL of 10% sterile glycerol and dispensed into 1.5 mL aliquots. EP tubes (each containing 100 μL of competent cells) are stored at -80°C.
[0040] Preparation of homologous arm fragments upstream and downstream of the gene to be knocked out (excluding the deoD gene): The genome sequence of Escherichia coli BL21(DE3) was searched in GenBank (GenBank No.: NC_012971.2). The upstream and downstream 500bp of the gene to be knocked out were selected as homologous arms. Primers were designed and, using the Escherichia coli BL21(DE3) genome as a template, PCR was performed to obtain the upstream 500bp homologous arm C1 (nucleotide sequence as shown in SEQ ID NO:4) and the downstream 500bp homologous arm C2 (nucleotide sequence as shown in SEQ ID NO:5) of the gene to be knocked out. C1 and C2 were ligated using cycloplegic PCR to obtain the upstream and downstream homologous arm fragments of the gene to be knocked out.
[0041] Preparation of pTargetF plasmid containing the sgRNA of the gene to be knocked out: The sgRNA of the gene to be knocked out was designed using the online website chopchop (http: / / chopchop.cbu.uib.no / ). Using pTargetF as a template, reverse PCR primers were designed, and the sgRNA sequence was added to the 5' end of the primers. The reverse PCR product was then ligated using seamless cloning to obtain pTargetF-sgRNA.
[0042] The upstream and downstream homologous arm fragments of the gene to be knocked out and the pTargetF plasmid containing the sgRNA of the gene to be knocked out were electroporated into E. coli BL21(DE3) / pCas: Prepared E. coli BL21(DE3) / pCas electroporation competent cells were placed on ice and allowed to thaw. pTargetF-sgRNA and the upstream and downstream homologous arm fragments of the gene to be knocked out were added separately, gently mixed by pipetting, and transferred to a pre-chilled electroporation cuvette (1 mm). The mixture was allowed to stand for 20 min, then electroporated at 2.5 kJ / mL for 5 ms. Immediately afterward, 1 mL of pre-chilled LB medium was added. After recovery at 30°C and 220 rpm for 2 h, the medium was plated onto solid LB agar plates containing 300 μg / mL streptomycin and 50 μg / mL kanamycin, and incubated at 30°C for 16–24 h. Selected single clones were cultured in LB liquid medium containing 300 μg / mL streptomycin and 50 μg / mL kanamycin at 30°C and 220 rpm for 12–14 h. Genomic DNA was extracted according to the instructions of the Sangon Biotech Genomics Extraction Kit, and PCR verification was performed. If the target band size was correct, it was recovered using a DNA gel extraction kit and sequenced to verify the knockout results.
[0043] To further knock out other genes from the already knocked-out strains, pTargetF needs to be eliminated from the bacteria: Inoculate the knocked-out strains into liquid LB containing 50 μg / mL kanamycin, add IPTG to a final concentration of 0.5 mM to induce Cas9 protein cleavage of the pTargetF plasmid, culture at 30℃ and 220 rpm for 12-14 h, passage twice, and use the plate printing method to screen for colonies where pTargetF has been eliminated, and prepare electrocompetent cells to prepare for the next gene editing.
[0044] If further gene editing is not required, pCas needs to be eliminated after eliminating the pTargetF plasmid: Inoculate the pTargetF-eliminated strain into antibiotic-free liquid LB, incubate at 42℃ and 220rpm for 12-14h, passage twice, and screen for pCas-eliminated colonies using the plate printing method, and preserve them for later use.
[0045] Example 4: Construction of the nicotinamide coenzyme cycling regeneration strain E. coli BL21(DE3)-ΔdeoD
[0046] Following the gene knockout strategy of the CRISPR / Cas9 gene editing system described in Example 3, deoD (nucleotide sequence shown in SEQ ID NO:6) in E. coli BL21(DE3) was knocked out, and positive clones were screened to obtain strain E001E. coli BL21(DE3)ΔdeoD. E. coli BL21(DE3) and E001 were respectively inoculated into 100 mL LB liquid medium and cultured at 37°C and 220 rpm for 24 h. The NAD(H) content was then detected according to the method described in Example 1. The intracellular NAD(H) content of strain E001 reached 4.1 μmol / g DCW, which was 1.1 times higher than that of the control group (E. coli BL21(DE3)).
