Rapid identification kit for plasmodium falciparum based on rpa-crispr / cas12a fluorescent system

Abstract

The application discloses a kit for rapidly identifying malignant plasmodium based on an RPA-CRISPR / Cas12a fluorescence system and belongs to the field of detection and testing. The kit comprises a malignant plasmodium RPA specific primer pair, a crRNA fragment, a fluorescence reporter probe, and a buffer and Cas12a protein for a CRISPR reaction. The application is based on RPA technology, CRISPR / Cas12a technology and fluorescence detection technology, and a kit and a detection method for rapidly, accurately, simply and specifically detecting and identifying malignant plasmodium are constructed. The kit and the detection method can be used for detecting malignant plasmodium in a wild or clinical environment, especially in a country with limited resources, and the detection method does not require expensive instruments and equipment and a professional standard laboratory, and therefore has important significance for malaria monitoring, diagnosis and prevention and control.

Description

Technical Field

[0001] This invention relates to the field of detection and testing, and in particular to a kit for rapid identification of Plasmodium falciparum based on the RPA-CRISPR / Cas12a fluorescence system. Background Technology

[0002] Plasmodium falciparum (Pf) is the most virulent species of malaria parasite, causing the vast majority of deaths in sub-Saharan Africa, primarily among young children and pregnant women. In Ethiopia, Pf infection accounts for the majority of malaria deaths, approximately 70% of all cases. Rapid and accurate diagnosis and treatment of malaria patients are crucial components of malaria control. Diagnosis is typically achieved through a combination of reactive diagnoses (RDT) and microscopic examination. Microscopic examination is the gold standard for malaria diagnosis, and RDT is the only point-of-care testing (POCT) method that can be performed in the field and used in community health centers to screen for asymptomatic infections. However, most RDT tests for Pf target specific histidine-rich protein II (HRP2) or histidine-rich protein III (HRP3) genes. Deletion of the HRP2 or HRP3 genes can lead to false negative results and pose a significant threat to malaria control and elimination efforts. HRP2 is a highly expressed secreted protein, making it an ideal diagnostic target and a target for next-generation ultrasensitive reactive diagnostic tests (RDTs), with a detection limit of >100 p / μL. While alternative RDT methods exist that detect other proteins, such as parasite lactase dehydrogenase (pLDH) or aldolases, they typically have lower sensitivity. Therefore, developing a rapid and highly sensitive detection method is crucial for malaria control and elimination efforts. Summary of the Invention

[0003] The purpose of this invention is to provide a kit for rapid identification of Plasmodium falciparum based on the RPA-CRISPR / Cas12a fluorescence system, in order to solve the problems existing in the prior art. This kit has the advantages of high sensitivity and high specificity in detecting Plasmodium falciparum, and does not require special equipment or high laboratory requirements. It is suitable for rapid on-site identification of imported malaria and rapid identification of Plasmodium falciparum in resource-scarce areas.

[0004] To achieve the above objectives, the present invention provides the following solution:

[0005] This invention provides an RPA-specific primer pair, the nucleotide sequence of which is shown in SEQ ID NO: 1-2.

[0006] The present invention also provides a crRNA fragment, the nucleotide sequence of which is shown in SEQ ID NO: 3.

[0007] The present invention also provides a kit for rapid identification of Plasmodium falciparum based on the RPA-CRISPR / Cas12a fluorescence system, the kit comprising the RPA-specific primer pair, the crRNA fragment, the fluorescent reporter probe, and buffer and Cas12a protein for CRISPR reaction.

[0008] Preferably, the nucleotide sequence of the fluorescent reporter probe is: 5'-FAM-TTTTTT-BHQ1-3'.

[0009] Preferably, when amplifying the Plasmodium falciparum gene using the RPA-specific primer pair, the amplification reaction system used is as follows: 29.4 μL buffer, 2.0 μL each of upstream and downstream primers, 2.0 μL DNA template, and double-distilled water to make up to 47.5 μL;

[0010] The amplification reaction conditions used were: 39℃ for 20 min.

