Lentivirus product with prostate cancer inhibiting effect and construction method thereof

By constructing lentiviral products carrying RNAi target sequences, the problem of poor inhibitory effects on prostate cancer cells in existing technologies has been solved, achieving efficient inhibition of prostate cancer cell expression and proliferation, and providing a new direction for prostate cancer treatment.

CN116445550BActive Publication Date: 2026-06-09SHANGHAI YIBEIRUI BIOMEDICAL SCIENCE & TECHNOLOGY CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANGHAI YIBEIRUI BIOMEDICAL SCIENCE & TECHNOLOGY CO LTD
Filing Date
2023-04-20
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Existing lentiviral vectors are not specifically designed to inhibit and clear prostate cancer cells, making it difficult to effectively inhibit the expression, proliferation, and transformation of prostate cancer cells.

Method used

A lentiviral product was designed, carrying RNAi-21904, RNAi-21905, or RNAi-21906 as the RNAi target sequence. Through endogenous target screening experiments, it was determined that the product efficiently knocked down the TDRKH gene in prostate cancer cells. The product was then carried on tool vectors BR-V108, BR-V307, or BR-V112 and constructed through steps such as vector enzyme digestion, acquisition of the target gene fragment, ligation of the annealing product with the vector, transformation, and colony PCR identification.

Benefits of technology

It achieves highly efficient inhibition of prostate cancer cells, significantly reduces their self-replication ability, has an infection efficiency of over 80%, and maintains normal cell status, demonstrating high safety and stability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present application relates to the field of biotechnology, specifically to a lentivirus product with prostate cancer inhibiting effect and a construction method thereof, at least carrying one of RNAi target sequence RNAi-21904, RNAi-21905 and RNAi-21906, wherein the RNAi-21904, RNAi-21905 and RNAi-21906 fragment coding sequences are respectively: AAGGACATGGCCACAGAAACA, CTTGATATTGGGCTAGAATTA, ATTGGATAAGCTTGTCAATGA; under the support of Shanghai Natural Foundation (project number 19ZR1454800), the applicant effectively inhibits the expression, proliferation, migration and transformation of prostate cancer cells by carrying specific RNAi target sequences, and provides a new direction for symptom relief and subsequent treatment of patients.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a lentiviral product with prostate cancer inhibitory activity and its construction method. Background Technology

[0002] Prostate cancer refers to an epithelial malignant tumor occurring in the prostate gland. Many researchers both domestically and internationally have been striving to develop viral vectors that can specifically replicate and express in tumor cells. For example, attempts have been made to achieve this by modifying the lentiviral genome itself or by modifying the ciliary structure of the lentiviral vector. Lentivirus vectors are gene therapy vectors developed based on human immunodeficiency virus (HIV). They are capable of infecting both dividing and non-dividing cells, can be expressed in vivo for extended periods, and have high safety. A Chinese patent (authorization announcement number CN102154369B) discloses a recombinant lentiviral vector, a recombinant lentivirus, and stem cells containing the recombinant lentivirus. The Survivin promoter, Apoptin gene, and SV40 Poly A sequence are sequentially inserted into the multiple cloning site of the lentiviral vector to achieve its functions of specific early warning, response, tracing, and clearance of transformed cells. However, it does not specifically design for the inhibition and clearance of prostate cancer cells. Summary of the Invention

[0003] To address the aforementioned problems, this invention provides a lentiviral product with prostate cancer inhibitory activity, comprising at least one of the RNAi target sequences RNAi-21904, RNAi-21905, and RNAi-21906, wherein the coding sequences of RNAi-21904, RNAi-21905, and RNAi-21906 are AAGGACATGGCCACAGAAACA, CTTGATATTGGGCTAGAATTA, and ATTGGATAAGCTTGTCAATGA, respectively. Preferably, the RNAi target sequence carried by the lentiviral product is RNAi-21904.

[0004] See Table 1. Figure 1The RNAi target sequence was obtained through an endogenous target screening experiment. The quantitative PCR results from this experiment showed that in human prostate cancer cells (DU 145 cells), after infection with lentivirus, compared to the normal target cell group infected with the negative control lentivirus (shCtrl), the TDRKH gene knockdown efficiency in the shTDRKH-1 group (normal target cell group infected with the target gene (RNAi-21904) lentivirus) reached 69.5% (p<0.001). The TDRKH gene knockdown efficiency in the shTDRKH-2 group (normal target cell group infected with the target gene (RNAi-21905) lentivirus) was not significant. The TDRKH gene knockdown efficiency in the shTDRKH-3 group (normal target cell group infected with the target gene (RNAi-21906) lentivirus) reached 67.6% (p<0.001).