[0047] Example 5: Construction of the nicotinamide coenzyme cycling regeneration strain E. coli BL21(DE3),ΔdeoDΔushA
[0048] Following the gene knockout strategy of the CRISPR / Cas9 gene editing system described in Example 3, ushA (nucleotide sequence shown in SEQ ID NO:7) was knocked out on strain E001, and positive clones were screened to obtain strain E002E.coli BL21(DE3)ΔdeoDΔushA. E.coli BL21(DE3) and E002 were respectively inoculated into 100 mL LB liquid medium and cultured at 37°C and 220 rpm for 24 h. The NAD(H) content was then detected according to the method described in Example 1. The intracellular NAD(H) content of strain E002 reached 4.5 μmol / g DCW, which was 1.25 times higher than that of the control group.
[0049] Example 6: Construction of the nicotinamide coenzyme cycling regeneration strain E. coli BL21(DE3)ΔdeoDΔushAΔnudC
[0050] Following the gene knockout strategy of the CRISPR / Cas9 gene editing system described in Example 3, nudC (nucleotide sequence shown in SEQ ID NO:8) was knocked out on strain E002, and positive clones were screened to obtain strain E003 E. coli BL21(DE3)ΔdeoDΔushAΔnudC. E. coli BL21(DE3) and E003 were respectively inoculated into 100 mL LB liquid medium and cultured at 37°C and 220 rpm for 24 h. The NAD(H) content was then detected according to the method described in Example 1. The intracellular NAD(H) content of strain E003 reached 4.7 μmol / g DCW, which was 1.3 times higher than that of the control group.
[0051] Example 7: Construction of the nicotinamide coenzyme cycling regeneration strain E. coli BL21(DE3)ΔdeoDΔushAΔnudCΔmazG
[0052] Following the gene knockout strategy of the CRISPR / Cas9 gene editing system described in Example 3, mazG (nucleotide sequence as shown in SEQ ID NO:9) was knocked out on strain E003, and positive clones were screened to obtain strain E004E.coli BL21(DE3)ΔdeoDΔushAΔnudCΔmazG. E.coli BL21(DE3) and E004 were respectively inoculated into 100 mL LB liquid medium and cultured at 37°C and 220 rpm for 24 h. The NAD(H) content was then detected according to the method described in Example 1. The intracellular NAD(H) content of strain E004 reached 5.1 μmol / g DCW, which was 1.4 times higher than that of the control group.
[0053] Example 8: Construction of the nicotinamide coenzyme cycling regeneration strain E. coli BL21(DE3)ΔdeoDΔushAΔnudCΔmazGΔamn
[0054] Following the gene knockout strategy of the CRISPR / Cas9 gene editing system described in Example 3, amn (nucleotide sequence as shown in SEQ ID NO:10) was further knocked out based on strain E004, and positive clones were screened to obtain strain E005E.coli BL21(DE3)ΔdeoDΔushAΔnudCΔmazGΔamn. E.coli BL21(DE3) and E005 were respectively inoculated into 100 mL LB liquid medium and cultured at 37°C and 220 rpm for 24 h. The NAD(H) content was then detected according to the method described in Example 1. The intracellular NAD(H) content of strain E005 reached 6.3 μmol / g DCW, which was 1.75 times higher than that of the control group.
[0055] Example 9: Construction of the nicotinamide coenzyme cycling regeneration strain E. coli BL21(DE3)ΔdeoDΔushAΔnudCΔmazGΔamnΔadd
[0056] Following the gene knockout strategy of the CRISPR / Cas9 gene editing system described in Example 3, the nucleotide sequence "add" (as shown in SEQ ID NO: 11) was further knocked out in strain E005, and positive clones were screened to obtain strain E006 E. coli BL21(DE3)ΔdeoDΔushAΔnudCΔmazGΔadd. E. coli BL21(DE3) and E005 were respectively inoculated into 100 mL LB liquid medium and cultured at 37°C and 220 rpm for 24 h. The NAD(H) content was then measured according to the method described in Example 1. The intracellular NAD(H) content of strain E006 reached 6.7 μmol / g DCW, which was 1.9 times higher than that of the control group.
