A strain for preventing and treating tea anthracnose and application thereof

By screening the Streptomyces JS4-F strain of *Gastrodinium spores*, the environmental pollution problem caused by chemical control of tea anthracnose was solved, achieving a highly efficient biological control effect and showing a significant inhibitory effect on tea anthracnose and other plant diseases.

CN116376782BActive Publication Date: 2026-06-05HUNAN AGRI UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUNAN AGRI UNIV
Filing Date
2023-05-17
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Current technologies for the prevention and control of anthracnose in tea mainly rely on chemical methods, which leads to increased drug resistance in pathogens and serious environmental pollution, while lacking effective biological control measures.

Method used

Streptomyces luteosporeus JS4-F strain was screened out and selected using the dilution plating method and plate confrontation method. Combined with morphological characteristics, physiological and biochemical properties and molecular biological identification, it was used to prepare microbial agents for the prevention and control of tea anthracnose.

Benefits of technology

The strain JS4-F exhibits a 75.59% inhibition rate against tea anthracnose fungus, and the fermentation broth achieves a 52.54% control effect in the laboratory. Even after dilution, it still maintains a high control effect, broadly inhibiting a variety of plant pathogens and providing an effective resource for biological control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116376782B_ABST
    Figure CN116376782B_ABST
Patent Text Reader

Abstract

The application discloses a strain for preventing and treating tea anthracnose, wherein the strain is Streptomyces luteosporeus JS4-F, is preserved in the China Center for Type Culture Collection, is preserved on April 27, 2023, has a preservation number of CCTCC NO: M2023651, is preserved in Wuhan, Wuhan University, China, and is classified and named as Streptomyces luteosporeus JS4-F.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of screening technology for biocontrol strains of tea anthracnose, and more specifically to a strain for controlling tea anthracnose and its application. Background Technology

[0002] Anthracnose is a significant leaf disease of tea trees, a global problem prevalent in major tea-producing areas of my country. In severely affected regions, tea trees experience extensive leaf drop, impacting the yield and quality of the following spring tea. The fungus *Colletotrichum camelliae*, causing tea anthracnose, is identified as the dominant species affecting tea trees in my country, distributed across most tea-producing regions and capable of infecting most domestic tea varieties.

[0003] Currently, chemical control methods are still the primary means of controlling anthracnose in tea production. However, the extensive use of pesticides leads to increased resistance in pathogens, severe environmental pollution, and increased pesticide residues. Compared to chemical control, biological control is environmentally friendly and sustainable. Among these methods, using microorganisms to control plant diseases offers advantages such as safety, environmental friendliness, no residue, low risk of resistance development, no harm to natural enemies, and high selectivity, making it an important area of ​​development for biological control.

[0004] Therefore, how to screen for a biocontrol strain of tea anthrax is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a strain for the prevention and control of tea anthrax and its application.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A strain for controlling anthracnose in tea, namely *Streptomyces luteosporeus* JS4-F, is deposited at the China Center for Type Culture Collection (CCTCC) on April 27, 2023, with accession number CCTCC NO: M2023651, located at Wuhan University, Wuhan, China, and classified as *Streptomyces luteosporeus* JS4-F.

[0008] As having the same inventive concept as the above-described technical solution, the present invention also seeks protection for the use of the strain in the preparation of microbial agents for the prevention and control of anthrax in tea.

[0009] As an inventive concept with the same technical solution as above, the present invention also claims protection for a microbial agent for the prevention and control of anthrax in tea, including Streptomyces chrysogenum JS4-F.

[0010] As an inventive concept with the same technical solution described above, the present invention also seeks protection for the use of the strain in the preparation of microbial agents for the prevention and control of strawberry blight pathogens.

[0011] As an inventive concept with the same technical solution described above, the present invention also seeks protection for the use of the strain in the preparation of microbial agents for controlling Fusarium wilt of pepper.

[0012] As an inventive concept with the same technical solution described above, the present invention also seeks protection for the use of the strain in the preparation of microbial agents for the prevention and control of early blight pathogens of potato.

[0013] As an inventive concept with the same technical solution described above, the present invention also seeks protection for the use of the strain in the preparation of microbial agents for controlling wilt of cotton sedge.

[0014] As an inventive concept with the same technical solution described above, the present invention also seeks protection for the use of the strain in the preparation of microbial agents for the prevention and control of large spot disease of maize.

