Thermostable reductaminase, its preparation and use

Abstract

The present application provides a thermostable reductive aminase, its preparation method and application. Specifically, the present application relates to a thermostable reductive aminase and its functional identification and in vitro directed evolution. The reductive aminase of the present application is a reductive aminase from bacteria (BaRedAm) and its mutants (including a reductive aminase mutant with significantly improved enantiomeric selectivity of product rasagiline). The present application also provides an in vitro reductive amination method, comprising the steps of: (i) in the presence of a thermostable reductive aminase BaRedAm, subjecting (S1) a ketone substrate or an aldehyde substrate to a reductive amination reaction with (S2) an amine substrate. The enzyme and mutant of the present application can be used for in vitro enzymatic synthesis of different products such as enantiomerically pure rasagiline.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and biocatalysis, specifically relating to a thermostable reductive amination enzyme, its preparation method, and its applications. This invention provides a novel thermostable reductive amination enzyme and its mutants, as well as its application in the synthesis of compounds such as rasagiline. Background Technology

[0002] Chiral amines are an important component of many natural products, active pharmaceutical ingredients, and other high-value-added chemicals. In recent years, chiral amine drugs have accounted for approximately 40% of new drugs approved by the FDA, with a market value reaching nearly $14 billion in 2020. While many chemical strategies for preparing chiral amines have been established, these strategies are limited by factors such as low reaction efficiency, low selectivity, and adverse environmental impact. In contrast, enzymes derived from renewable resources can provide excellent stereoselectivity and regioselectivity, and catalyze reactions under mild aqueous conditions. Furthermore, enzyme-mediated biocatalysis can be carried out without the use of toxic reagents and without requiring extensive protection and deprotection steps. Therefore, developing novel enzymes as catalysts for green chemistry is a current research hotspot in the field of biosynthetic catalysis.

[0003] Over the past 20 years, numerous enzymatic pathways for the synthesis of chiral amines have been developed, among which transaminases (TAs), amine dehydrogenases (AmDHs), and imine reductases (IREDs), which catalyze the reductive amination of prochiral ketones to amines, have attracted considerable interest from scientists. However, related studies have shown that TAs and AmDHs are currently limited to the synthesis of primary amines, requiring subsequent alkylation steps to synthesize chiral secondary and tertiary amines. While IREDs can catalyze the NAD(P)H-dependent reduction of prochiral imines to chiral amines, they prefer to reduce cyclic imine substrates, resulting in relatively low conversion rates for the amination of prochiral ketones.

[0004] Notably, Turner et al. first reported in detail in 2017 a NADPH-dependent enzyme, AspRedAm, from *Aspergillus oryzae*. This enzyme, named a subfamily of IRED reductive amination enzymes (RedAm), catalyzes a wider range of intermolecular reductive amination reactions of ketones and amines in an aqueous medium. Compared to multi-step chemical routes and other biocatalysts (including TA and AmDH), the reductive amination enzyme RedAm exhibits remarkably high efficiency and atom economy in directly catalyzing the condensation of ketone and amine molecules to chiral amines. In particular, AspRedAm can directly catalyze the reaction of 1-indanone and propargylamine to produce the anti-Parkinson's drug (R)-rasagiline, and in some cases, AspRedAm still shows high reactivity even with substrate ketone to amine ratios as low as 1:1. Subsequently, the research group also reported two novel thermostable RedAms from fungi that can utilize inexpensive ammonium salts as amine donors to produce primary amines and perform continuous-flow biotransformation under mild conditions. By utilizing the NADPH cofactor regeneration system and various amines as amino donors, the RedAm-catalyzed reductive amination process can maximize atom economy, thereby contributing to environmental sustainability. These results demonstrate the significant industrial advantages and enormous application potential of reductive amination enzymes (RedAm).

[0005] Currently, the number of reductive amination enzymes (RedAm) reported in research is limited, which is insufficient to meet the customized needs of industrial applications. Therefore, there is an urgent need in this field to develop novel reductive amination enzymes. Summary of the Invention

[0006] The purpose of this invention is to provide a novel thermostable reductive amination enzyme, BaRedAm, its preparation method, and its applications.

[0007] In a first aspect of the present invention, an in vitro reductive amination method is provided, comprising the steps of:

[0008] (i) In the presence of the thermostable reductive amination enzyme BaRedAm, the (S1) ketone or aldehyde substrate is reductively aminationd with the (S2) amine substrate.

[0009] In another preferred embodiment, the method includes:

[0010] In the presence of the thermostable reductive amination enzyme BaRedAm, the ketone or aldehyde substrate shown in Formula Z1 and the amine substrate shown in Formula Z2 undergo a reductive amination reaction to form the reductive amination product shown in Formula I:

[0011]

[0012] in

[0013] R1 is a substituted or unsubstituted alkyl, a substituted or unsubstituted aryl, a substituted or unsubstituted (C1-C6 alkylene)-phenyl, wherein the substitution indicates that one or more H atoms are substituted by a substituent selected from the group consisting of: C1-C3 alkyl, C2-C4 alkenyl, C2-C4 ynyl, C3-C6 cycloalkyl, halogen, or a combination thereof.

[0014] R2 is H or methyl (CH3);

[0015] Alternatively, R1 and R2 together with the attached C atom can form a substituted or unsubstituted 4-10 membered heterocycle;

[0016] R3 is H, a substituted or unsubstituted C1-C8 alkyl, a substituted or unsubstituted C2-C8 alkenyl, a substituted or unsubstituted C2-C8 ynyl, a substituted or unsubstituted C3-C8 cycloalkyl, a substituted or unsubstituted 6-10 aryl, a substituted or unsubstituted (C1-C6 alkylene)-phenyl, a substituted or unsubstituted (C3-C6 cycloalkylene)-phenyl, wherein the substitution indicates that one or more H atoms are substituted by a substituent selected from the group consisting of: C1-C3 alkyl, C2-C4 alkenyl, C2-C4 ynyl, C3-C6 cycloalkyl, halogen, or a combination thereof.

[0017] In another preferred embodiment, the 4-10 quinone heterocycle includes saturated or unsaturated heterocycles, or benzo[a] 5-7 heterocycles.

[0018] In another preferred embodiment, the substitution refers to the substitution of one or more H atoms by a substituent selected from the group consisting of C1-C3 alkyl, C3-C6 cycloalkyl, halogen, C2-C6 ester, or combinations thereof.

[0019] In another preferred embodiment, the ketone or aldehyde substrate is selected from the group consisting of:

[0020]

[0021] In another preferred embodiment, the amine substrate is selected from the group consisting of:

[0022]

[0023] In another preferred embodiment, the reduced amination product represented by Formula I is a chiral amine compound.

[0024] In another preferred embodiment, the reduced amination product represented by Formula I is selected from the group consisting of rasagiline (9e), N-ethylcyclohexylamine (4b), N-cyclopropylcyclohexylamine (4f), N-benzylcyclohexylamine (4i), benzylpropyl-2-ynylamine (6e), N-benzylaniline (6h), and N-cyclopropyl-4-fluorophenylamine (8f).

[0025] In another preferred embodiment, the reductive amination enzyme BaRedAm is selected from the group consisting of:

[0026] (a) A polypeptide having the amino acid sequence shown in SEQ ID NO:1;

[0027] (b) A derivative polypeptide having reductive amination activity formed by substituting, deleting or adding one or more (e.g., 1-10) amino acid residues of the polypeptide with the amino acid sequence shown in SEQ ID NO:1, or by adding a signal peptide sequence.

[0028] (c) A derivative polypeptide whose sequence contains the polypeptide sequence described in (a) or (b);

[0029] (d) A derived polypeptide with amino acid sequence homology ≥85% or ≥90% (preferably ≥95%) to the amino acid sequence shown in SEQ ID NO: 1 and having reductive amination activity.

