A method for detecting a molecular marker of blumeria graminis resistant to triazole fungicides

Abstract

This invention provides a molecular marker method for detecting triazole fungicide resistance in wheat powdery mildew, belonging to the field of fungicide resistance molecular detection. The method utilizes primers to amplify the fungicide resistance gene in wheat powdery mildew. cyp51 This method can accurately distinguish whether a resistance gene locus has mutated. It can identify three mutation types at the CYP51-458 locus: mutant (T), wild-type (A), or heterozygous (A / T), thus improving the resistance gene cyp... 51 The selection efficiency can be improved, the frequency of pesticide resistance in the field can be accurately predicted, and the application of pesticides in production can be scientifically guided.

Description

Technical Field

[0001] This invention belongs to the field of molecular detection technology for plant pathogenic fungal resistance, specifically relating to a KASP marker related to wheat powdery mildew resistance and its application. Background Technology

[0002] By obligate parasites ( Blumeria graminis f.sp. tritici Powdery mildew, caused by ergosterol (Bgt), is one of the most important diseases in wheat production. This disease can occur throughout the entire wheat growth cycle, particularly affecting grain filling, leading to an increase in empty and shriveled grains and a decrease in yield. In my country, the annual affected area is 6.85-7.3 million hectares. Generally, affected fields experience yield reductions of 5%-10%, while severely affected fields suffer reductions exceeding 20%. Chemical agents are currently a crucial control measure for wheat powdery mildew, playing a vital role in ensuring safe wheat production. At present, the main fungicides used for controlling wheat powdery mildew are azole agents, which target 14-α demethylase and act as inhibitors of ergosterol synthesis. Among the registered fungicides for wheat powdery mildew control in China, triazoles account for 89.9% (single-agent and compound agents), mainly including triadimefon, tebuconazole, and propiconazole. However, large-scale, long-term use of fungicides with the same mechanism of action can create selective pressure on the pathogen population, gradually leading to the formation of drug-resistant strains and ultimately resulting in the loss of fungicide efficacy.

[0003] Amino acid mutations in CYP51 are the most widely reported resistance mechanism in plant pathogenic fungi. This is because, under long-term selection by fungicides, single or multiple base mutations in the CYP51 gene lead to amino acid sequence substitutions, altering the structure and spatial conformation of CYP51. This reduces the binding affinity of CYP51 to fungicides, decreasing the fungal's sensitivity to the agent and leading to resistance. Among plant pathogens, the most prevalent CYP51 amino acid mutation is Y136F, where tyrosine at position 136 is replaced by phenylalanine. This mutation site has been reported in resistant strains of many pathogens, such as those causing wheat powdery mildew and grape powdery mildew. Erysiphe necator Banana black streak leaf spot fungus Mycosphaerella fijiensis and wheat leaf rust fungus Puccinia triticina Therefore, CYP51 amino acid mutations can be used for molecular monitoring of antibiotic resistance in pathogen populations, thereby predicting the resistance level of the pathogen population. Currently, Y136F and K147Q are the most common antibiotic-resistant mutant genotypes reported. The former is mainly associated with antibiotic resistance in *Phyllostachys edulis* and *Erythrina variegata*, while the latter is mainly associated with highly resistant strains of *Barley Powdery Mildew*. The Y136F mutant was first detected in *Phyllostachys edulis* by Délye et al. in 1997, and subsequently also detected in *Barley* and *Wheat* powdery mildew. The K147Q mutant was first detected in *Barley Powdery Mildew* by Brown et al. in 2005.