[0057] Table 3 sgRNA sequences of different genes
[0058] Genes to be knocked out sgRNA sequence sequence deoD GACCTGTTCTACTCTCCGGA SEQ ID NO.12 ushA GCAAGATCCGGTCTGCATGG SEQ ID NO.13 nudC TTTGCGGGTAGTAACGCTCA SEQ ID NO.14 mazG AGTCTACGAAGAGATCGAGG SEQ ID NO.15 amn GTGCGAGGGAAAAATCGACG SEQ ID NO.16 add TTGGCAATGACCTGAACGTG SEQ ID NO.17
[0059] Example 10 Construction of prs overexpression vector (E.coli-pPrs)
[0060] prs encodes 5-phosphoribose-1-pyrophosphate (PRPP) synthase, which is a precursor for NMN synthesis. PRPP is used in conjunction with nicotinamide (NAM) to synthesize NMN, which then reacts to generate NAD(H). Therefore, overexpression of prs can lead to the accumulation of NAD(H).
[0061] Using the E. coli BL21(DE3) genome as a template, prs (nucleotide sequence shown in SEQ ID NO:3) was amplified by PCR, and the expression plasmid pET22b-PRS was constructed using pET22b(+), which was then transformed into E. coli BL21(DE3) to obtain the engineered strain E. coli-pPrs. E. coli-pPrs was inoculated into LB medium (containing 50 μg / mL kanamycin) and cultured overnight at 37°C with shaking at 220 rpm to obtain the corresponding seed culture. The seed culture was then transferred to fresh LB medium (containing 50 μg / mL kanamycin) at a 1% inoculation rate and cultured at 37°C until OD. 600 When the concentration of NAD(H) in E. coli-pPrs was 0.8 ± 0.1, IPTG was added to bring the final concentration to 0.2 mM, and the cells were induced at 37 °C for 24 hours. The intracellular NAD(H) content of E. coli-pPrs was measured to be 7.2 μmol / g DCW, which was 2.0 times higher than that of the control group.
[0062] Example 11 Functional expression of nicotinamide phosphoribosyltransferase engineered bacteria (E. coli-pVs)
[0063] VsNAMPT is a nicotinamide phosphoribosyltransferase (amino acid sequence shown in SEQ ID NO:1) derived from Variovorax sp. Its encoding gene was synthesized by a commissioned process, and the expression plasmid pET22b-VsNAMPT was constructed using pET22b(+), which was then transformed into E. coli BL21(DE3) to obtain the engineered strain E. coli-pVs.
[0064] E. coli-pVs were inoculated into LB medium (containing 50 μg / mL kanamycin) and cultured overnight at 37°C with shaking at 220 rpm to obtain the corresponding seed culture. The seed culture was then transferred to fresh LB medium (containing 50 μg / mL kanamycin) at a 1% inoculation rate and cultured at 37°C until OD500. 600 When the concentration of VsNAMPT was 0.8 ± 0.1, IPTG was added to bring the final concentration to 0.2 mM, and the cells were induced at 16 °C for 24 hours. SDS-PAGE analysis showed that VsNAMPT was expressed in soluble form, with a soluble expression rate of 42.4%.
[0065] After induction of expression, E. coli-pVs cells were collected, diluted and resuspended in 0.05M Tris-HCl buffer (pH 7.5), and nicotinamide (1 g / L) was added to construct a whole-cell biosynthesis system. After reacting at 37°C for 12 hours, the NMN content was detected using the fluorescence method described in Example 2. The results showed that VsNAMPT could catalyze the conversion of nicotinamide to NMN with a conversion rate of 76.3%.
[0066] Example 12 Functional expression of nicotinamide mononucleotide adenylate transferase engineered bacteria (E. coli-pSs)
[0067] SsNadR is a nicotinamide mononucleotide adenosine transferase (amino acid sequence shown in SEQ ID NO:2) derived from Stutzeri Stutzerimonas stutzeri. Its encoding gene was synthesized by Genewiz, and the expression plasmid pET22b-SsNadR was constructed using pET22b(+), which was then transformed into E. coli BL21(DE3) to obtain the engineered strain E. coli-pSs.
[0068] E. coli-pSs were inoculated into LB medium (containing 50 μg / mL kanamycin) and cultured overnight at 37°C with shaking at 220 rpm to obtain the corresponding seed culture. The seed culture was then transferred to fresh LB medium (containing 50 μg / mL kanamycin) at a 1% inoculation rate and cultured at 37°C until OD500. 600When the concentration of SsNadR was 0.8 ± 0.1, IPTG was added to bring the final concentration to 0.2 mM, and the cells were induced at 16 °C for 24 hours. SDS-PAGE analysis showed that SsNadR was expressed in soluble form, with a soluble expression rate of 36.5%.