[0030] In another preferred embodiment, the sequence (c) is a fusion protein formed by adding a tag sequence, a signal sequence or a secretion signal sequence to (a) or (b).

[0031] In another preferred embodiment, the polypeptide is a polypeptide with the amino acid sequence shown in SEQ ID NO:1.

[0032] A second aspect of the present invention provides an isolated or purified reductive amination enzyme, characterized in that the reductive amination enzyme has the sequence shown in SEQ ID No:1 and has at least one amino acid mutation.

[0033] In another preferred embodiment, the reductive amination enzyme has the following activity: catalyzing the reductive amination reaction of (s1) ketone or aldehyde substrates with (s2) amine substrates.

[0034] In another preferred embodiment, the reductive amination enzyme catalyzes the reductive amination reaction of the ketone or aldehyde substrate of formula Z1 and the amine substrate of formula Z2 to form the reductive amination product of formula I.

[0035]

[0036] In another preferred embodiment, the reductive amination enzyme includes wild-type and mutant types.

[0037] In another preferred embodiment, the mutant reductase has a mutation at a site selected from the group consisting of position 257 of the sequence shown in SEQ ID No:1.

[0038] In another preferred embodiment, the original amino acid residue at the above site is replaced by another amino acid residue, preferably by an amino acid selected from the group consisting of tyrosine, phenylalanine, or leucine.

[0039] In another preferred embodiment, the mutant reductive amination enzyme has mutations selected from the group consisting of:

[0040] Q257I, Q257C, Q257F, Q257M, Q257L, Q257K, Q257Y.

[0041] A third aspect of the present invention provides an isolated polynucleotide encoding the reductase of claim 3.

[0042] The present invention also provides a codon-optimized polynucleotide encoding wild-type thermostable reductive amination enzyme BaRedAm, the sequence of which is shown in SEQ ID NO:2.

[0043] In another preferred embodiment, the polynucleotide sequence encoding the mutant thermostable reductive amination enzyme BaRedAm in the third aspect of the present invention is substantially the same as that in SEQ ID NO:2, except that the codons encoding the mutant amino acids at specific sites are different (for example, for the Q257I mutant thermostable reductive amination enzyme BaRedAm, the codon corresponding to amino acid 257 is the codon encoding amino acid I).

[0044] In a fourth aspect, the present invention provides a carrier containing the polynucleotide described in the third aspect.

[0045] In another preferred embodiment, the carrier includes an expression carrier, a shuttle carrier, and an integration carrier.

[0046] In a fifth aspect, the present invention provides a genetically engineered host cell containing the vector described in the fourth aspect of the present invention, or having the polynucleotides described in the third aspect of the present invention integrated into its genome.

[0047] In another preferred embodiment, the cell is a prokaryotic cell or a eukaryotic cell.

[0048] In another preferred embodiment, the host cell is a eukaryotic cell, such as a yeast cell or a plant cell.

[0049] In another preferred embodiment, the host cell is a brewer's yeast cell.

[0050] In another preferred embodiment, the host cell is a prokaryotic cell, such as Escherichia coli.

[0051] In a sixth aspect of the invention, the use of the thermostable reductive amination enzyme BaRedAm or wild-type thermostable reductive amination enzyme BaRedAm described in the second aspect of the invention is described, in which it is used to catalyze reductive amination reactions or to prepare catalysts for reductive amination reactions.

[0052] In another preferred embodiment, the reaction product of the reductive amination reaction includes an isomer or a non-isomer.

[0053] In another preferred embodiment, the reaction product is an S configuration, an R configuration, or a combination thereof.

[0054] A seventh aspect of the present invention provides a method for the in vitro synthesis of rasagiline using a reductive amination enzyme, comprising the steps of:

[0055] In the presence of the thermostable reductive amination enzyme BaRedAm or wild-type thermostable reductive amination enzyme BaRedAm as described in the second aspect of the invention, 1-indanone and propargylamine are catalyzed to react to generate rasagiline.

[0056] An eighth aspect of the present invention provides a reaction system for carrying out a reducing amination reaction, characterized in that the reaction system comprises:

[0057] (S0) The reductive amination enzyme or wild-type reductive amination enzyme BaRedAm as described in the second aspect of the present invention;

[0058] (S1) Ketone or aldehyde substrates;

[0059] (S2) Amine substrate; and

[0060] (S3) Optional NADPH or NADPH regeneration module.

[0061] In another preferred embodiment, the NADPH regeneration module includes glucose dehydrogenase (GDH) and glucose.

[0062] In another preferred embodiment, the NADPH regeneration module reacts glucose and NADP+ under the catalysis of glucose dehydrogenase (GDH) to generate gluconolactone and NADPH.

[0063] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0064] Figure 1 The image shows the SDS-PAGE electrophoresis results of the purified reductive amination enzyme BaRedAm.

[0065] Figure 2 The graph shows the optimal pH required for the reductive amination of BaRedAm enzyme.

[0066] Figure 3 The graph shows the optimal temperature required for the reductive amination reaction of BaRedAm.

[0067] Figure 4 The results show the Tm values ​​(4a) and temperature tolerance (4b) of the reductase BaRedAm.

[0068] Figure 5 The figure shows the ketone (5a) and amine substrates (5b) used for screening reductive amination enzyme BaRedAm, as well as the results of reductive amination to produce different amine products (5c).

[0069] Figure 6 The diagram shows the relative activity and enantioselectivity of the Q257 site saturated mutant of the reductase BaRedAm in synthesizing rasagiline.

[0070] Figure 7 The graph shows the results of optimizing the reaction conditions for the synthesis of rasagiline for scale-up.

[0071] In this table, A shows the optimized concentration of 1-indanone substrate; B shows the optimized concentration of propargylamine substrate; C shows the optimized concentration of glucose dehydrogenase (GDH); and D shows the optimized concentration of reductive amination enzyme (BaRedAm).

[0072] Figure 8 The diagram shows the results of the reaction between the reductive amination enzyme BaRedAm and rasagiline.

[0073] Figure 9 The HPLC chromatogram of the synthesis of rasagiline by the reductive amination enzyme BaRedAm is shown.

[0074] In this spectrum, A is the chromatogram of 1-indanone standard; B is the chromatogram of propargylamine standard; C is the chromatogram of (R)-rasagiline standard; D is the chromatogram of (S)-rasagiline standard; and E is the chromatogram of the product of the reductive amination catalyzed by BaRedAm.

[0075] Figure 10 The recombinant plasmid pET28a-BaRedAm of the present invention is shown. Detailed Implementation

[0076] Through extensive and in-depth research, the inventors have unexpectedly developed a thermostable reductive amination enzyme, BaRedAm, for the first time. Specifically, the inventors developed a bacterial reductive amination enzyme and performed directed evolutionary modification to obtain mutants with improved reductive amination enzyme activity, such as the reductive amination enzyme mutant BaQ257Y, which exhibits significantly enhanced enantioselectivity for the product rasagiline. The reductive amination enzyme BaRedAm and its mutants of this invention can be used for the in vitro enzymatic synthesis of a variety of useful compounds (including enantiomeric rasagiline). This invention is based on this foundation.

[0077] Specifically, the inventors, through the study of the sequence and structure of reductive aminases, screened the enzymes based on principles such as protein structural similarity, conserved site analysis, and diverse host origins, combined with database analysis. Subsequently, the screened genes were functionally expressed in an *E. coli* expression system, and after purification, the purified reductive aminase BaRedAm of this invention was obtained. Experiments demonstrated that the bacterial reductive aminase BaRedAm has a broad substrate spectrum, capable of catalyzing a series of ketone and amine substrates to generate the corresponding primary and secondary amines, and can directly catalyze the conversion of 1-indanone and propargylamine to rasagiline, with a conversion rate of 14% and an ee value of 22%(R).