[0011] Preferably, when using the kit to detect Plasmodium falciparum, the detection system is as follows: 2.0 μL of 10× buffer, 7.0 μL of LbCas12a, 2.0 μL of crRNA, 1.0 μL of fluorescent reporter probe, 5.0 μL of RPA amplification product, and then replenished to 20 μL with enzyme-free sterile water.

[0012] The present invention also provides the application of the kit in the detection of Plasmodium falciparum for non-diagnostic purposes.

[0013] This invention also provides a method for detecting Plasmodium falciparum using the kit for non-diagnostic purposes. The method uses the genomic DNA of the sample to be tested as a template, performs an RPA reaction using RPA-specific primer pairs, performs a Cas12a visual enzyme digestion reaction on the RPA amplification product using crRNA fragments and fluorescent reporter probes, and detects the cleavage site using a fluorescent detection device to detect whether the sample to be tested is infected with Plasmodium falciparum.

[0014] Preferably, if the test sample exhibits the same fluorescence as the positive control, the test sample is considered to be infected with Plasmodium falciparum.

[0015] The present invention discloses the following technical effects:

[0016] This invention establishes an RPA-CRISPR / Cas12a detection kit targeting the conserved 18S rRNA gene of Plasmodium falciparum. This kit avoids the missed diagnoses that occur with traditional Plasmodium-specific histidine-rich protein II or histidine-rich protein III detection methods, providing a new rapid identification kit for Plasmodium falciparum control. Experimental verification shows that this kit overcomes the drawbacks of other Plasmodium detection methods, such as cumbersome operation, long processing time, high cost, and missed detections. It requires only simple detection equipment to achieve visualized detection results with good accuracy and specificity. It is suitable for rapid on-site detection of imported malaria and rapid identification of Plasmodium falciparum in resource-scarce areas. However, to achieve widespread clinical application, the kit still needs to be tested on a large number of clinical specimens. Furthermore, this invention does not require expensive instruments or specialized standard laboratories for detecting Plasmodium falciparum, which is of great significance for malaria surveillance, diagnosis, and control. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is a schematic diagram of the RPA-CRISPR / Cas12a system.

[0019] Figure 2 Figure 1 shows the results of the kit's sensitivity test; A: Results of the sensitivity test of the Plasmodium falciparum RPA-CRISPR / Cas12a detection kit under a fluorescence detection device; B: Statistical results of the detection data in Figure A; C: Results of the sensitivity test of the Plasmodium falciparum RPA-CRISPR / Cas12a detection kit under a UV lamp.

[0020] Figure 3Figures A and B show the results of specific experiments. A: Gel imaging results of the Plasmodium falciparum RPA-CRISPR / Cas12a detection platform; B: Specificity experiment results of the Plasmodium falciparum RPA-CRISPR / Cas12a detection kit under UV light; C: Specificity experiment results of the Plasmodium falciparum RPA-CRISPR / Cas12a detection kit under fluorescence detection equipment. In figures A and B, M: Marker; NEG: Negative control; S1: Human genomic DNA; S2: Hepatitis A virus; S3: Hepatitis B virus; S4: Hepatitis C virus; S5: Hepatitis D virus; S6: Syphilis; S7: Human immunodeficiency virus; Pm: Plasmodium malariae; Po: Plasmodium ovale; Pv: Plasmodium vivax; Pf: Plasmodium falciparum. Detailed Implementation

