An engineered strain for producing recombinant quail IFN-α, recombinant quail IFN-α and its preparation method

Abstract

This invention relates to an engineered strain for producing recombinant quail IFN-α, the recombinant quail IFN-α, and its preparation method. It belongs to the field of bioengineering. The process involves removing the signal peptide and transmembrane region from the quail interferon α gene sequence, optimizing the Pichia pastoris codon, and artificially synthesizing the recombinant quail interferon α gene. The optimized quail interferon α gene is then directionally cloned into the eukaryotic expression plasmid pPIC9K to construct a recombinant plasmid. This plasmid is then transformed into Pichia pastoris X-33 competent cells to screen for engineered strains. The resulting engineered strains are used to produce recombinant quail interferon α. ​​The recombinant quail interferon α exhibits an antiviral activity of 1.0 × 10⁻⁶. 4 U / mL, with a specific activity of 1.77 × 10⁻⁶ U / mL. 4 The yield reaches 20 mg / L (U / mg); recombinant quail interferon-α can improve quail immunity and enhance their disease resistance. The preparation method of this invention can guarantee the activity and yield of recombinant quail IFN-α, meeting the needs of large-scale industrial protein production.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, and particularly relates to an engineered strain for producing recombinant quail IFN-α, recombinant quail IFN-α and its preparation method. Background Technology

[0002] Quail are an important economic animal in my country, with the largest quail farming industry in the world. However, certain highly contagious diseases such as Newcastle disease and avian influenza seriously threaten the development of the quail farming industry. Currently, my country lacks dedicated veterinary drugs for quail. Therefore, developing quail-specific immunization and prevention products (vaccines, diagnostic reagents, drugs, probiotics, etc.) is of great significance for ensuring the healthy and sustainable development of the quail industry.

[0003] Interferons (IFNs) are a class of glycoproteins with various physiological activities, including antiviral, immunomodulatory, and antitumor activity. Based on their binding to different host cell surface receptors, interferons can be classified into type I (IFN-α, IFN-β), type II (IFN-γ), and type III (IFN-λ). After binding to specific receptors on the cell surface, interferons trigger a cascade reaction (such as the JAK-STAT pathway), initiating the transcription and translation of antiviral-related genes in the nucleus (such as PKR, IRF7, ISG15, Mx1, and OAS). Different types of interferons have played important roles in the prevention and control of animal diseases. Interferons can interfere with viral replication, protect cells from viral infection, and possess excellent antiviral and immunomodulatory functions, making them ideal antiviral biological agents. For example, recombinant porcine IFN-α developed by Dong Shijuan et al. can inhibit the replication of PRRSV in vivo and in vitro (Dong Shijuan. Preparation and freeze-drying process of recombinant porcine α-interferon and its anti-PRRSV replication effect in vivo and in vitro [D]. Nanjing Agricultural University, 2018); recombinant chicken IFN-α developed by Hou Fengxiang et al. can inhibit the proliferation of NDV and AIV in chicken embryo fibroblasts, and has an immunomodulatory effect on H9N2 subtype avian influenza inactivated vaccine (Hou Fengxiang. Study on the structure and function of recombinant chicken α-interferon and its antiviral activity [D]. Nanjing Agricultural University, 2009); recombinant canine IFN-α4 and IFN-α2 developed by Wang Jingyu et al. have high activity, reaching 1.19×10⁻⁶ respectively. 5 U / mL and 1.70×10 6 U / mL (Wang Jingyu. Expression and antiviral activity analysis of canine interferon α4 and α2 genes [D]. Nanjing Agricultural University, 2017).