[0078] The reductive amination enzyme of the present invention

[0079] As used herein, the terms “thermostable reductive amination enzyme BaRedAm,” “reductive amination enzyme BaRedAm,” “enzyme of the present invention,” “reductive amination enzyme of the present invention,” or “amination enzyme of the present invention” are used interchangeably and all refer to thermostable reductive amination enzyme BaRedAm. It should be understood that the term includes wild-type and mutant reductive amination enzyme BaRedAm (e.g., derivative polypeptides derived from reductive amination enzyme BaRedAm).

[0080] The present invention provides a novel reductive aminease and its encoding gene, derived from bacteria. This reductive aminease is named BaRedAm protein. The wild-type amino acid sequence of the protein is SEQ ID NO:1, and an optimized nucleotide sequence is SEQ ID NO:2.

[0081] In this invention, the reductive amination enzyme of this invention may also be a derivative protein that has the same function (i.e., reductive amination function) as the protein shown in SEQ ID NO:1 by substitution, deletion or addition of one or more amino acids.

[0082] The enzymes of the present invention also include mutants of the reductive amination enzyme BaRedAm. Typically, these mutants are obtained by replacing one or more amino acid residues at one or more positions in the wild-type reductive amination enzyme BaRedAm with another amino acid residue; the preferred substitution position is position 257 of the amino acid sequence of the reductive amination enzyme BaRedAm represented by SEQ NO:1 or the corresponding position thereon. The mutant reductive amination enzyme BaRedAm of the present invention exhibits significantly improved enantioselectivity in catalyzing the conversion of 1-indanone and propargylamine to rasagiline compared to the wild type.

[0083] Furthermore, the reductase mutant is obtained by replacing one or more amino acid residues at one or more positions of a reductase that exhibits at least 90% homology with the amino acid sequence of the wild-type reductase BaRedAm with another amino acid residue; the preferred substitution position is position 257 or the corresponding position of the amino acid sequence of the reductase BaRedAm represented by SEQ NO:1, and the enantioselectivity of the mutant in catalyzing the production of rasagiline from 1-indanone and propargylamine is significantly improved compared to the wild type.

[0084] Furthermore, the other amino acid residue used to replace the original amino acid residue is preferably tyrosine (amino acid abbreviation Y), phenylalanine (amino acid abbreviation F), or leucine (amino acid abbreviation L).

[0085] In this invention, the nucleotide encoding corresponding to the mutation site of the reductase should be understood as the nucleotide encoding of the "other amino acid residue" described in this invention.

[0086] In this invention, some preferred reductase mutants and their encoded genes are also provided, wherein the gene sequence of their starting reductase is SEQ NO:2 in the sequence listing and the starting amino acid sequence is SEQ NO:1 in the sequence listing.

[0087] Some preferred mutation types are selected from the following group: mutants in which glutamine at position 257 is replaced by tyrosine, mutants in which glutamine at position 257 is replaced by phenylalanine, and mutants in which glutamine at position 257 is replaced by leucine.

[0088] As used herein, "isolated polypeptide" means that the polypeptide is substantially free of other naturally occurring or associated proteins, lipids, carbohydrates, or other substances. Those skilled in the art can purify the polypeptide using standard protein purification techniques. A substantially pure polypeptide will produce a single master band on a non-reducing polyacrylamide gel. The purity of the polypeptide can also be further analyzed using its amino acid sequence.

[0089] The active polypeptides of the present invention can be recombinant polypeptides, natural polypeptides, or synthetic polypeptides. The polypeptides of the present invention can be naturally purified products, chemically synthesized products, or produced from a prokaryotic or eukaryotic host (e.g., bacteria, yeast, plants) using recombinant technology. Depending on the host used in the recombinant production protocol, the polypeptides of the present invention can be reductively amination-modified or non-reductively amination-modified. The polypeptides of the present invention may or may not include an initial methionine residue.

[0090] The present invention also includes fragments, derivatives, and analogs of the said polypeptide. As used herein, the terms “fragment,” “derivative,” and “analyte” refer to a polypeptide that substantially retains the same biological function or activity as the said polypeptide.

[0091] The polypeptide fragments, derivatives, or analogs of the present invention may be (i) polypeptides in which one or more conserved or non-conserved amino acid residues (preferably conserved amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code; or (ii) polypeptides having substituent groups in one or more amino acid residues; or (iii) polypeptides formed by fusing a mature polypeptide with another compound (e.g., a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (iv) polypeptides formed by fusing an additional amino acid sequence to the polypeptide sequence (e.g., a leader sequence or secretion sequence or a sequence used to purify the polypeptide or a proteogen sequence, or a fusion protein formed with an antigen IgG fragment). Based on the teachings herein, these fragments, derivatives, and analogs are within the scope well known to those skilled in the art.

[0092] The preferred sequence of the polypeptide is the polypeptide shown in SEQ ID NO:1. This term also includes variants and derived polypeptides having the same function as the polypeptide shown, based on the sequence of SEQ ID NO:1. These variants include (but are not limited to): deletions, insertions, and / or substitutions of one or more amino acids (typically 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10), and the addition of one or more amino acids (typically up to 20, preferably up to 10, more preferably up to 5) to the C-terminus and / or N-terminus. For example, in the art, substitution with amino acids of similar or comparable properties generally does not alter the function of the protein. Similarly, the addition of one or more amino acids to the C-terminus and / or N-terminus generally does not alter the function of the protein. This term also includes the active fragment and active derivative of the reductive aminase BaRedAm of the present invention. The present invention also provides analogues of the polypeptide. These analogues may differ from natural human EGFRvA peptides in amino acid sequence, in form of modification that does not affect the sequence, or both. These peptides include natural or induced genetic variants. Induced variants can be obtained using various techniques, such as random mutagenesis through radiation or exposure to a mutagen, site-directed mutagenesis, or other known molecular biology techniques. Analogs also include those having residues different from natural L-amino acids (e.g., D-amino acids), and those having non-naturally occurring or synthetic amino acids (e.g., β, γ-amino acids). It should be understood that the peptides of the present invention are not limited to the representative peptides exemplified above.

[0093] Modifications (typically without altering the primary structure) include chemically derived forms of peptides, such as acetylation or carboxylation, either in vivo or in vitro. Modifications also include reductive amination, such as those resulting from reductive amination modifications during peptide synthesis and processing or further processing steps. This modification can be accomplished by exposing the peptide to enzymes that perform reductive amination (such as mammalian reductive or dereductive amination enzymes). Modifications also include sequences containing phosphorylated amino acid residues (such as phosphotyrosine, phosphotyserine, phosphotythreonine). Modifications also include peptides modified to improve their resistance to proteolysis or optimize their solubility.

[0094] The amino or carboxyl terminus of the protein of this invention may also contain one or more polypeptide fragments as protein tags. Any suitable tag can be used in this invention. For example, the tags may be FLAG, HA, HA1, c-Myc, Poly–His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6, ε, B, gE, and Ty1. These tags can be used for protein purification.

[0095] To enable the translated protein to be expressed secretively (e.g., secreted extracellularly), a signal peptide sequence, such as the pelB signal peptide, can be added to the amino terminus of the reductive amination enzyme BaRedAm. The signal peptide can be cleaved during the secretion of the polypeptide from the cell.

[0096] The polynucleotides of this invention can be in DNA or RNA form. DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. DNA can be single-stranded or double-stranded. DNA can be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide can be identical to or a degenerate variant of the coding region sequence shown in SEQ ID NO:1. As used herein, "degenerate variant" refers to a nucleic acid sequence encoding the protein having SEQ ID NO:1 but differing from the coding region sequence shown in SEQ ID NO:2.