[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0022] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0023] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0024] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0025] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0026] This invention essentially constructs an RPA-CRISPR / Cas12a fluorescence detection kit, which refers to a technique that combines recombinase polymerase isothermal amplification technology with CRISPR / Cas12a technology and fluorescence technology for the rapid identification of Plasmodium falciparum. Its principle is as follows: Figure 1 As shown. Recombinase polymerase isothermal amplification (RPA) is a technique for isothermal amplification of target genes, using recombinase and polymerase as core components and single-stranded binding proteins as auxiliary components. This technique can rapidly amplify target fragments within a short time (20 min) under isothermal (37-42℃) conditions. CRISPR / Cas12a belongs to the second type of effector protein in the CRISPR system. It exerts endonuclease activity at the target site in a RNA-guided manner and exhibits its non-specific enzymatic activity. In this study, the target sample was amplified using Plasmodium falciparum primers at 39℃ to enrich the target fragment; based on the characteristic of LbCas12a crRNA recognizing "TTTN", a Plasmodium falciparum-specific crRNA was designed on the target sequence. When the target, LbCas12a protein, and crRNA are present simultaneously, the LbCas12a protein is activated and exerts its non-specific cleavage ability. The LbCas12a protein cleaves the single-stranded DNA reporter in the reaction system, and the cleavage products are detected by fluorescence detection equipment or ultraviolet light, thereby detecting whether the sample is infected with Plasmodium falciparum.

[0027] Some of the reagents used in the following examples:

[0028] (1) The RPA reagent kit was purchased from TwistDx, UK (product code: TALQBAS01);

[0029] (2) The nucleic acid extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd. (product code: DP334);

[0030] (3) LbCas12a purchased Tolo Biotechnology Co., Ltd. (product code: 32108-01);

[0031] (4) Primers, crRNA and fluorescent reporter (FQ-Reporter) were ordered from Suzhou Genewiz Biotechnology Co., Ltd.

[0032] To further illustrate the technical concept and working principle of the present invention, specific embodiments are described below.

[0033] Example 1

[0034] 1. Nucleic acid extraction

[0035] Malaria genomic DNA was extracted from dried blood spots using the dried blood spot genomic DNA extraction kit manufactured by Tiangen Biotech (Beijing) Co., Ltd., strictly following the instructions. The A260 / 280 and A260 / 230 ratios were measured using a Nanodrop 2000c to determine sample purity. The DNA samples met the following standards: A260 / 280 = 1.8; A260 / 230 = 2.0-2.2. After quality control, the samples were stored at -80℃ until use.

[0036] 2. Primer design

[0037] Using BioEdit 7.19 software, we performed homology comparisons on the 18S rRNA genes of four Plasmodium species (Plasmodium falciparum / GenBank: M19173.1, Plasmodium ovale / GenBank: AB182490.1, Plasmodium vivax / GenBank: U07367.1, and Plasmodium malariae / GenBank: AF487999.1), as well as the sequences of human genomic DNA (gDNA), hepatitis A virus (HAV) gDNA, hepatitis B virus (HBV) gDNA, hepatitis C virus (HCV) gDNA, hepatitis D virus (HDV) gDNA, syphilis gDNA, and human immunodeficiency virus (HIV) gDNA. Specific primers were designed for specific regions of Plasmodium falciparum (Table 1). The primers designed in this experiment were validated for primer specificity using NCBI's primer-BLAST, and then synthesized by Suzhou Genewiz Biotechnology Co., Ltd.

[0038] Table 1 Primer sequences for Plasmodium falciparum

[0039]

[0040] 3. Plasmid preparation

[0041] Based on the target region (SEQ ID NO: 4) amplified using RPA Plasmodium falciparum-specific primers, the pUC-GW-Kan plasmid was constructed by Suzhou Genewiz Biotechnology Co., Ltd. The synthesized plasmid was serially diluted 10-fold with ddH2O (double-distilled water) and stored at -20℃ for later use.

[0042] Plasmid sequence (SEQ ID NO: 4):

[0043] GTGTTCATAACAGACGGGTAGTCATGATTGAGTTCATTGTGTTTGAATACTACAGCA TGGAATAACAAATATGAATAAGCTAATTATTTTTTTTTTTCATTTTTTTTTGATATTCTTAT TAGCTTAGTTACGATTAATAGGAGTAGCTTTGGGGGCATTCGTATTCAGATGT.