[0004] Currently, the preparation of recombinant quail interferon using genetic engineering technology mainly relies on the Escherichia coli expression system. For example, the IFN-α of white-feathered quail expressed using E. coli, developed by Guo Guangyang et al., exhibits good biological activity (Guo Guangyang; Zhao Panpan; Zhang Kexin; Guo Ying; Xing Mingwei. Cloning, genetic evolution and prokaryotic expression of IFN-α gene in white-feathered quail [J]. Heilongjiang Journal of Animal Husbandry and Veterinary Medicine, 2017, No. 3); and Liu Zixin et al. reported that the IFN-γ of white-feathered quail expressed using E. coli also exhibits good biological activity (Liu Zixin; Zhao Hongjing; Wang Yu; Tao Jin; Xing Mingwei. Cloning, sequence analysis and prokaryotic expression of IFN-γ gene in white-feathered quail [J]. Chinese Journal of Veterinary Medicine, 2018, No. 2). However, the recombinant proteins prepared using the E. coli expression system have the following drawbacks, such as loss of inclusion bodies due to denaturation and renaturation, residual endotoxins, and the relatively cumbersome purification steps and low protein modification levels. Summary of the Invention

[0005] To address the problems of inclusion body denaturation and renaturation loss, endotoxin residue, cumbersome purification steps, and low protein modification levels in the existing E. coli expression system for preparing recombinant quail interferon, this invention provides an engineered strain for producing recombinant quail IFN-α, recombinant quail IFN-α, and its preparation method.

[0006] The technical solution adopted by this invention to solve the technical problem is as follows:

[0007] This invention provides a method for preparing an engineered strain for producing recombinant quail IFN-α, specifically including the following steps:

[0008] (1) Optimization and synthesis of quail IFN-α gene;

[0009] Based on the quail IFN-α gene sequence information, the signal peptide and transmembrane region were removed from the sequence, and 6 histidine residues were added to the end of the sequence; codon optimization was performed for Pichia pastoris cells, and restriction endonuclease sites EcoRI and NotI were introduced at both ends of the sequence, respectively; the optimized quail IFN-α gene nucleotide sequence is shown in SEQ ID NO:1, and the corresponding encoded amino acid sequence is shown in SEQ ID NO:2;

[0010] (2) Construct the recombinant plasmid pPIC9K-quailIFNα;

[0011] The quail IFN-α gene and pPIC9K vector were digested with restriction endonucleases EcoR I and Not I. The target fragment was recovered by 1% agarose gel electrophoresis, and the target fragment was ligated with T4 ligase and transformed into E. coli DH5α competent cells. The cells were plated and cultured overnight. The next day, single colonies were picked and sequenced. The correctly identified recombinant plasmid was named pPIC9K-quailIFNα and stored at -20℃ for later use.

[0012] (3) Constructing engineered strains;

[0013] The recombinant plasmid pPIC9K-quailIFNα was linearized with restriction endonuclease Sal I and added to Pichia pastoris X-33 competent cells. After mixing, the cells were transferred to a pre-cooled electroporation cuvette for an ice bath, and then transferred to an electroporator. After electroporation, pre-cooled sorbitol was added, and the cells were pipetted and transferred to centrifuge tubes. The cells were incubated statically at 25℃-30℃, centrifuged at room temperature to collect the cells, and resuspended in YPG medium. The cells were then spread onto YPG solid medium containing bleomycin for further culture. Single colonies were picked for PCR identification. After successful identification, the engineered strain for expressing recombinant quail IFN-α was obtained, and its nucleotide sequence is shown in SEQ ID NO:3.

[0014] As a preferred embodiment, in step (3) above, centrifugation is performed at 4000 r / min for 4 min at room temperature.

[0015] The present invention also provides an engineered strain for producing recombinant quail IFN-α, which is prepared by the above-described preparation method.

[0016] The present invention also provides a recombinant quail IFN-α, which is prepared using the above-mentioned engineered strain.

[0017] This invention also provides a method for preparing recombinant quail IFN-α, specifically including the following steps:

[0018] (1) Optimization and synthesis of quail IFN-α gene;

[0019] Based on the quail IFN-α gene sequence information, the signal peptide and transmembrane region were removed from the sequence, and 6 histidine residues were added to the end of the sequence; codon optimization was performed for Pichia pastoris cells, and restriction endonuclease sites EcoRI and NotI were introduced at both ends of the sequence, respectively; the optimized quail IFN-α gene nucleotide sequence is shown in SEQ ID NO:1, and the corresponding encoded amino acid sequence is shown in SEQ ID NO:2;

[0020] (2) Construct the recombinant plasmid pPIC9K-quailIFNα;

[0021] The quail IFN-α gene and pPIC9K vector were digested with restriction endonucleases EcoR I and Not I. The target fragment was recovered by 1% agarose gel electrophoresis, and the target fragment was ligated with T4 ligase and transformed into E. coli DH5α competent cells. The cells were plated and cultured overnight. The next day, single colonies were picked and sequenced. The correctly identified recombinant plasmid was named pPIC9K-quailIFNα and stored at -20℃ for later use.