[0097] The polynucleotide encoding the mature polypeptide of SEQ ID NO:1 includes: a coding sequence that encodes only the mature polypeptide; a coding sequence of the mature polypeptide and various additional coding sequences; a coding sequence of the mature polypeptide (and optional additional coding sequences) and a non-coding sequence.

[0098] The term "polynucleotide encoding a polypeptide" can refer to a polynucleotide that includes the polypeptide, or it can also include additional coding and / or non-coding sequences.

[0099] This invention also relates to variants of the aforementioned polynucleotides that encode polypeptides or fragments, analogs, and derivatives of polypeptides having the same amino acid sequence as those of this invention. These polynucleotide variants can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially alter the function of the polypeptide it encodes.

[0100] The present invention also relates to polynucleotides that hybridize with the above-described sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that hybridize with the polynucleotides described herein under stringent conditions (or strict conditions). In the present invention, “stringent conditions” means: (1) hybridization and elution at lower ionic strength and higher temperatures, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) hybridization with a denaturing agent, such as 50% (v / v) formamide, 0.1% fetal bovine serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization only occurs when the identity between the two sequences is at least 90%, more preferably at least 95%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO:1.

[0101] This invention also relates to nucleic acid fragments that hybridize with the sequences described above. As used herein, a "nucleic acid fragment" is at least 15 nucleotides long, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides or more. The nucleic acid fragment can be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding the reductase BaRedAm protein.

[0102] The polypeptides and polynucleotides in this invention are preferably provided in isolated form and are more preferably purified to homogenization.

[0103] The full-length nucleotide sequence or fragments of the reductive amination enzyme BaRedAm of the present invention can generally be obtained by PCR amplification, recombinant methods, or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed in this invention, especially the open reading frame sequences, and the relevant sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared according to conventional methods known to those skilled in the art as templates. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then splice the fragments amplified from each amplification in the correct order.

[0104] Once the relevant sequence is obtained, it can be obtained in large quantities using recombination methods. This typically involves cloning it into a vector, transferring it into cells, and then isolating the sequence from the proliferated host cells using conventional methods.

[0105] In addition, sequences can be synthesized artificially, especially when the fragment length is short. Typically, long sequences can be obtained by first synthesizing multiple small fragments and then joining them.

[0106] Currently, the DNA sequence encoding the protein of this invention (or a fragment thereof, or a derivative thereof) can be obtained entirely through chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. Furthermore, mutations can be introduced into the protein sequence of this invention through chemical synthesis.

[0107] The application of PCR technology to amplify DNA / RNA is preferred for obtaining the gene of the present invention. Especially when it is difficult to obtain full-length cDNA from a library, the RACE method (RACE-cDNA end amplification method) is preferred. Primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein and can be synthesized using conventional methods. The amplified DNA / RNA fragments can be separated and purified using conventional methods such as gel electrophoresis.

[0108] The present invention also relates to vectors containing the polynucleotides of the present invention, host cells genetically engineered using the vectors of the present invention or the BaRedAm protein-coding sequence of the reductase, and methods for generating the polypeptides of the present invention via recombinant technology.

[0109] Using conventional recombinant DNA techniques, the polynucleotide sequence of this invention can be used to express or produce recombinant reductase BaRedAm polypeptides. Generally, the following steps are involved:

[0110] (1) Transform or transduce suitable host cells with the polynucleotide (or variant) encoding the reductive amination enzyme BaRedAm polypeptide of the present invention, or with a recombinant expression vector containing the polynucleotide.

[0111] (2) Host cells cultured in a suitable culture medium;

[0112] (3) Isolate and purify proteins from culture media or cells.

[0113] In this invention, the BaRedAm polynucleotide sequence of the reductive amination enzyme can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well-known in the art. Any plasmid and vector can be used as long as it can replicate and remain stable within the host. An important characteristic of expression vectors is that they typically contain an origin of replication, a promoter, a marker gene, and translational control elements.

[0114] Methods well known to those skilled in the art can be used to construct expression vectors containing a reductive aminylase BaRedAm encoding DNA sequence and suitable transcription / translation control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombination techniques. The DNA sequence can be efficiently ligated to an appropriate promoter in the expression vector to direct mRNA synthesis. Representative examples of these promoters include: the lac or trp promoter of *E. coli*; the PL promoter of *λ* phage; eukaryotic promoters including the CMV immediate early promoter, the HSV thymidine kinase promoter, early and late SV40 promoters, LTRs of retroviruses, and other known promoters that control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0115] In addition, the expression vector preferably contains one or more selective marker genes to provide phenotypic traits for selecting host cells for transformation, such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for Escherichia coli.

[0116] Vectors containing the appropriate DNA sequence and appropriate promoter or control sequence can be used to transform appropriate host cells so that they can express proteins.

[0117] The host cell can be a prokaryotic cell, such as a bacterial cell; a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples include: Escherichia coli, Streptomyces; Salmonella typhimurium bacterial cells; fungal cells such as yeast; plant cells; Drosophila S2 or Sf9 insect cells; and animal cells such as CHO, COS, 293 cells, or Bowes melanoma cells.

[0118] In another preferred embodiment, suitable host cells include Gram-positive bacteria such as Bacillus subtilis, Gram-negative bacteria such as Escherichia coli, actinomycetes such as Streptomyces, yeasts such as Saccharomyces cerevisiae, and fungi such as Aspergillus, whose cells are all commonly used host cells for recombinant vectors.

[0119] When the polynucleotides of this invention are expressed in higher eukaryotic cells, the insertion of an enhancer sequence into the vector will enhance transcription. Enhancers are cis-acting factors of DNA, typically approximately 10 to 300 base pairs, that act on the promoter to enhance gene transcription. Examples include the SV40 enhancer (100 to 270 base pairs) located late on the replication origin side, the polyoma enhancer located late on the replication origin side, and adenovirus enhancers.

[0120] Those skilled in the art are well aware of how to select appropriate vectors, promoters, enhancers, and host cells.

[0121] Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as *E. coli*, competent cells capable of uptake DNA can be harvested after the exponential growth phase and treated with CaCl2, the steps of which are well known in the art. Another method is to use MgCl2. If desired, transformation can also be performed using electroporation. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0122] The obtained transformants can be cultured using conventional methods to express the polypeptide encoded by the gene of this invention. Depending on the host cells used, the culture medium can be selected from various conventional media. Culture is carried out under conditions suitable for host cell growth. Once the host cells have grown to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature adjustment or chemical induction), and the cells are cultured for a further period.

[0123] The recombinant peptides used in the methods described above can be expressed intracellularly, on the cell membrane, or secreted extracellularly. If desired, the recombinant proteins can be separated and purified using various separation methods based on their physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional refolding treatment, treatment with protein precipitants (salting out), centrifugation, permeation, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high-performance liquid chromatography (HPLC), and various other liquid chromatography techniques, as well as combinations of these methods.

[0124] application

[0125] This invention also provides applications of the reductive amination enzyme BaRedAm, particularly in catalyzing the reductive amination reaction of (S1) ketone or aldehyde substrates with (S2) amine substrates.

[0126] A preferred example is its use in the synthesis of pharmaceutical compounds or intermediates. Typically, the reductive amination enzyme BaRedAm of this invention can be used to prepare compounds such as rasagiline.

[0127] The rasagiline product catalyzed by reductase (RedAm) contains (R)-rasagiline, a potent anti-Parkinson's disease drug, and (S)-rasagiline has also been shown to have significant cardioprotective activity. The reductase BaRedAm of this invention can catalyze the production of a single enantiomeric rasagiline.

[0128] Because certain mutant reductive amination enzymes of the present invention, such as BaRedAm, have significantly improved enantioselectivity for the product rasagiline (e.g., the reductive amination enzyme mutant BaQ257Y), they can be used for the in vitro enzymatic synthesis of enantiopure rasagiline.