[0015] As an inventive concept with the same technical solution described above, the present invention also seeks protection for the use of the strain in the preparation of microbial agents for the prevention and control of rice blast fungus.

[0016] As an inventive concept with the same technical solution described above, the present invention also seeks protection for the use of the strain in the preparation of microbial agents for the prevention and control of citrus scab and eggplant brown spot.

[0017] As can be seen from the above technical solution, compared with the prior art, this invention uses the dilution plating method to isolate actinomycete strains from the rhizosphere soil of tea gardens, and uses the plate confrontation method to screen strains with high antagonistic activity; it identifies the species by combining its morphological characteristics, culture characteristics, physiological and biochemical characteristics, and molecular biology; it uses scanning electron microscopy to observe the growth inhibitory effect of strain JS4-F on tea anthracnose fungus, and uses the in vitro leaf method and pot control efficacy test to determine the indoor control effect of its fermentation broth on tea anthracnose, and the plate confrontation method to determine its antibacterial spectrum. The results show that an actinomycete strain JS4-F with good antagonistic effect against tea anthracnose fungus was isolated and screened. Based on the morphological characteristics and physiological and biochemical characteristics of this fungus, it was initially identified as a Streptomyces genus. By constructing a phylogenetic tree by combining the sequencing results of 16S rRNA, gyrB, ropB, recA, and trpB genes, strain JS4-F was identified as Streptomyces luteosporeus. The antagonistic effect of strain JS4-F against *Anthracnose causal agent* of tea anthracnose reached 75.59%. Scanning electron microscopy showed that it caused mycelial deformities, wrinkles, and entanglement of *Anthracnose causal agent*. Nitrogen source utilization tests showed that strain JS4-F can utilize L-arginine, L-glycine, L-alanine, and L-tryptophan, and can grow at a 6% NaCl concentration with a pH tolerance range of 5-12. The undiluted fermentation broth of strain JS4-F showed a 52.54% control effect on detached leaves in vitro, a 39.94% control effect after a 10-fold dilution, and a 30.56% control effect after a 100-fold dilution. Pot control efficacy tests showed that the undiluted fermentation broth of strain JS4-F achieved a 44.59% control effect on tea anthracnose. The antagonistic strain JS4-F also showed good antagonistic effects against eight other plant pathogens, with inhibition rates all greater than 60%. In summary, strain JS4-F has good control potential against tea anthracnose and can provide reference resources and technical basis for the biological control of tea anthracnose. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0019] Figure 1 The attached figure shows the inhibitory effect of the strain JS4-F of the present invention on tea anthracnose bacteria on a PDA. The left side is the treatment group and the right side is the control group.

[0020] Figure 2 The attached figures show the morphological characteristics of strain JS4-F: A) Colony morphology of strain JS4-F; B) Hyphae and sporophytes; C) Sporangiophores and spores.

[0021] Figure 3 The attached figure shows a phylogenetic tree of strain JS4-F based on multiple gene sequences;

[0022] Figure 4 The attached figure shows the inhibitory effect of strain JS4-F on the mycelial growth of tea anthracnose fungus;

[0023] Figure 5 The attached diagram shows the antagonistic effects of strain JS4-F against eight plant pathogens: A) *Verticillium dahlia* (cotton wilt pathogen), B) *Phomopsis vexans* (eggplant brown spot pathogen), C) *Exserohilum turcicum* (corn leaf spot pathogen), D) *Magnaporthe oryzae* (rice blast pathogen), E) *Diaporthe citri* (citrus scab pathogen), F) *Alternaria alternate* (potato early blight pathogen), G) *Fusarium oxysporum* (pepper wilt pathogen), and H) *Phytophtherafragariae* (strawberry blight pathogen).

[0024] Figure 6 The attached figure shows the control efficacy of the fermentation broth of strain JS4-F against detached leaves of tea anthracnose.

[0025] Figure 7 The attached image shows the control efficacy of strain JS4-F against anthracnose in indoor potted tea plants. Detailed Implementation

[0026] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] Example 1: Screening for antagonistic strains of tea anthracnose pathogen

[0028] Test soil

[0029] The soil samples were collected from the rhizosphere soil of a tea garden in Hunan Province.