[0022] (3) Constructing engineered strains;

[0023] The recombinant plasmid pPIC9K-quailIFNα was linearized with restriction endonuclease Sal I, added to Pichia pastoris X-33 competent cells, mixed well, and transferred to a pre-cooled electroporation cuvette for an ice bath, followed by transfer to an electroporator. After electroporation, pre-cooled sorbitol was added, and the mixture was pipetted and transferred to centrifuge tubes. The cells were incubated statically at 25℃-30℃, centrifuged at room temperature to collect the cells, resuspended in YPG medium, and plated onto YPG solid medium containing bleomycin for further culture. Single colonies were picked for PCR identification. After successful identification, the engineered strain for expressing recombinant quail IFN-α was obtained, and its nucleotide sequence is shown in SEQ ID NO:3.

[0024] (4) Preparation of recombinant quail IFN-α;

[0025] The constructed engineered strain was inoculated into YPG culture medium for rejuvenation. The next day, it was inoculated into a shake flask containing YPG culture medium and cultured overnight at 25-31℃ and 190-210 r / min. The cells were collected by centrifugation, resuspended in an equal volume of BMMY liquid medium, and induced at 25-31℃ and 190-210 r / min for 100-140 hours. The supernatant was collected and purified to obtain recombinant quail IFN-α.

[0026] As a preferred embodiment, in step (4), the inoculum is inoculated into a shake flask containing YPG culture medium the next day and cultured overnight at 28°C and 200 r / min.

[0027] As a preferred embodiment, in step (4), the induction is carried out at 28°C and 200r / min for 120 hours, and methanol with a final concentration of 0.5% is added every 24 hours.

[0028] The beneficial effects of this invention are:

[0029] This invention involves removing the signal peptide and transmembrane region from the quail interferon α gene sequence, optimizing the Pichia pastoris codon, and artificially synthesizing the gene. The optimized quail interferon α gene is then directionally cloned into the eukaryotic expression plasmid pPIC9K to construct the recombinant plasmid pPIC9K-quailIFNα. This recombinant plasmid pPIC9K-quailIFNα is transformed into Pichia pastoris X-33 competent cells to screen for engineered strains used to produce recombinant quail IFN-α. Simultaneously, the obtained engineered strains are used to produce recombinant quail interferon α. ​​The obtained recombinant quail interferon α exhibits an antiviral activity of 1.0 × 10⁻⁶. 4 U / mL, with a specific activity of 1.77 × 10⁻⁶ U / mL. 4 The yield can reach 20 mg / L (U / mg). The obtained recombinant quail interferon α has the advantages of high efficiency, stability, and high degree of glycosylation. Recombinant quail IFN-α can stimulate cells to increase the transcription level of PKR and Mx genes, exhibiting significant biological activity, and can be used to improve the immunity and disease resistance of quail. In addition, compared with the prior art, the preparation method of this invention solves the problems of inclusion body denaturation and renaturation loss, endotoxin residue, cumbersome purification steps, and low protein modification level when using the E. coli expression system to prepare recombinant quail interferon. It can ensure the activity, yield, and safety of recombinant quail IFN-α, while meeting the needs of large-scale, industrialized protein production. Attached Figure Description

[0030] Figure 1 This is a construction map of the recombinant plasmid pPIC9K-quailIFNα in Example 2;

[0031] Figure 2 The results of PCR identification of the engineered strain of recombinant quail IFN-α in Example 3;

[0032] Figure 3 The results of Western blot identification of recombinant quail IFN-α in Example 4;

[0033] Figure 4 This refers to the transcriptional levels of PKR and Mx genes in DF-1 cells after recombinant quail IFN-α was inoculated into the cells in Example 5. Detailed Implementation

[0034] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0035] Material:

[0036] The pPIC9K carrier was purchased from Thermo Fisher Scientific (China) Co., Ltd.