[0004] The applicant has expanded the production of wheat powdery mildew bacteria. cyp51 When examining the full-length gene for the mutation site at amino acid 136 (nucleotide 458), three types of mutations were found: wild-type (A), mutant (T), and heterozygous (A / T). Since wheat powdery mildew is haploid during the conidial stage, it is theoretically impossible for a heterozygous mutation site to occur. The most likely explanation is the third type of mutation caused by cross-contamination between strains. To clarify whether the heterozygous (A / T) mutation was caused by cross-contamination, we selected 10 strains (5-93, 7-8, 10-40, 11-99, 12-24, 12-50, 28-9, 35-27, 48-28, 49-1) from the heterozygous strains for further isolation and purification of single-spore strains. First, single spore clusters were selected for propagation, and then single spore colonies were selected for propagation. Five single spore strains were selected from each strain and numbered for first-generation Sanger sequencing. The results showed that five purified single spore strains from the ten strains were still heterozygous, indicating that the heterozygosity was not caused by contamination, but was likely due to a problem with gene copy number.

[0005] Whether it's conventional PCR, real-time PCR, digital PCR, or CAPS markers, these methods cannot rapidly detect genes in a single step. cyp51 The three variants at amino acid position 136 require sequencing for some (e.g., application CN 101397585 B), which increases time and economic costs. This application develops KASP-labeled primers to sequentially sequence amino acids at position 136. cyp51 Three variations were detected simultaneously at nucleotide 458 of the gene. A search revealed no information regarding... cyp51 Reports of simultaneous detection of three variant types at nucleotide 458 of the gene. Summary of the Invention

[0006] To address the shortcomings of the existing technologies, one objective of this invention is to provide a high-throughput marker for detecting wheat powdery mildew resistance and its application in field resistance monitoring. The KASP molecular marker developed in this invention is suitable for high-throughput, high-efficiency detection and can be applied to the dynamic monitoring of resistance development in the field. It is also of great significance for accurately assessing the frequency of wheat powdery mildew resistance in the field.

[0007] The inventors of this application randomly selected one strain (21-2) from 100 powdery mildew fungi collected from different ecological regions in China for de novo sequencing, and re-sequencing the remaining 99 strains. Bioinformatics analysis was used to obtain information on wheat powdery mildew fungi. cyp51The full-length gene is 1696 bp, with two introns of 51 bp and 52 bp in length. Four amino acid alterations were found at the sites S79T, F136Y, K175N, and F442L. During amplification... cyp51 When the full-length gene was examined for variation at amino acid position 136 (458 nucleotides), three types of variation were found: wild-type (A458), mutant (T458), and heterozygous (A / T458). Since wheat powdery mildew is haploid during the conidial stage, it is impossible for a heterozygous variation to occur. The most likely explanation is that the third type of variation was caused by cross-contamination between strains. To determine whether the heterozygosity (A / T 458) was caused by cross-contamination, we selected 10 strains (5-93, 7-8, 10-40, 11-99, 12-24, 12-50, 28-9, 35-27, 48-28, 49-1) from the heterozygous strains for further isolation and purification of single spores. First, single spore clusters were selected for propagation, and then single spore colonies were selected for propagation. Five single spores from each strain were selected and numbered, and then first-generation Sanger sequencing was performed. The results showed that the five purified single spores from the 10 strains were still heterozygous, indicating that it was not caused by contamination, but rather by a gene copy number issue.

[0008] To achieve targeting of wheat powdery mildew genes cyp51 To detect the three variations present at amino acid position 136, this invention employs the following technical solution:

[0009] A molecular marker associated with wheat powdery mildew resistance, the molecular marker being located in the wheat powdery mildew gene. cyp51, Gene cyp51 The nucleotide sequence is shown in SEQ ID NO:1. The sequence is 1696 bp in length. There is a variation at position 458 of the sequence, which is wild-type A, mutant T, and heterozygous A / T. It is labeled as CYP51-458.

[0010] Preferably, a molecular marker method for wheat powdery mildew resistance as described above, wherein CYP51-458 is detected using KASP, and the primer sequence is:

[0011] Primer_AlleleFAM: GTCTTCGGGACTGATGTAGTGTA, as shown in sequence list SEQ ID NO:2;

[0012] Primer_AlleleHEX: GTCTTCGGGACTGATGTAGTGTT, as shown in sequence list SEQ ID NO:3;

[0013] Primer_Common: TTGTTCCATAATTTTGAATTAGGACAGTCA, as shown in the sequence list SEQ ID NO:4.