[0030] Test culture medium

[0031] Gao's No. 1 medium, potato dextrose agar medium, ISP2 medium, ISP4 medium, ISP6 medium, Czapek agar medium, Bennett's medium, and nutrient agar medium (g / L): peptone 10g, beef extract 5g, NaCl 5g, agar 20g, pH 7.2; these media were used for observing the culture characteristics of antagonistic actinomycetes. GY liquid medium was used for NaCl tolerance tests and pH tests of antagonistic actinomycetes. The basal medium for nitrogen source utilization tests consisted of: glucose 1g, MgSO4·7H2O 0.05g, NaCl 0.05g, FeSO4·7H2O 0.001g, and K2HPO4 0.01g, with each nitrogen source added at 0.5%.

[0032] Test pathogens

[0033] Nine plant pathogens tested were preserved at Hunan Agricultural University. They were: *C. camelliae* (anthraxyphysis of tea), *Phytophthera fragariae* (blight of strawberry), *Fusarium oxysporum* (wilt of pepper), *Alternaria alternate* (early blight of potato), *Verticillium dahlia* (wilt of cotton), *Exserohilum turcicum* (large leaf spot of maize), *Magnaporthe oryzae* (blast blast of rice), *Diaporthe citri* (skin scab of citrus), and *Phomopsis vexans* (brown spot of eggplant).

[0034] Isolation and screening of antagonistic strains

[0035] Using the dilution plating method, 1g of soil was added to 9mL of sterile water, shaken for several minutes, and then serially diluted 10 times with sterile water. -1 ~10 -6100 μL of each grade of bacterial suspension was spread onto Gao's No. 1 agar plates. The antagonistic actinomycete strain JS4-F was streaked onto Gao's No. 1 agar, yeast extract oat extract agar, inorganic salt starch agar, Czapek's agar, ISP6, Bennett's agar, nutrient agar, and PDA agar, respectively. The plates were incubated upside down at 28°C for 7-14 days. The growth of the strains, basal hyphae, aerial hyphae, colony characteristics, and the presence or absence of soluble pigments were observed. Strain JS4-F grew rapidly on Gao's No. 1 medium, forming dense colonies with well-developed aerial hyphae. The basal hyphae were yellowish-gray, while the aerial hyphae were powdery gray. The spore hyphae were spiral-shaped. It did not produce soluble pigment in the early stages but produced pink pigment in the later stages. When cultured on different media, it grew well on all media except for weaker growth on ISP4 and nutrient agar. It did not produce soluble pigment on ISP2 and nutrient agar, but produced soluble pigment on all other media. (See [link to relevant documentation]). Figure 1 ;

[0036] Each dilution gradient was replicated three times, and the plates were incubated upside down at 28°C for 7 days. After colonies grew on the plates, single colonies were picked, purified, and preserved. Antagonistic bacteria were screened for isolated actinomycetes using the plate confrontation method. The purified actinomycetes were streaked onto PDA medium 2 cm from the center of the petri dish and incubated at 28°C for 2 days. Then, a 0.5 cm diameter pathogenic bacterial disc was inoculated in the center. Three replicates were set up, with petri dishes inoculated only with the pathogenic bacterial disc serving as a control. After culturing for another 5 days, the diameter of the inhibition zone was measured, and the inhibition rate was calculated using the following formula.

[0037] Inhibition rate (%) = (Coronary diameter of control group - Colony diameter of treatment group) / Colony diameter of control group × 100%

[0038] The results showed that strain JS4-F exhibited an inhibition zone diameter of 1.66 cm against *C. camelliae*, the causal agent of anthracnose in tea, with an inhibition rate of 75.59%. Figure 2 .

[0039] Physiological and biochemical tests: Referring to the "Streptomyces Identification Manual", gelatin liquefaction test, methyl red test, catalase test, VP test, milk coagulation and peptone test, H2S production test, casein hydrolysis test, arginine decarboxylase test, and nitrate reduction test were performed. The ability of antagonistic strains to produce cellulase was determined by Congo red staining. The nitrogen source utilization test adopted the Pugos's single nitrogen source method. The NaCl concentration adjustment range for the salt tolerance test of antagonistic strains was 0-10%, and the pH adjustment range for the pH test was 3-12. The test method was to inject the sterile white pipette tip with strain spores into a test tube containing 5 ml of GY liquid culture medium and incubate at 28℃ for 7 days. The growth of the strain and its growth status under different NaCl concentrations and different pH conditions were observed, as shown in Table 1.