[0129] Typically, the present invention provides a method for synthesizing corresponding primary and secondary amines in vitro using the reductive amination enzyme of the present invention. In the method of the present invention, the corresponding ketones and amines are used as raw materials, and the corresponding product amines can be directly generated under the catalysis of the reductive amination enzyme.

[0130] Preferably, the reductive amination enzyme BaRedAm or the reductive amination enzyme mutant provided in the second aspect above. Under optimized conditions, the conversion rate of the reaction catalyzed by the reductive amination enzyme BaRedAm is 3%-97%.

[0131] Preferably, the molar ratio of the ketone to the amine substrate is 1:1 to 1:50.

[0132] Preferably, the concentration of the ketone is 5 mM / L, and the concentration of the amine is 5 to 250 mM / L.

[0133] Preferably, the hydrophilic organic solvent is dimethyl sulfoxide (DMSO).

[0134] Preferably, the final concentration of the hydrophilic organic solvent in the reaction system is 2%.

[0135] Methods for synthesizing rasagilan

[0136] This invention also provides a method for the in vitro synthesis of rasagiline using the reductive amination enzyme of this invention. Typically, this method includes: using 1-indanone and propargylamine as raw materials, rasagiline can be directly generated under the catalysis of the reductive amination enzyme.

[0137] Experiments show that the enzyme of the present invention is particularly suitable for the in vitro enzymatic conversion synthesis of enantiomeric rasagiline.

[0138] Preferably, the reductive aminase BaRedAm or the reductive aminase mutant provided in the second aspect above. Under the same conditions, the reductive aminase BaRedAm mutant exhibits significantly improved enantioselectivity in catalyzing the conversion of 1-indanone and propargylamine to rasagiline, with an ee value >99%.

[0139] Preferably, the molar ratio of 1-indanone to propargylamine is 1:50.

[0140] Preferably, the concentration of 1-indanone is 5 mM / L, and the concentration of propargylamine is 250 mM / L.

[0141] Preferably, the hydrophilic organic solvent is dimethyl sulfoxide (DMSO).

[0142] Preferably, the final concentration of the hydrophilic organic solvent in the reaction system is 2%.

[0143] The main advantages of this invention include:

[0144] 1. The thermostable reductive amination enzyme described in this invention can be used to synthesize the corresponding primary and secondary amines in vitro via enzymatic methods, achieving a conversion rate of 3%-97% for substrate ketones and amines.

[0145] 2. Rasagilan can be synthesized in vitro using the thermostable reductive amination enzyme described in this invention, with a conversion rate of up to 83% for the substrates 1-indanone and propargylamine; its mutant, under the same conditions, shows a significantly improved enantioselectivity for the production of rasagilan from 1-indanone and propargylamine, with an ee value of >99%.

[0146] 3. The thermostable reducing amination enzyme described in this invention was used to successfully synthesize rasagiline in vitro via enzymatic method.

[0147] 4. The thermostable reductive amination enzyme and its mutants obtained by this invention can be used for in vitro enzymatic synthesis of rasagiline, which is a new production method that is different from existing production technologies. The production process is simplified, has low consumption, and is green and environmentally friendly.

[0148] The present invention will be further described in detail below with reference to specific embodiments and data. It should be understood that these embodiments are merely illustrative and not intended to limit the scope of the invention in any way. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0149] Materials and reagents

[0150] General description of the source of the biological materials described in this invention:

[0151] 1. Primer synthesis: All primers used in this invention were synthesized and prepared by BGI Genomics Co., Ltd.

[0152] 2. The PrimeSTAR Max DNA polymerase used in the experiment was purchased from TakaRa; the DNA gel extraction kit and plasmid mini-extraction reagent were purchased from Axygen.

[0153] Example 1: Screening of reductive amination enzymes

[0154] Based on the structural analysis of reductases, and based on principles such as protein structural similarity, conserved site analysis, and diverse host origins, databases from different species were screened, and candidate enzymes were cloned and validated, thereby obtaining a reductase.

[0155] Specifically, in this embodiment, the reductive amination enzyme obtained by screening is the bacterial reductive amination enzyme BaRedAm and its coding sequence. Its amino acid sequence is shown in SEQ ID No:1.

[0156] MREPIVSAHTERAVESRGADRGSAVTVIGLGSMGSALAGAVLEAGYPTTVWNRTAGKAEPLVRRGAARAATVAEAVSASPTVIACVLDYRALREILSTAGDALAGRTVVNLTNGTPTEARETAAWVEGHGARYLDGGIMAVPEMIGGAESLVLYS GSEAAFETVEPVLRRFGSAMYLGADPGLASLHDLALLAGMYGLFAGFLHAVALVGTEGVRATEFTSSLLIPWLQAMTATLPEAAAQIDAGDYAATGSRLDMQAVALANIVEASRSQGIRPDLMLPIQALVERRVAKGGGGEDIAAVVEEVRG(SEQ ID No: 1)

[0157] The BaRedAm gene was codon-optimized to facilitate expression in E. coli. The optimized coding sequence is shown in SEQ ID No:2.

[0158] ATGCGTGAACCGATCGTGAGCGCGCATACCGAACGCGCCGTTGAAAGCCGTGGTGCCGATCGCGGTAGTGCGGTGACCGTTATTGGTCTGGGCAGTATGGGTAGTGCCCTCGCGGGTGCCGTTCTGGAAGCCGGCTATCCAACGACCGTTTGGAATCGTACGGCCGGTAAAGCCGAGCCGCTGGTTCGTCGCGGCGCCGCCCGTGCCGCGACGGTTGCCGAAGCGGTTAGTGCGAGCCCGACGGTGATCGCGTGCGTTCTGGATTATCGCGCGCTGCGCGAGATTCTGAGTACCGCCGGTGATGCGCTGGCCGGTCGTACGGTTGTGAATCTCACGAACGGCACGCCAACCGAAGCGCGTGAAACGGCGGCGTGGGTTGAAGGCCATGGTGCCCGTTATCTGGATGGCGGTATCATGGCGGTGCCGGAAATGATTGGCGGCGCGGAAAGCCTCGTGCTCTACAGCGGCAGCGCCGAAGCGTTCGAAACCGTTGAACCGGTTCTGCGCCGCTTCGGCAGTGCGATGTATCTGGGTGCGGATCCGGGTCTGGCCAGTCTGCACGATCTGGCGCTGCTGGCGGGCATGTATGGTCTGTTCGCCGGCTTTCTGCATGCGGTTGCGCTGGTTGGTACCGAGGGTGTTCGTGCCACCGAATTTACCAGCAGTCTGCTCATCCCGTGGCTGCAAGCCATGACCGCCACGCTGCCAGAAGCGGCGGCGCAAATTGATGCCGGTGATTACGCCGCCACCGGTAGTCGTCTGGATATGCAAGCCGTTGCGCTGGCGAACATCGTGGAAGCCAGTCGCAGCCAAGGCATTCGCCCGGATCTGATGCTCCCAATCCAAGCCCTCGTGGAACGTCGCGTGGCCAAAGGTGGCGGTGGCGAAGATATCGCCGCGGTTGTTGAAGAAGTGCGCGGTTAA(SEQ ID NO:2)

[0159] The sequence shown in SEQ ID No:2 was synthesized using a whole-genome synthesis method, with NdeⅠ and XhoⅠ restriction sites added to both ends. This full-length sequence was then cloned into the NdeⅠ and XhoⅠ restriction sites of a commercially available pET28a(+) plasmid.

[0160] Example 2: Expression and purification of reductive amination enzyme

[0161] The recombinant expression plasmids of the selected genes were heat-shock transformed into E. coli BL21(DE3) competent cells for gene expression and protein purification. When the recombinant bacteria reached an OD of 0.6-0.8, IPTG was added to a final concentration of 0.5 mM, and the cells were induced overnight at 18°C ​​and 220 rpm.