[0069] After induction of expression, E. coli-pSs cells were collected, diluted and resuspended in 0.05M Tris-HCl buffer (pH 7.5), and NMN (1 g / L) was added to construct a whole-cell biosynthesis system. After reacting at 37°C for 12 hours, the NAD(H) content was detected using the enzyme cycling method described in Example 1. The results showed that SsNadR could catalyze the conversion of NMN to NAD(H), with a conversion rate of 69.4%.
[0070] Example 13 Construction of E. coli-NAD(H) nicotinamide coenzyme cycling regeneration strain
[0071] Based on the successfully constructed plasmids pET22b-PRS, pET22b-VsNAMPT, and pET22b-SsNadR, upstream and downstream primers were designed, and an SD-AS sequence (AGAAGGAGATATACA) was added between each gene. Using the cycloplegic PCR technique, pET22b-PRS-VsNAMPT-SsNadR was obtained, which was then transformed into strain E006 to obtain the nicotinamide coenzyme recycling strain E. coli-NAD(H).
[0072] E. coli-NAD(H) was inoculated into LB medium (containing 50 μg / mL kanamycin) and cultured overnight at 37°C with shaking at 220 rpm to obtain the corresponding seed culture. The seed culture was then transferred to fresh LB medium (containing 50 μg / mL kanamycin) at a 1% inoculation rate and cultured at 37°C until OD500 reached. 600 When the concentration of NAD(H) was 0.8 ± 0.1, IPTG was added to bring the final concentration to 0.2 mM, and nicotinamide (1 g / L) was added simultaneously. The cells were induced and cultured at 16 °C for 24 hours. The intracellular NAD(H) content of E. coli-NAD(H) was measured to be 34.6 μmol / g DCW, which was 9.6 times higher than that of the control group.
[0073] Table 4 Comparison of NAD(H) content in different knockout strains and the final strain obtained
[0074]
[0075]
[0076] Note: E. coli-pVs and E. coli-pS are only used to verify protein catalytic function, so specific values are not given. DCW refers to cell dry weight.
[0077] As shown above, the transformation efficiency of engineered bacteria formed by gene knockout or gene overexpression is less than 2 times, but the transformation efficiency of forming E.coli-NAD(H) is 9.6 times, which is much higher than the efficiency of the above engineered bacteria, showing a significant difference. This indicates that each gene has a synergistic effect in the formation of engineered bacteria.
Claims
1. A nicotinamide coenzyme cycle regenerating engineered strain, characterized by, The strain is constructed by the following steps: expressing nicotinamide phosphoribosyltransferase and nicotinamide mononucleotide adenylyltransferase in the strain, enhancing related genes of NAD(H) synthesis precursors, knocking out related genes of NAD(H) degradation, enhancing related genes of ATP supply, and obtaining a nicotinamide coenzyme cycle regeneration engineering strain; The strain is Escherichia coli; the nicotinamide phosphoribosyltransferase is a NAMPT from Variovorax Mycoplasmoides Vs NAMPT, the nucleotide sequence of which is SEQ ID NO: 1 ; the nicotinamide mononucleotide adenylyltransferase is NadR from Pseudomonas stutzeri (ATCC 17588) Stutzerimonas Stutzeri Ss NadR, the nucleotide sequence of which is SEQ ID NO: 2; The related genes for enhancing the synthesis precursor of NAD(H) are through overexpression of endogenous 5-phosphoribosyl-l-pyrophosphate synthetase gene prs Achieved , The nucleotide sequence is as shown in SEQ ID NO: 3; The NAD(H)-degrading related gene is deoD, ushA, nudC and mazG The ATP supply related genes are implemented by knocking out amn and add; wherein deoD The nucleotide sequence of ushA is shown in SEQ ID NO: 7, the nucleotide sequence of nudC is shown in SEQ ID NO: 8, the nucleotide sequence of mazG is shown in SEQ ID NO: 9, the nucleotide sequence of amn is shown in SEQ ID NO: 10, and the nucleotide sequence of add is shown in SEQ ID NO:
11.
2. A method of synthesizing NAD(H), characterized in that, NAD(H) is synthesized by the nicotinamide coenzyme cycle regeneration engineering strain in claim 1 with nicotinamide as a donor.