[0040] Table 1 Physiological and Biochemical Performance

[0041]

[0042]

[0043] Physiological and biochemical tests showed that strain JS4-F was positive for catalase, milk coagulation and peptonization, starch hydrolysis, H2S production, arginine decarboxylase, and nitrate reductase, but negative for methyl red, casein hydrolysis, and VP tests. Nitrogen utilization tests indicated that strain JS4-F could utilize L-arginine, L-glycine, L-alanine, and L-tryptophan, but not L-cysteine ​​or L-glutamic acid. NaCl tolerance and pH tolerance tests showed that strain JS4-F could grow at a 6% NaCl concentration, with a pH tolerance range of 5-12; it could grow at pH 5, but growth was weak.

[0044] A phylogenetic tree was constructed using the combined sequencing results of 16S rRNA, gyrB, ropB, recA, and trpB genes. Primer information is shown in Table 2. The phylogenetic tree is shown in [Table 2]. Figure 3The results showed that strain JS4-F and Streptomyces luteosporeus belonged to the same branch, and its bootstrap value was 93. Therefore, based on the morphological characteristics, physiological and biochemical properties, and 16S rDNA gene sequence analysis of strain JS4-F, it was preliminarily identified as Streptomyces luteosporeus. The strain, Streptomyces luteosporeus JS4-F, is deposited at the China Center for Type Culture Collection (CCTCC) on April 27, 2023, with accession number CCTCC NO: M2023651, located at Wuhan University, Wuhan, China, and classified as Streptomyces luteosporeus JS4-F.

[0045] Table 2

[0046] Gene Primer name Primer sequence 16S rRNA 27F AGAGTTTGATCCTGGCTCAG 1492R TACGGCTACCTTGTTACGACTT gyrB gyrB-F GTGGCCGATTCCGGCAACCCCAACG gyrB-R TCAGATGTCGAGGAAGCGGACGT recA recA-F GCSAGGTCGGGGTTGTCCTTSAGGAAGTGCG recA-R GCSAGGTCGGGGTTGTCCTTSAGGAAGTGCG ropB ropB-F GAGCGCATGACCACCCAGGACGTCGAGGC ropB-R CCTCGTAGTTGTACCCTCCCACGGCATGA trpB trpB-F GCGCGAGGACCTGAACCACACCGGCTCACACAAGATCAACA trpB-R TCGATGGCCGGGATGATGCCCTCGGTGCGCGACAGCAGGC

[0047] Example 2: Antibacterial properties of antagonistic actinomycete strain JS4-F

[0048] Antagonistic effect of actinomycete strain JS4-F on mycelial growth of *Anthracis aureus*

[0049] After antagonistic strain JS4-F was cultured against anthrax pathogen of tea for 5 days, anthrax pathogen hyphae at the edge of the inhibition zone formed by the antagonistic bacteria were picked and observed morphologically by scanning electron microscopy. Anthrax pathogen of tea that grew naturally for 5 days without antagonistic bacteria was used as a control.

[0050] Scanning electron microscopy revealed that the growth of *C. camelliae* hyphae was inhibited in the presence of the antagonistic strain JS4-F. Compared with the control group, the hyphae in the treatment group were deformed, wrinkled, and intertwined, indicating that strain JS4-F inhibited the growth of *C. camelliae* hyphae. Figure 4 .

[0051] Determination of antibacterial activity against antagonistic actinomycete strain JS4-F

[0052] The antibacterial spectrum of antagonistic strain JS4-F was determined using the plate confrontation method. A 0.5 cm diameter mycelial cake of each tested pathogen was placed in the center of a petri dish using a punch. An antagonistic bacterium was picked up with a sterile inoculation loop and streaked on both sides of the pathogen at a distance of 1.5 cm. A control was prepared by inoculating only the pathogen. Each treatment was repeated three times. After incubation at 28℃ for 7 days, the diameter of the inhibition zone was measured, and the inhibition rate of antagonistic strain JS4-F against eight plant pathogens was calculated.

[0053] The antibacterial spectrum assay of the antagonistic strain showed that strain JS4-F had inhibitory effects on *Phytophthora blight*, *Fusarium wilt*, *Early blight*, *Fusarium wilt*, *Leptochloa crus-galli*, *Magnaporta oryzae*, *Magnaporta oryzae*, *Magnaporta oryzae*, *Citrus sclerotium*, and *Brachystomata var. oryzae*. The inhibitory effect against *Magnaporta oryzae* was the best, reaching (72.24±0.21)%, and the inhibition rate against all eight plant pathogens was greater than 60%, while the inhibition rates against *Magnaporta oryzae*, *Brachystomata var. oryzae*, and *Fusarium wilt* were all greater than 70%. This indicates that the antagonistic strain has a good antagonistic effect and broad-spectrum antibacterial activity. Figure 5 And Table 3.