[0014] Preferably, in the molecular marker method for wheat powdery mildew resistance as described above, the KASP detection includes the following steps:

[0015] (1) Extract DNA from the wheat powdery mildew sample to be tested;

[0016] (2) Take 3 μL of template DNA with a concentration of 20 ng / μL, 0.0825 μL of the mixed primers shown in SEQ ID NO.2-4, and 3 μL of 2X Master Mix for PCR amplification;

[0017] (3) Use a fluorescence detection instrument to detect the fluorescence signal of the PCR amplification product and perform genotyping.

[0018] Preferably, in the molecular marker method for wheat powdery mildew resistance as described above, the PCR amplification conditions in step (2) are as follows:

[0019] 1) Pre-denaturation at 94℃ for 5 min;

[0020] 2) Denaturation at 94℃ for 20 seconds;

[0021] 3) Anneal at 65℃ for 30 seconds, repeat steps 2)-3) 10 times, with the annealing temperature decreasing by 0.8℃ in each cycle;

[0022] 4) Denaturation at 94℃ for 20 seconds;

[0023] 5) Anneal at 57℃ for 30 seconds, repeat steps 4)-5) 38 times;

[0024] 6) Store at 4℃.

[0025] The second objective of this application is the application of molecular markers related to wheat powdery mildew resistance. The marker CYP51-458 of this application can be used for the detection of polymorphisms in the triadimefon resistance gene of wheat powdery mildew.

[0026] Compared with the prior art, the present invention has the following advantages:

[0027] 1) The present invention obtains SNP markers at the CYP51-458 sites, which can accurately reflect the actual resistance frequency in the field and is more accurate and objective than the previously reported Y136F mutation type.

[0028] 2) The KASP marker of the present invention has the characteristics of high throughput and simple operation, and can be used for high-throughput screening of large-scale field strain materials to improve the efficiency of resistance monitoring. Attached Figure Description

[0029] Figure 1 KASP typing results using CYP51-458 markers, with the dot closest to the X-axis representing the C (sensitive strain) base.

[0030] For each genotype, the dot near the Y-axis represents the T (resistant strain), and the dot near the diagonal represents the heterozygous C / T (resistant / susceptible strain) genotype. Detailed implementation method:

[0032] The following are specific embodiments of the present invention, which further describe the technical solution of the present invention. However, the content of the present invention is not limited to the scope described in the embodiments. Any changes or equivalent substitutions that do not depart from the concept of the present invention are included within the protection scope of the present invention.

[0033] Example 1: Extraction of wheat powdery mildew

[0034] 1) Collection of wheat powdery mildew spores: In greenhouse isolation culture, highly susceptible wheat seedlings are cultured until the first leaf is fully expanded. The middle section of the leaf is cut off and placed on an agar preservation medium with the upper surface facing up. The above-mentioned detached leaf section is inoculated with pre-propagated fresh wheat powdery mildew conidia in an inoculation device. After inoculation, it is placed at 17±1℃ and cultured under light conditions for 18 hours. When a large number of spores are produced, the culture dish is placed on a clean bench, and the culture dish is inverted on sulfuric acid paper. It is gently tapped 2-3 times with tweezers to collect the conidia into sterile centrifuge tubes. The optimal conidia biomass is between 100-200mg.

[0035] The formula for agar preservation medium is: 4 grams of water agar powder, 50 mg of benzimidazole, and 1 L of deionized water.

[0036] 2) DNA extraction from wheat powdery mildew: The specific extraction method is as follows:

[0037] ① Place the collected 100-200mg wheat powdery mildew spore powder into a 2ml centrifuge tube pre-cooled with liquid nitrogen (the centrifuge tube contains 3 stainless steel balls with a diameter of 3mm), and then grind it 3 times in a grinder (specific parameters: frequency 30 times / second, time interval 30 seconds); Note: the centrifuge tube must be under liquid nitrogen protection before each grinding.