[0162] The bacterial cells were collected by centrifugation and resuspended in 100 mM Tris-HCl buffer (pH 8.0, 300 mM NaCl, 30 mM imidazole). 250 mL of cultured cells were finally resuspended in 40 mL of buffer and disrupted using a high-pressure cell disruptor (4–6 °C, 700 Pa). The cell disruption buffer was then centrifuged at 12,000 rpm for 30 min (4 °C), and the supernatant was collected. This centrifugation at 12,000 rpm for 30 min (4 °C) was repeated. The supernatant was then used to purify the protein using a Ni-NTA column affinity purification process. Impurities were eluted with 100 mM Tris-HCl buffer (pH 8.0, 300 mM NaCl, 50 mM imidazole), and the target protein was eluted with 100 mM Tris-HCl buffer (pH 8.0, 300 mM NaCl, 250 mM imidazole). The eluted protein was then concentrated and desalted to obtain the purified protein.

[0163] The purified protein was stored in 100 mM Tris-HCl buffer (pH 8.0), and the purified protein was detected by electrophoresis using 12% SDS-PAGE. The protein concentration was determined using the Bradford Protein Assay Kit (Shanghai Sangon Biotech).

[0164] The results are as follows Figure 1 As shown in the figure. The results indicate that a clear band was obtained at 31.6 kDa, suggesting that the target protein BaRedAm has been purified.

[0165] Example 3: Determination of the enzymatic properties of the reductive amination enzyme BaRedAm

[0166] In this embodiment, the enzymatic properties of the recombinant reductive amination enzyme BaRedAm prepared in Example 2 were determined.

[0167] In the enzyme activity assay of reductase BaRedAm and its mutants, NADPH cofactor regeneration is provided by coupling with glucose dehydrogenase (GDH).

[0168] 3.1. Determination of the optimal pH for reductase BaRedAm:

[0169] The enzyme activity of BaRedAm was investigated at different pH values ​​(7.0, 8.0, 9.0, and 10.0). The reaction system consisted of 1 mg / mL BaRedAm pure enzyme, 0.7 mg / mL GDH (Aladdin), 30 mM D-glucose, and 1 mM NADP. + 5 mM cyclohexanone, 5 mM cyclopropylamine (in buffer adjusted to pH 9.0), and 2% (v / v) DMSO were added. The final reaction volume was brought to 500 μL using Tris-HCl buffer. The reaction was incubated at 25 °C with shaking at 220 rpm for 24 h. Then, 30 μL of 10 M NaOH was added to quench the reaction. The reaction mixture was extracted twice with 500 μL of methyl tert-butyl ether. The combined upper organic phases were dried over anhydrous MgSO4 and analyzed using GC-FID. The relative enzyme activity under different pH conditions was calculated with the highest enzyme activity defined as 100%.

[0170] The results are as follows Figure 2 As shown in the figure. The results indicate that BaRedAm exhibits high activity at pH 9.0.

[0171] 3.2. Determination of the optimal temperature for reductase BaRedAm:

[0172] The enzyme activity of BaRedAm was investigated at different temperatures (20℃, 25℃, 30℃, and 35℃). The reaction system consisted of 1 mg / mL BaRedAm pure enzyme, 0.7 mg / mL GDH (Aladdin), 30 mM D-glucose, and 1 mM NADP. + 5 mM cyclohexanone, 5 mM cyclopropylamine (in buffer adjusted to pH 9.0), and 2% (v / v) DMSO were added. The final reaction volume was brought to 500 μL using Tris-HCl buffer. The reaction was incubated at different temperatures with shaking at 220 rpm for 24 h. Then, 30 μL of 10M NaOH was added to quench the reaction. The reaction mixture was extracted twice with 500 μL of methyl tert-butyl ether. The combined upper organic phases were dried over anhydrous MgSO4 and analyzed using GC-FID. The relative enzyme activity under different temperature conditions was calculated with the highest enzyme activity defined as 100%.

[0173] The results are as follows Figure 3 As shown in the figure. The results indicate that BRedAm exhibits high activity at 25°C.

[0174] 3.3. Determination of the Tm value and thermal stability of the reductive amination enzyme BaRedAm:

[0175] The Tm value of BaRedAm was determined using differential scanning calorimetry (DSC). The enzyme's unfolding behavior was studied by recording the heat capacity (Cp) at different temperatures (30-80℃), thus determining its Tm value.

[0176] The results are as follows Figure 4 As shown in figure a. The results indicate that the Tm value of BaRedAm is 67℃, which is the highest among currently reported reductive amination enzymes.

[0177] 3.4. Determination of the thermal stability of reductive amination enzyme BaRedAm:

[0178] The enzyme activity of BaRedAm was investigated after treating the enzyme solution at 50℃ for different times (0 min, 20 min, 40 min, 60 min). The reaction system consisted of: 1 mg / mL BaRedAm pure enzyme, 0.7 mg / mL GDH (Aladdin), 30 mM D-glucose, and 1 mM NADP. + 5 mM cyclohexanone, 5 mM cyclopropylamine (in buffer adjusted to pH 9.0), and 2% (v / v) DMSO were added. The final reaction volume was brought to 500 μL using Tris-HCl buffer. The reaction was incubated at 25 °C with shaking at 220 rpm for 24 h. Then, 30 μL of 10 M NaOH was added to quench the reaction. The reaction mixture was extracted twice with 500 μL of methyl tert-butyl ether. The combined upper organic phases were dried over anhydrous MgSO4 and analyzed using GC-FID.

[0179] The results are as follows Figure 4 As shown in b. The results show that the conversion rate of BaRedAm catalyzed reaction remained at 90% after treatment at 50℃ for 60 min, exhibiting high thermal stability and belonging to the category of thermostable reductive amination enzymes.

[0180] 3.5. Substrate profile determination of reductive amination enzyme BaRedAm:

[0181] The reaction system consisted of: 1 mg / mL BaRedAm purified enzyme, 0.7 mg / mL GDH (Aladdin), 30 mM D-glucose, and 1 mM NADP. +5 mM ketone substrate, an appropriate proportion of amine substrate (in buffer adjusted to pH 9.0), and 2% (v / v) DMSO were added. The final reaction volume was brought to 500 μL using Tris-HCl (pH 9.0) buffer. The reaction was incubated at 25 °C with shaking at 220 rpm for 24 h. Then, 30 μL of 10 M NaOH was added to quench the reaction. The reaction mixture was extracted twice with 500 μL of methyl tert-butyl ether. The combined upper organic phases were dried over anhydrous MgSO4 and analyzed by HPLC or GC-FID.

[0182] The results are as follows Figure 5 As shown in the figure. The results indicate that the reductive amination enzyme BaRedAm exhibits a clear preference for amine substrates e and f, and moderate to excellent conversion and reduction capabilities for both aliphatic and aromatic ketone substrates.

[0183] In these reactions, the enzyme catalyzes reactions of equimolar concentrations of ketones and amines, achieving a conversion rate of 92%, such as... Figure 5 The reaction shown in Figure 4f; the conversion of catalytic substrate 1 and cyclopentanone 3 to equimolar amounts of e or f for reductive amination is between 24% and 63%; the reaction of equimolar amounts of benzylamine i and ketone substrate 4 to produce a secondary amine can achieve a conversion of 3%.

[0184] These results all indicate that the enzyme possesses the ability to directly reduce ketones and amine substrates at equimolar equivalents, and can be classified as a true reductive amination enzyme.

[0185] In the reaction catalyzing substrate 2 and 20 molar equivalents of e or f, the conversion rates reached 46% and 88%, respectively, with the ee value of product 2e being 78%. Substrate a and cyclohexanone 4 can also be directly catalyzed by this enzyme to produce cyclohexylamine, with a conversion rate of 73%.