[0037] Restriction endonucleases EcoRI, NotI, SalI, T4 ligase, and E. coli DH5α competent cells were all purchased from BioRi Biotechnology (Beijing) Co., Ltd.

[0038] Pichia pastoris X-33 competent cells were purchased from Changsha Aikebo Biotechnology Co., Ltd.

[0039] The electroporation device was purchased from Bio-Rad Life Sciences (Shanghai) Co., Ltd.

[0040] Sorbitol, bleomycin, and affinity chromatography column were all purchased from Shanghai Beyotime Biotechnology Co., Ltd.

[0041] YPG medium and BMMY liquid medium were both purchased from Beijing Solarbio Science & Technology Co., Ltd.

[0042] DF-1 cells were preserved by the Veterinary Research Institute of Jiangsu Academy of Agricultural Sciences;

[0043] The total RNA extraction kit was purchased from Beijing Jinsha Biotechnology Co., Ltd.

[0044] Example 1: Optimization and Synthesis of Quail IFN-α Gene

[0045] Based on the sequence information of the quail IFN-α gene (GenBank accession number: AB154298.1), the signal peptide (amino acids 1 to 30) and the transmembrane region (amino acids 32 to 37) were removed from the sequence, and six histidine residues (His) were added to the end of the sequence. Simultaneously, codon optimization was performed for Pichia pastoris cells, ultimately introducing restriction endonuclease sites EcoRI and NotI at both ends of the sequence.

[0046] The nucleotide sequence of the optimized quail IFN-α gene is shown in SEQ ID NO:1, and the corresponding encoded amino acid sequence is shown in SEQ ID NO:2. The sequence was artificially synthesized by Nanjing Genscript Biotech Co., Ltd.

[0047] Example 2: Construction of recombinant plasmid pPIC9K-quailIFNα

[0048] like Figure 1As shown, the artificially synthesized quail IFN-α gene and pPIC9K vector were digested with restriction endonucleases EcoRI and NotI, respectively, and the target fragment was recovered by 1% agarose gel electrophoresis. The recovered target fragment was ligated with T4 ligase and transformed into E. coli DH5α competent cells. The cells were plated and cultured overnight. The next day, a single colony was picked, and the correctly identified recombinant plasmid was named pPIC9K-quailIFNα by sequencing and stored at -20℃ for later use.

[0049] Example 3 Construction of engineered strains

[0050] The recombinant plasmid pPIC9K-quailIFNα constructed above was linearized with restriction endonuclease Sal I, then added to Pichia pastoris X-33 competent cells. After gentle mixing, it was transferred to a pre-chilled electroporation cuvette and incubated on ice for 5 min. The electroporation parameters were as follows: voltage 1.5 kV, resistance 250 Ω, capacitance 25 μF. Immediately after electroporation, 1 mL of 1 M pre-chilled sorbitol was added, and the mixture was pipetted twice before being transferred to a 1.5 mL centrifuge tube. The tube was incubated statically at 30°C for 1 h, followed by centrifugation at 4000 rpm for 4 min at room temperature. The cells were collected and resuspended in 100 μL YPG medium, then plated onto YPG solid medium containing 100 μg / mL bleomycin (Zeocin). The cells were incubated at 37°C for 2 days. Single colonies were picked for PCR identification. The results are as follows: Figure 2 As shown, the length is 480bp. After correct identification, an engineered strain for expressing recombinant quail IFN-α was obtained, and its nucleotide sequence is shown in SEQ ID NO:3.

[0051] Example 4: Preparation of recombinant quail IFN-α

[0052] The engineered strain constructed above was inoculated into 20 mL of LYPG medium for regeneration. The next day, 5 mL was inoculated into a 1 L shake flask containing 250 mL of LYPG medium and cultured overnight at 28°C and 200 rpm. The cells were collected by centrifugation and resuspended in an equal volume of BMMY liquid medium. Induction was performed at 28°C and 200 rpm for 120 hours, with methanol added every 24 hours to a final concentration of 0.5%. The supernatant was collected and purified according to the affinity chromatography column instructions to obtain the recombinant protein. The molecular weight and purity of the recombinant protein were analyzed by SDS-PAGE and Western blot methods. Figure 3 The Western blot results show that the relative molecular mass of the obtained recombinant protein is 30.0 kDa, which is consistent with the expected value, indicating that the recombinant protein is recombinant quail IFN-α with a concentration of 0.667 mg / mL and a purity of 95%.