[0038] ② Add 300 μL of Sarcosyl (5% sodium lauroyl sarcosinate solution) to the centrifuge tube from step ① and shake vigorously for 30 seconds; add 700 μL of Solution B and continue shaking vigorously, and finally place in a water bath at 65°C for 15-30 minutes; Note: The steel ball can be removed in this step to avoid contamination by chloroform in the subsequent process.

[0039] Solution B's specific components (0.2M Tris, pH= 7.5, 50mM EDTA, 2M NaCl, 2% CTAB, 0.25M Na2S2O3).

[0040] ③ Add 600 μL of chloroform to the centrifuge tube in step ②, shake vigorously, centrifuge at 14000 rpm for 10 min (4℃), and collect the supernatant; Note: Wear protective gloves during the chloroform operation.

[0041] ④ Add one volume of pre-cooled isopropanol, approximately 700 μL, to the supernatant collected in step ③; invert the centrifuge tube 6-8 times, centrifuge at 14000 rpm for 10 min (4℃), discard the supernatant and retain the precipitate, place on ice for 15 min, and dissolve the precipitate with 450 μL TE (Tris-EDTA buffer, 10 mM Tris, 1 mM EDTA, pH 8.0).

[0042] Note: First add isopropanol to each tube. After all the isopropanol has been added, invert each centrifuge tube 6-8 times in turn and incubate at 30°C for 1 hour or at 4°C overnight.

[0043] ⑤ Aspirate the solution dissolved in step ④ into an Amicon Ultra -0.5ml (Millipore, Ultracel model UFC5030BK, LOTNo: R8JA97944), centrifuge at 14000 rpm for 30 min (4℃), and discard the filtrate; then add 300μL TE to rinse, and gently add directly to an Amicon Ultra -0.5ml, centrifuge at 14000 rcf (4℃), invert the filter into a new centrifuge tube, centrifuge at 1000 rcf for 1 min, and collect the filtrate.

[0044] ⑥ Add 300 μL TE and 4 μL RNase to the filtrate from step ⑤ into the DNA enrichment tube, incubate at 37°C for 1 h, then add 300 μL phenol-chloroform (volume ratio 1:1) and mix 6-8 times. Centrifuge at 14000 rcf for 10 min (4°C), transfer the supernatant to a new centrifuge tube, add 2.5 times the volume of anhydrous ethanol and 0.01 times the volume of 3M sodium acetate to the supernatant, and incubate at -20°C overnight.

[0045] ⑦ Centrifuge the overnight centrifuge tube from step ⑥ at 15000 rcf for 30 min (4℃), discard the filtrate, add 450 μL of 70% ethanol to the centrifuge tube, centrifuge again at 13000 rcf for 10 min (18℃), discard the ethanol, dry the precipitate on ice for 15 min (no more than 30 min), and finally add 30-50 μL of TE or deionized water to resuspend the precipitate.

[0046] Quality testing: Nucleic acid quality was tested using Nanodrop One, and the sample concentration was ≥66 ng / μL (Table 1).

[0047] Table 1. DNA concentration detection results of 60 samples to be tested

[0048]

[0049] Example 2: cyp51 Gene 458 site

[0050] According to the invention description cyp51 At gene SNP position 458, using Primer 5.0, these SNP sites were converted into KASP detection markers. During the design, markers with hairpin structures, primer dimers, and Tm values ​​exceeding 3°C between upstream and downstream primers were excluded, resulting in a total of 16 markers. Through genotyping in random samples, one KASP detection marker was found to be able to effectively distinguish the genotypes of each individual.

[0051] Example 3: Primer dilution and mixing of KASP detection primers

[0052] The three primers were diluted to 100 μM with Tris HCl and then mixed in a volume ratio of AlleleFAM:AlleleHEX:Common:Tris HCl = 6:6:15:23. After being aliquoted, the mixtures were stored at -20℃ as KASP detection primers.