[0186] In reactions that catalyze the formation of secondary amines from substrates benzaldehyde in 6 and 4 molar equivalents of b, e, f, h, or i, the conversion rates range from 12% to 58%.

[0187] In the catalytic reactions of some substrates such as 7 and 8 with amine substrates b, e, and f, the conversion rates range from 11% to 97%. Notably, among the products of these reactions, 4a, 4b, 4f, 4i, 6e, 6h, 7b, and 8f can be used as relevant scaffold precursors in the synthesis of some related drugs.

[0188] In addition, BaRedAm can directly synthesize rasagiline 9e from 1-indanone 9 and propargylamine e with a conversion rate of 14% and an ee value of 22% (S).

[0189] Example 4 Construction and Enzyme Activity Assay of BaRedAm Reductase Mutant

[0190] In this embodiment, based on the reductive amination enzyme BaRedAm's activity in catalyzing the synthesis of rasagiline, the enzyme was rationally designed and selected through protein homology modeling and molecular docking analysis to carry out directed evolutionary modification to obtain a mutant that can catalyze the synthesis of enantiopure rasagiline.

[0191] Using recombinant plasmid pET28a-BaRedAm as a template ( Figure 10 Using a pair of complementary oligonucleotides with a degenerate (NNK) mutation site as primers, full-plasmid PCR amplification was performed with Primestar high-fidelity enzyme to obtain a recombinant plasmid with the specific mutation site. The primer sequences are as follows:

[0192] The mutant corresponding to the one in SEQ NO:2 where glutamine at position 257 is replaced by 19 other amino acids:

[0193] Q257-F:AGTCGTCTGGATATGGNNKGCCGTTGCGC(SEQ ID No: 3)

[0194] Q257-R:MNNCATATCCAGACGACTACCGGTGG(SEQ ID No: 4)

[0195] The amplification system consisted of 20 ng of recombinant plasmid template, 1 μL each of primers (10 μm), 25 μL of PrimeSTAR Max DNA polymerase, and double-distilled water to a final volume of 50 μL. The amplification conditions were: 98°C pre-denaturation for 1 min, 98°C denaturation for 10 s, 60°C annealing for 30 s, and 72°C extension for 1 min 45 s, for a total of 25 cycles. After the reaction, the amplified products were detected by 0.8% agarose gel electrophoresis. The products were purified and recovered using a PCR product purification kit, and digested with DpnI enzyme (NEB) at 37°C for 2 hours to degrade the initial template. The digested products were transformed into E. coli BL21(DE3) competent cells, plated on LB agar plates containing 50 μg / mL kanamycin, and incubated overnight at 37°C. Positive clones were screened and sequenced for verification. A saturated mutant recombinant bacterium with the specified site of the reductase BaRedAm was obtained.

[0196] The purified protein of the saturated mutant at the specified site of the reductase BaRedAm was obtained according to the method in Example 2.

[0197] The reaction system for the mutant enzyme activity assay was as follows: 1 mg / mL mutant purified enzyme, 0.7 mg / mL GDH (Aladdin), 30 mM Md-glucose, and 1 mM NADP. +5 mM 1-indanone, 250 mM propargylamine (in buffer adjusted to pH 9.0), and 2% (v / v) DMSO were added. The final reaction volume was brought to 500 μL using Tris-HCl (pH 9.0) buffer. The reaction was incubated at 25 °C with shaking at 220 rpm for 24 h. Then, 30 μL of 10 M NaOH was added to quench the reaction. The reaction mixture was extracted twice with 500 μL of methyl tert-butyl ether. The combined upper organic phases were dried over anhydrous MgSO4 and analyzed by HPLC or GC-FID.

[0198] The results are as follows Figure 6 As shown in the figure. The results indicate that among the saturated mutants at site 257, most mutants exhibited reduced or even inactivated activity. However, the mutants that remained active showed excellent enantioselectivity to (S)-rasagiline, with an ee value >99%. This site is a key site affecting the catalytic activity of BaRedAm.

[0199] Example 5: Scale-up reaction of reductive aminylase BaRedAm for the synthesis of rasagiline.

[0200] The scale-up reaction conditions for the synthesis of rasagiline were optimized by reacting with different concentrations of 1-indanone (5 mM–50 mM), different concentrations of propargylamine (50 mM–1 M), different concentrations of glucose dehydrogenase (GDH) (0.7 mg / mL–2 mg / mL), or different concentrations of reductive amination enzyme (0.25 mg / mL–2.5 mg / mL), and incubating at 25 °C with shaking at 220 rpm for 24 h. Then, 30 μL of 10 M NaOH was added to quench the reaction. The reaction mixture was extracted twice with 500 μL of methyl tert-butyl ether. The combined upper organic phases were dried over anhydrous MgSO4 and analyzed by HPLC or GC-FID.

[0201] The results are as follows Figure 7 As shown in the figure. The results indicate that a high conversion rate can be obtained when the concentration of 1-indanone is 5 mM, the concentration of propargylamine is 250 mM, and the enzyme loading (GDH concentration 0.7 mg / mL, reductase concentration 1 mg / mL) is moderate.

[0202] The scale-up reaction system for the synthesis of rasagiline consisted of: 1 mg / mL pure enzyme, 0.7 mg / mL GDH (Aladdin), 100 mM D-glucose, and 1 mM NADP. +5 mM 1-indanone, 250 mM propargylamine (in buffer adjusted to pH 9.0), and 2% (v / v) DMSO were added. The final reaction volume was brought to 50 mL using Tris-HCl (pH 9.0) buffer. The reaction was incubated at 25 °C with shaking at 220 rpm for 180 h. 200 μL samples were taken at different time points, and 10 μL of 10 M NaOH was added to quench the reaction. The reaction mixture was extracted twice with 200 μL of methyl tert-butyl ether. The combined upper organic phases were dried over anhydrous MgSO4 and analyzed by HPLC or GC-FID.

[0203] The results are as follows Figure 8 and Figure 9 As shown in the figure. The results indicate that after 180 hours of reaction, the conversion rate of the reductive amination enzyme BaRedAm to rasagiline reached 83%, and the separation yield was 72%.