[0053] Example 5: Bioactivity assay of recombinant quail IFN-α

[0054] The antiviral activity of recombinant quail IFN-α was determined using the cytopathic effect inhibition (VSV-CEF) method. The results showed that the antiviral activity of recombinant quail IFN-α was 1.0 × 10⁻⁶. 4 U / mL, specific activity is 1.77×10 4 U / mg. Recombinant quail IFN-α was inoculated into DF-1 cells at a dose of 1 μg / mL. Cells were collected 24 hours later, and total RNA was extracted using a total RNA extraction kit. The transcriptional levels of ISG15, OAS, PKR, and Mx genes in the cells were detected using a one-step qRT-PCR method. Results are as follows: Figure 4 As shown, the transcription levels of PKR and Mx genes in DF-1 cells stimulated by recombinant quail IFN-α in the experimental group were significantly higher than those in the control group, indicating that recombinant quail IFN-α has significant biological activity.

[0055] This invention discloses an engineered strain for producing recombinant quail IFN-α, recombinant quail IFN-α, and a method for its preparation. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The product of this invention has been described through preferred embodiments, and those skilled in the art can clearly modify or appropriately change and combine the product described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0056] sequence list

[0057] <110> Jiangsu Academy of Agricultural Sciences

[0058] <120> An engineered strain for producing recombinant quail IFN-α, recombinant quail IFN-α and its preparation method

[0059] <160> 3

[0060] <210> 1

[0061] <211> 480

[0062] <212> DNA

[0063] <213> Artificial sequence

[0064] <400> 1

[0065] cgcccccaggacgccaccttctctcgcgacagcctccagctcctaggggacatggctcccagcccaccccagctgtgcccacagcacagcgcgtcgccttgctccttcaacgacaccatc ctggacaccagcaacatctggcaaactgacaaaaccacccacgacattcttcaggacctcttcagtatcctcagcggaccaagcactccacccccactggatcgaaagccaacgccaaagc ctcctcagccacatccagcgctacacccagcacctcgagcagtgcctggaaaaaaacagcgacacgcgctcccggacacgacggcctcgaaaccttcacctcaccatcagcaaacacttc agctgcctccgcaccttcctcagcgataacgactacagcgactgcgcctgggacctcgtcctcctgcaagctcgtgaatggttccggcgcatcaacaacctcacaggcaacacgcgcact

[0066] <210> 2

[0067] <211> 160

[0068] <212> AA

[0069] <213> Artificial sequence

[0070] <400> 2

[0071] RPQD AT FSRDSLQLLGD MAP SPPQLCPQHSASPCS FN DTILDTSNIWQTDKTTHDILQ DLFSILSGPSTPPHWI ES QRQSLLSHIQ RY TQHLEQCLE KN SDTRRSRTRRPRNLHL TI SKHFSCLRTFLSDNDYSDC AW D LV LLQ AR EWFRRINNNL TG NTRT

[0072] <210>3

[0073] <211>9771

[0074] <212>DNA

[0075] <213>Artificial sequence

[0076] <400>3

[0077]

Claims

1. A method for preparing an engineered strain for producing recombinant quail IFN-α, characterized in that, Includes the following steps: (1) Optimization and synthesis of quail IFN-α gene; Based on the quail IFN-α gene sequence information, the signal peptide and transmembrane region were removed from the sequence, and 6 histidine residues were added to the end of the sequence. Codon optimization was performed on Pichia pastoris cells by introducing restriction endonuclease sites EcoRI and Not I at both ends of the sequence, respectively; the optimized nucleotide sequence of the quail IFN-α gene is shown in SEQ ID NO:1, and the corresponding encoded amino acid sequence is shown in SEQ ID NO:2; (2) Construct the recombinant plasmid pPIC9K-quailIFNα; The quail IFN-α gene and pPIC9K vector were digested with restriction endonucleases EcoR I and Not I. The target fragment was recovered by 1% agarose gel electrophoresis, and the target fragment was ligated using T4 ligase and transformed into E. coli DH5α competent cells. The cells were plated and cultured overnight. Single colonies were picked the next day, and the correctly identified recombinant plasmid was named pPIC9K-quailIFNα by sequencing. Its nucleotide sequence is shown in SEQ ID NO:

3. It was stored at -20℃ for later use. (3) Constructing engineered strains; The recombinant plasmid pPIC9K-quailIFNα was linearized with restriction endonuclease Sal I and added to Pichia pastoris X-33 competent cells. After mixing, the cells were transferred to a pre-cooled electroporation cuvette for an ice bath, and then transferred to an electroporator. After electroporation, pre-cooled sorbitol was added, and the cells were pipetted and transferred to centrifuge tubes. The cells were incubated statically at 25℃-30℃, centrifuged at room temperature to collect the cells, and resuspended in YPG medium. The cells were then spread onto YPG solid medium containing bleomycin for further culture. Single colonies were picked for PCR identification. After successful identification, the engineered strain for expressing recombinant quail IFN-α was obtained.

2. The preparation method according to claim 1, characterized in that, In step (3), centrifuge at 4000 r / min for 4 min at room temperature.

3. An engineered strain for producing recombinant quail IFN-α, prepared by the preparation method described in claim 1 or 2.

4. A recombinant quail IFN-α prepared using the engineered strain described in claim 3.

5. The method for preparing recombinant quail IFN-α as described in claim 4, characterized in that, Includes the following steps: (1) Optimization and synthesis of quail IFN-α gene; Based on the quail IFN-α gene sequence information, the signal peptide and transmembrane region were removed from the sequence, and 6 histidine residues were added to the end of the sequence. Codon optimization was performed on Pichia pastoris cells by introducing restriction endonuclease sites EcoRI and Not I at both ends of the sequence, respectively; the optimized nucleotide sequence of the quail IFN-α gene is shown in SEQ ID NO:1, and the corresponding encoded amino acid sequence is shown in SEQ ID NO:2; (2) Construct the recombinant plasmid pPIC9K-quailIFNα; The quail IFN-α gene and pPIC9K vector were digested with restriction endonucleases EcoR I and Not I. The target fragment was recovered by 1% agarose gel electrophoresis, and the target fragment was ligated using T4 ligase and transformed into E. coli DH5α competent cells. The cells were plated and cultured overnight. Single colonies were picked the next day, and the correctly identified recombinant plasmid was named pPIC9K-quailIFNα by sequencing. Its nucleotide sequence is shown in SEQ ID NO:

3. It was stored at -20℃ for later use. (3) Constructing engineered strains; The recombinant plasmid pPIC9K-quailIFNα was linearized with restriction endonuclease Sal I, added to Pichia pastoris X-33 competent cells, mixed well, and transferred to a pre-cooled electroporation cuvette for an ice bath, followed by transfer to an electroporator. After electroporation, pre-cooled sorbitol was added, and the mixture was pipetted and transferred to centrifuge tubes. The cells were incubated statically at 25℃-30℃, centrifuged at room temperature to collect the cells, resuspended in YPG medium, and plated onto YPG solid medium containing bleomycin for further culture. Single colonies were picked for PCR identification. After successful identification, the engineered strain for expressing recombinant quail IFN-α was obtained. (4) Preparation of recombinant quail IFN-α; The constructed engineered strain was inoculated into YPG culture medium for rejuvenation. The next day, it was inoculated into a shake flask containing YPG culture medium and cultured overnight at 25-31℃ and 190-210 r / min. The cells were collected by centrifugation, resuspended in an equal volume of BMMY liquid medium, and induced at 25-31℃ and 190-210 r / min for 100-140 hours. The supernatant was collected and purified to obtain recombinant quail IFN-α.

6. The method for preparing recombinant quail IFN-α according to claim 5, characterized in that, In step (4), the inoculum is inoculated into a shake flask containing YPG culture medium the next day and cultured overnight at 28°C and 200 r / min.

7. The method for preparing recombinant quail IFN-α according to claim 5, characterized in that, In step (4), the induction was carried out at 28°C and 200 r / min for 120 hours, and methanol with a final concentration of 0.5% was added every 24 hours.

Images