[0054] Table 3

[0055]

[0056] The efficacy of antagonistic actinomycete strain JS4-F fermentation broth against tea anthracnose

[0057] Efficacy of detached leaves: Sterile filter paper was placed in a petri dish and moistened with sterile water. Fresh and healthy tea leaves were selected, and the surface was disinfected with 75% alcohol. After rinsing three times with sterile water, the leaves were punctured with a sterile needle. The fermentation broth of the antagonistic strain JS4-F was evenly applied to the leaves. After drying, tea anthracnose fungal cakes with a diameter of 0.5 cm were inoculated at the wound. Leaves not treated with the antagonistic bacteria fermentation broth were used as controls. Each treatment was repeated in 6 groups. The leaves were incubated in a constant temperature incubator at 28℃ and the disease incidence was observed after 5 days.

[0058] In vitro leaf control efficacy tests of the antagonistic strain JS4-F showed that, 5 days after leaf inoculation with the pathogen, the stock solution of sterile fermentation broth of strain JS4-F achieved a 52.54% control effect against tea anthracnose. The control effect decreased with increasing dilution ratio; a 10-fold dilution resulted in a control effect of 39.94%, and a 100-fold dilution resulted in a control effect of 30.56%. (See attached data). Figure 6 .

[0059] The effect of antagonistic actinomycete fermentation broth on the prevention of anthracnose in indoor potted tea

[0060] Indoor potted plant control efficacy: Two-year-old susceptible tea cultivar Longjing was selected as the experimental material. Surfactants were added to the antagonistic bacterial fermentation broth and mixed thoroughly. Fresh, healthy tea leaves without disease spots were selected, and the leaves were punctured with a sterile needle. The antagonistic strain JS4-F fermentation broth was sprayed onto the tea leaves. After drying, a 0.5 cm diameter tea anthracnose fungal cake was inoculated at the wound site. The wound was kept moist with cotton. A control group without antagonistic bacterial fermentation broth treatment was used. Each treatment was repeated three times, with four tea seedlings in each group. The plants were cultured under natural conditions, and the disease incidence was observed. After disease onset, the fungal cake was removed. On day 7, the treatment groups were sprayed with the antagonistic bacterial broth again, and an investigation was conducted 14 days later. Pot experiments with the antagonistic strain JS4-F showed that, 14 days after inoculation with the pathogen, the disease index in the control group was 30.83; the disease index in the treatment group (undiluted solution) was 17.08%, with a control effect of 44.59% against tea anthracnose; after a 10-fold dilution, the disease index was 20.00, with a control effect of 35.13%. As the dilution factor increased, the disease index increased while the control effect decreased. After a 100-fold dilution, the disease index was 23.33, with a control effect of 24.32%. (See...) Figure 7 .

[0061] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0062] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A strain for controlling anthracnose in tea, characterized in that, The strain described is *Streptomyces luteosporeus* JS4-F, deposited at the China Center for Type Culture Collection (CCTCC) on April 27, 2023, with accession number CCTCCNO: M2023651, located at Wuhan University, Wuhan, China, and classified as *Streptomyces luteosporeus* JS4-F.

2. The use of the strain described in claim 1 in the preparation of microbial agents for the prevention and control of anthrax in tea.

3. A microbial agent for preventing and controlling anthracnose in tea, characterized in that, Including Streptomyces luteosporeus JS4-F as described in claim 1.

4. The use of the strain described in claim 1 in the preparation of microbial agents for the prevention and control of strawberry blight.

5. The use of the strain described in claim 1 in the preparation of microbial agents for controlling wilt disease of pepper.

6. The use of the strain according to claim 1 in the preparation of microbial agents for the prevention and control of early blight of potato.

7. The use of the strain according to claim 1 in the preparation of microbial agents for controlling cotton wilt disease.

8. The use of the strain described in claim 1 in the preparation of microbial agents for the prevention and control of maize leaf spot disease.

9. The use of the strain according to claim 1 in the preparation of microbial agents for the prevention and control of rice blast.

10. The use of the strain according to claim 1 in the preparation of microbial agents for the prevention and control of citrus scab and eggplant brown spot disease.