[0204] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims. SEQUENCE LISTING <110> Shanghai Jiao Tong University <120> Thermostable reductive amination enzymes, their preparation methods and applications <130> P2021-3351 <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 307 <212> PRT <213> Unknown bacteria <400> 1 Met Arg Glu Pro Ile Val Ser Ala His Thr Glu Arg Ala Val Glu Ser 1 5 10 15 Arg Gly Ala Asp Arg Gly Ser Ala Val Thr Val Ile Gly Leu Gly Ser 20 25 30 Met Gly Ser Ala Leu Ala Gly Ala Val Leu Glu Ala Gly Tyr Pro Thr 35 40 45 Thr Val Trp Asn Arg Thr Ala Gly Lys Ala Glu Pro Leu Val Arg Arg 50 55 60 Gly Ala Ala Arg Ala Ala Thr Val Ala Glu Ala Val Ser Ala Ser Pro 65 70 75 80 Thr Val Ile Ala Cys Val Leu Asp Tyr Arg Ala Leu Arg Glu Ile Leu 85 90 95 Ser Thr Ala Gly Asp Ala Leu Ala Gly Arg Thr Val Val Asn Leu Thr 100 105 110 Asn Gly Thr Pro Thr Glu Ala Arg Glu Thr Ala Ala Trp Val Glu Gly 115 120 125 His Gly Ala Arg Tyr Leu Asp Gly Gly Ile Met Ala Val Pro Glu Met 130 135 140 Ile Gly Gly Ala Glu Ser Leu Val Leu Tyr Ser Gly Ser Ala Glu Ala 145 150 155 160 Phe Glu Thr Val Glu Pro Val Leu Arg Arg Phe Gly Ser Ala Met Tyr 165 170 175 Leu Gly Ala Asp Pro Gly Leu Ala Ser Leu His Asp Leu Ala Leu Leu 180 185 190 Ala Gly Met Tyr Gly Leu Phe Ala Gly Phe Leu His Ala Val Ala Leu 195 200 205 Val Gly Thr Glu Gly Val Arg Ala Thr Glu Phe Thr Ser Ser Leu Leu 210 215 220 Ile Pro Trp Leu Gln Ala Met Thr Ala Thr Leu Pro Glu Ala Ala Ala 225 230 235 240 Gln Ile Asp Ala Gly Asp Tyr Ala Ala Thr Gly Ser Arg Leu Asp Met 245 250 255 Gln Ala Val Ala Leu Ala Asn Ile Val Glu Ala Ser Arg Ser Gln Gly 260 265 270 Ile Arg Pro Asp Leu Met Leu Pro Ile Gln Ala Leu Val Glu Arg Arg 275 280 285 Val Ala Lys Gly Gly Gly Gly Glu Asp Ile Ala Ala Val Val Glu Glu 290 295 300 Val Arg Gly 305 <210> 2 <211> 924 <212> DNA <213> Artificial Sequence <400> 2 atgcgtgaac cgatcgtgag cgcgcatacc gaacgcgccg ttgaaagccg tggtgccgat 60 cgcggtagtg cggtgaccgt tattggtctg ggcagtatgg gtagtgccct cgcgggtgcc 120 gttctggaag ccggctatcc aacgaccgtt tggaatcgta cggccggtaa agccgagccg 180 ctggttcgtc gcggcgccgc ccgtgccgcg acggttgccg aagcggttag tgcgagcccg 240 acggtgatcg cgtgcgttct ggattatcgc gcgctgcgcg agattctgag taccgccggt 300 gatgcgctgg ccggtcgtac ggttgtgaat ctcacgaacg gcacgccaac cgaagcgcgt 360 gaaacggcgg cgtgggttga aggccatggt gcccgttatc tggatggcgg tatcatggcg 420 gtgccggaaa tgattggcgg cgcggaaagc ctcgtgctct acagcggcag cgccgaagcg 480 ttcgaaaccg ttgaaccggt tctgcgccgc ttcggcagtg cgatgtatct gggtgcggat 540 ccgggtctgg ccagtctgca cgatctggcg ctgctggcgg gcatgtatgg tctgttcgcc 600 ggctttctgc atgcggttgc gctggttggt accgagggtg ttcgtgccac cgaatttacc 660 agcagtctgc tcatcccgtg gctgcaagcc atgaccgcca cgctgccaga agcggcggcg 720 caaattgatg ccggtgatta cgccgccacc ggtagtcgtc tggatatgca agccgttgcg 780 ctggcgaaca tcgtggaagc cagtcgcagc caaggcattc gcccggatct gatgctccca atccaagccc tcgtggaacg tcgcgtggcc aaaggtggcg gtggcgaaga tatcgccgcg 900. gttgttgaag aagtgcgcgg ttaa <210> 3 <211> 28 <212> DNA <213> Private Sequence(Artificial Sequence) <220> <221> misc_feature <222> (16)..(17) <223> n is a, c, g, or t <400> 3 agtcgtctgg atatgnnkgc cgttgcgc <210> 4 <211> 26 <212> DNA <213> Private Sequence(Artificial Sequence) <220> <221> misc_feature <222> (2)..(3) <223> n is a, c, g, or t <400> 4 mnncatatcc agacgacc cggtgg

Claims

1. An in vitro reductive amination method, characterized in that, Including the following steps: (i) In the presence of the thermostable reductive amination enzyme BaRedAm, the (S1) ketone or aldehyde substrate undergoes a reductive amination reaction with the (S2) amine substrate; The reductive amination enzyme BaRedAm is a polypeptide with the amino acid sequence shown in SEQ ID NO:

1.

2. The method as described in claim 1, characterized in that, The method includes: In the presence of the thermostable reductive amination enzyme BaRedAm, the ketone or aldehyde substrate shown in Formula Z1 and the amine substrate shown in Formula Z2 undergo a reductive amination reaction to form the reductive amination product shown in Formula I: in R1 is a substituted or unsubstituted alkyl, a substituted or unsubstituted aryl, a substituted or unsubstituted (C1-C6 alkylene)-phenyl, wherein the substitution means that one or more H atoms are substituted by a substituent selected from the group consisting of: C1-C3 alkyl, C2-C4 alkenyl, C2-C4 ynyl, C3-C6 cycloalkyl, halogen, or a combination thereof. R2 is H or methyl; Alternatively, R1 and R2 together with the attached C atom can form a substituted or unsubstituted 4-10 membered heterocycle; R3 is H, a substituted or unsubstituted C1-C8 alkyl, a substituted or unsubstituted C2-C8 alkenyl, a substituted or unsubstituted C2-C8 ynyl, a substituted or unsubstituted C3-C8 cycloalkyl, a substituted or unsubstituted 6-10 aryl, a substituted or unsubstituted (C1-C6 alkylene)-phenyl, a substituted or unsubstituted (C3-C6 cycloalkylene)-phenyl, wherein the substitution refers to one or more H atoms being substituted by a substituent selected from the group consisting of: C1-C3 alkyl, C2-C4 alkenyl, C2-C4 ynyl, C3-C6 cycloalkyl, halogen, or a combination thereof.

3. The method as described in claim 2, characterized in that, The substitution refers to the substitution of one or more H atoms by a substituent selected from the group consisting of C1-C3 alkyl, C3-C6 cycloalkyl, halogen, C2-C6 ester, or a combination thereof.

4. The method as described in claim 2, characterized in that, The reduced amination product shown in Formula I is a chiral amine compound.

5. An isolated or purified reductive amination enzyme, characterized in that, The reductive amination enzyme is obtained by mutating the sequence shown in SEQ ID No:1, and the mutation is selected from the following group: Q257I, Q257C, Q257F, Q257M, Q257L, Q257K, Q257Y.

6. An isolated polynucleotide, characterized in that, The polynucleotide encodes the reductase described in claim 5.

7. A carrier, characterized in that, The carrier contains the polynucleotide as described in claim 6.

8. A genetically engineered host cell, characterized in that, The host cell contains the vector of claim 7, or the polynucleotide of claim 6 is integrated into its genome.

9. The use of the reductive amination enzyme according to claim 5 or the wild-type thermostable reductive amination enzyme BaRedAm, characterized in that, It is used in catalytic reductive amination reactions, or in the preparation of catalytic agents for catalytic reductive amination reactions; The wild-type thermostable reductive amination enzyme BaRedAm is a polypeptide with the amino acid sequence shown in SEQ ID NO:

1.

10. A method for synthesizing rasagiline in vitro using a reductive amination enzyme, characterized in that, Including the following steps: In the presence of the reductive amination enzyme as described in claim 5 or the wild-type thermostable reductive amination enzyme BaRedAm, 1-indanone and propargylamine are catalyzed to react to produce rasagiline. The wild-type thermostable reductive amination enzyme BaRedAm is a polypeptide with the amino acid sequence shown in SEQ ID NO:

1.

11. A reaction system for carrying out a reductive amination reaction, characterized in that, The reaction system includes: (S0) The reductive amination enzyme of claim 5 or the wild-type thermostable reductive amination enzyme BaRedAm; (S1) Ketone or aldehyde substrates; (S2) Amine substrate; and (S3) Optional NADPH or NADPH regeneration module; The wild-type thermostable reductive amination enzyme BaRedAm is a polypeptide with the amino acid sequence shown in SEQ ID NO:

1.

12. The reaction system as described in claim 11, characterized in that, The NADPH regeneration module includes glucose dehydrogenase (GDH) and glucose.

Images