[0044] 4. Design of CRISPR / Cas12a RNA (crRNA)

[0045] Based on the CRISPR / Cas12a protein's recognition of the PAM site, the binding target sequence characteristics were determined. Using CRISPR-DT (http: / / bioinfolab.miamioh.edu / CRISPR-DT), Plasmodium falciparum-specific crRNAs were designed on the RPA-amplified target sequence (Table 1), and the targeting efficiency of the crRNAs was calculated. All crRNAs were synthesized by Suzhou Genewiz Biotechnology Co., Ltd. The synthesized crRNAs were diluted to a concentration of 10 μM with enzyme-free sterile water (product code: 10202-01), aliquoted into 20 μL tubes, and stored at -80℃ for later use.

[0046] 5. RPA amplification

[0047] Using plasmids or Plasmodium falciparum gDNA as templates, amplification was performed using the basic RPA kit (product code: TALQBAS01) from TwistDx (UK). The reaction system is as follows:

[0048] Table 2 Reaction System

[0049]

[0050] The order of sample addition is negative control sample, test sample, or recombinant plasmid. After each sample is added, the tube cap must be closed immediately to prevent aerosol contamination. Mix the above reaction system thoroughly and add it to the basic reaction unit. Allow the lyophilized powder to dissolve completely. Open the reaction unit and add 2.5 μL (280 mM) of MgAc to each 0.2 mL Eppendorf tube. Mix thoroughly and collect by centrifugation. Place the reaction tube at 39°C for 20 min.

[0051] 6. RPA-CRISPR / Cas12a detection

[0052] The detection system of the RPA-CRISPR / Cas12a system is shown in the table below:

[0053] Table 3 Detection System

[0054]

[0055]

[0056] The order of sample addition is negative control sample, test sample, or recombinant plasmid. After each sample is added, the tube cap must be immediately closed to prevent aerosol contamination. The reaction system is thoroughly mixed and collected by centrifugation. The reaction tube is then placed in a fluorescence PCR instrument (Shanghai Hongshi Medical Technology Co., Ltd., SLAN 96S) and reacted at 42℃ for 30 min. The RPA product is then digested using LbCas12a, and the fluorescence signal is collected using the fluorescence PCR instrument. Data is processed and images are generated using Excel 2019 software. Additionally, the fluorescent tubes after the reaction are placed under UV light, and the detection results are observed visually.

[0057] 7. Sensitivity testing

[0058] Based on the above reaction system and conditions, the constructed recombinant plasmid was serially diluted. Plasmids of 1 copy / μL, 10 copy / μL, 100 copy / μL, and 1000 copy / μL were used as templates to determine the detection threshold of the RPA-CRISPR / Cas12a kit for Plasmodium falciparum recombinant plasmids. Results are as follows: Figure 2 As shown, this kit has excellent sensitivity and can detect recombinant plasmid concentrations as low as 1 copy / μL.

[0059] 8. Specific detection

[0060] Based on the above reaction conditions and system, the specificity of the RPA-CRISPR / Cas12a kit was evaluated. Four types of Plasmodium gDNA, human gDNA, HAV gDNA, HBV gDNA, HCV gDNA, HDV gDNA, syphilis gDNA, and HIV gDNA were used as templates for evaluation. The experimental results are as follows: Figure 3 As shown, the Plasmodium falciparum RPA-CRISPR / Cas12a detection kit has high specificity, with no detection signal in Plasmodium mimicum and blank control, and no cross-reaction with other pathogens.