[0053] Example 4: PCR amplification system and procedure

[0054] PCR reaction system: Prepare the system on ice according to the table below. KASP primers were synthesized by the Laboratory of the Government Chemist, Ltd.

[0055]

[0056] PCR reaction conditions:

[0057] 1) Pre-denaturation at 94℃ for 5 minutes;

[0058] 2) Denaturation at 94℃ for 20 seconds;

[0059] 3) Anneal at 65℃ for 30 seconds, repeat steps 2)-3) 10 times, with the annealing temperature decreasing by 0.8℃ in each cycle;

[0060] 4) Denaturation at 94℃ for 20 seconds;

[0061] 5) Anneal at 57℃ for 30 seconds, repeat steps 4)-5) 38 times;

[0062] 6) Store at 4℃.

[0063] Example 5: Results Analysis

[0064] The SNP distribution results of the amplified PCR system were collected using the ABI Quant Studio™ 12K Flex real-time quantitative PCR system, such as... Figure 1 As shown, the Y-axis represents the drug-resistant genotype, and the X-axis represents the susceptible genotype. Forty strains from a natural population were tested. The KASP genotyping results using the CYP51-458 marker showed that the dots closer to the Y-axis represented 4 C (resistant strains) genotypes, the dots closer to the X-axis represented 18 T (susceptible strains) genotypes, and the dots near the diagonal represented 32 C / T (resistant / susceptible strains) genotypes. The remaining 6 dots may be due to template issues.

[0065] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the scope of protection of this application.

Claims

1. A molecular marker method for detecting wheat powdery mildew resistant to triazole fungicides, characterized in that: The molecular marker is located in the wheat powdery mildew gene cyp51. The nucleotide sequence of gene cyp51 is shown in SEQ ID NO:

1. There is a base variation at nucleotide 458 of this sequence, which is wild-type A, mutant T, and heterozygous A / T, and is marked as CYP51-458. The CYP51-458 was detected using KASP, and the primer sequence was: Primer_AlleleFAM: GTCTTCGGGACTGATGTAGTGTA, as shown in sequence list SEQ ID NO:2; Primer_AlleleHEX: GTCTTCGGGACTGATGTAGTGTT, as shown in sequence list SEQ ID NO:3; Primer_Common: TTGTTCCATAATTTTGAATTAGGACAGTCA, as shown in the sequence list SEQ ID NO:

4.

2. The molecular marker method for detecting wheat powdery mildew resistant to triazole fungicides as described in claim 1, characterized in that: The KASP detection includes the following steps: (1) Extract DNA from the wheat powdery mildew sample to be tested; (2) Take 3 μL of template DNA with a concentration of 20 ng / μL, 0.0825 μL of the mixed primers shown in SEQ ID NO.2-4, and 3 μL of 2×Master Mix for PCR amplification; (3) Use a fluorescence detection instrument to detect the fluorescence signal of the PCR amplification product and perform genotyping.

3. The molecular marker method for detecting wheat powdery mildew resistant to triazole fungicides as described in claim 2, characterized in that: The conditions for PCR amplification in step (2) are as follows: 1) Pre-denaturation at 94℃ for 5 min; 2) Denaturation at 94℃ for 20 seconds; 3) Anneal at 65℃ for 30 seconds, repeat steps 2)-3) 10 times, with the annealing temperature decreasing by 0.8℃ in each cycle; 4) Denaturation at 94℃ for 20 seconds; 5) Anneal at 57℃ for 30 seconds, repeat steps 4)-5) 38 times; 6) Store at 4℃.

4. The molecular marker CYP51-458 is used for the detection of polymorphism in the triadimefon resistance gene of wheat powdery mildew. The molecular marker is located in the wheat powdery mildew gene cyp51. The nucleotide sequence of gene cyp51 is shown in SEQ ID NO:

1. There is a base variation at nucleotide 458 of this sequence, which is expressed as wild type A, mutant T, and heterozygous A / T, and is marked as CYP51-458.

Images