[0061] Example 2: RPA-CRISPR / Cas12a detection of actual samples

[0062] To validate the Plasmodium falciparum RPA-CRISPR / Cas12a detection kit, which enables rapid identification of Plasmodium falciparum infection after sample collection, our laboratory has preserved a large number of peripheral venous blood DBS samples from imported Plasmodium-infected patients in Southeast Asia, Africa, and my country, based on previous research. According to the Plasmodium density count (this step was completed at the previous sampling sites), 25 clinical samples were randomly selected for testing, of which 16 were positive and 9 were negative under microscopic examination. Genomic DNA was extracted from the samples using a genomic DNA extraction kit, and the extracted Plasmodium gDNA was detected using the RPA-CRISPR / Cas12a kit. The results are shown in Table 4: 16 samples were positive for Plasmodium falciparum, and 9 were negative, consistent with the microscopic examination results.

[0063] Table 4 Summary of actual samples detected by the RPA-CRISPR / Cas12a kit

[0064]

[0065] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of a kit for rapid identification of Plasmodium falciparum based on the RPA-CRISPR / Cas12a fluorescence system in the detection of Plasmodium falciparum for non-diagnostic purposes, characterized in that, The kit includes RPA-specific primer pairs, crRNA fragments, fluorescent reporter probes, and buffers and Cas12a protein for CRISPR reactions; The nucleotide sequences of the RPA-specific primer pairs are shown in SEQ ID NO: 1-2; The nucleotide sequence of the crRNA fragment is shown in SEQ ID NO: 3; The nucleotide sequence of the fluorescent reporter probe is: 5'-FAM-TTTTTT-BHQ1-3'; When amplifying the Plasmodium falciparum gene using the RPA-specific primer pair, the amplification reaction system used is as follows: 29.4 μL buffer, 2.0 μL each of upstream and downstream primers, 2.0 μL DNA template, and double-distilled water to make up to 47.5 μL; The amplification reaction conditions used were: 39℃ for 20 min; When using RPA-CRISPR / Cas12a to detect Plasmodium falciparum, the detection system used was as follows: 2.0 μL of 10× buffer, 7.0 μL of LbCas12a, 2.0 μL of crRNA, 2.0 μL of fluorescent reporter probe, and 5.0 μL of RPA amplification product, which was then replenished to 20 μL with enzyme-free sterile water. The detection conditions were: reaction at 42℃ for 30 min.

2. A kit for rapid identification of Plasmodium falciparum based on the RPA-CRISPR / Cas12a fluorescence system, characterized in that, The kit includes RPA-specific primer pairs, crRNA fragments, fluorescent reporter probes, and buffers and Cas12a protein for CRISPR reactions; The nucleotide sequences of the RPA-specific primer pairs are shown in SEQ ID NO: 1-2; The nucleotide sequence of the crRNA fragment is shown in SEQ ID NO: 3; The nucleotide sequence of the fluorescent reporter probe is: 5'-FAM-TTTTTT-BHQ1-3'; When amplifying the Plasmodium falciparum gene using the RPA-specific primer pair, the amplification reaction system used is as follows: 29.4 μL buffer, 2.0 μL each of upstream and downstream primers, 2.0 μL DNA template, and double-distilled water to make up to 47.5 μL; The amplification reaction conditions used were: 39℃ for 20 min; When using the kit to detect Plasmodium falciparum, the detection system is as follows: 2.0 μL of 10× buffer, 7.0 μL of LbCas12a, 2.0 μL of crRNA, 2.0 μL of fluorescent reporter probe, 5.0 μL of RPA amplification product, and enzyme-free sterile water to make up to 20 μL; the detection conditions are: reaction at 42℃ for 30 min.

3. A method for detecting Plasmodium falciparum using the kit described in claim 2 for non-diagnostic purposes, characterized in that, Using genomic DNA from the sample as a template, an RPA reaction was performed with RPA-specific primers. The RPA amplification product was then subjected to Cas12a visualization digestion using crRNA fragments and a fluorescent reporter probe. The cleavage site was detected using a fluorescence detection device, thereby determining whether the sample was infected with Plasmodium falciparum.

4. The method according to claim 3, characterized in that, If the test sample exhibits the same fluorescence as the positive control, it is considered that the test sample is infected with Plasmodium falciparum.

Images