[0005] Table 1

[0006]

[0007] See Table 2. Figure 2 The human prostate cells (DU 145 cells) were identified by background detection. The background detection experiment showed that, according to the quantitative PCR results, the gene expression was relatively high in DU 145 and PC-3 cells compared to C4-2 cells (P<0.001), while there was no significant change in the gene expression in 22RV1 and LNcap cells.

[0008] Table 2

[0009]

[0010] As a preferred technical solution, the RNAi target sequence is mounted on a tool vector, which is one of BR-V108, BR-V307, and BR-V112. Preferably, the tool vector is BR-V108, which is derived from Shanghai Yibeirui Biopharmaceutical Co., Ltd.

[0011] Another aspect of the present invention provides a method for constructing a lentiviral product with prostate cancer inhibitory activity, comprising: vector enzyme digestion, acquisition of target gene fragment, ligation of annealing product with vector, transformation, colony PCR identification, and sequencing.

[0012] As a preferred technical solution, the enzymatic digestion reaction temperature of the vector is 25-75 ℃, and the enzymatic digestion reaction time is 3-12 h. Preferably, the enzymatic digestion reaction temperature of the vector is 37 ℃, and the enzymatic digestion reaction time is 3 h.

[0013] As a preferred technical solution, the acquisition of the target gene fragment includes at least single-stranded primer synthesis and primer annealing to form double-stranded DNA.

[0014] As a preferred technical solution, the primer annealing to form double-stranded DNA specifically involves: dissolving the synthesized paired primer powder in deionized water, heating it in a PCR instrument at 90-100 °C for 4-6 minutes, then incubating it at 92-95 °C for 50-60 seconds, followed by a gradual cooling process, finally lowering the temperature to 25 °C. Preferably, the primer annealing to form double-stranded DNA specifically involves: dissolving the synthesized paired primer powder in deionized water, heating it in a PCR instrument at 95 °C for 5 minutes, then incubating it at 95 °C for 50 seconds, followed by a gradual cooling process, decreasing the temperature by 0.7 °C each time, finally lowering the temperature to 25 °C.

[0015] As a preferred technical solution, the ligation of the annealing product to the vector specifically involves: reacting the double-stranded DNA formed by primer annealing with the enzyme-digested vector at 10-20 °C for 1-3 h to achieve ligation of the annealing product to the vector. Preferably, the ligation of the annealing product to the vector specifically involves: preparing a 20 μL reaction system according to the Fermentas T4 DNA Ligase instructions, reacting the double-stranded DNA formed by primer annealing with the enzyme-digested vector at 16 °C for 1-3 h to achieve ligation of the annealing product to the vector.

[0016] As a preferred technical solution, the transformation specifically involves: adding the annealed product and the carrier-linked product to E. coli competent cells and incubating on ice for 20-40 minutes; then subjecting them to heat shock and cooling, followed by culture incorporation to complete the transformation.

[0017] As a preferred technical solution, the heat shock temperature is 40-45 ℃, the heat shock time is 80-100 s, and the cooling time is 100-150 s. Preferably, the heat shock temperature is 42 ℃, the heat shock time is 90 s, and the cooling time is 120 s.

[0018] As a preferred technical solution, the reaction conditions for colony PCR identification are: 92-96 ℃, 2-4 min; 92-96 ℃, 20-40 s, 50-60 ℃, 20-40 s, 70-75 ℃, 20-40 s, 22 cycles; 70-75 ℃, 4-6 min.

[0019] Beneficial effects:

[0020] 1. This invention provides a lentiviral product with prostate cancer inhibitory effects, which can effectively inhibit the expression, proliferation, migration and transformation of prostate cancer cells, providing a new direction for the relief of symptoms and subsequent treatment of prostate cancer patients.

[0021] 2. The lentiviral product with prostate cancer inhibitory effect provided by the present invention achieves high knockdown efficiency of the TDRKH gene by carrying a specific RNAi target sequence, thereby reducing the self-replication ability of prostate cancer cells and ensuring the inhibitory effect of the lentiviral product on prostate cancer cells.

[0022] 3. The lentiviral product with prostate cancer inhibitory effect provided by this invention has a cell infection efficiency of over 80%, and the cells are in normal condition, exhibiting high safety and stability. Attached Figure Description

[0023] Figure 1 The figure shows the results of the endogenous target screening experiment.

[0024] Figure 2 This is a graph showing the results of the background detection experiment.

[0025] Figure 3 This image shows a comparison of fluorescence between the experimental and control groups after lentivirus infection of target cells (LNcap).

[0026] Figure 4 The image shows a comparison of fluorescence between the experimental and control groups after lentivirus infection of target cells (DU 145).

[0027] Figure 5 This is a comparison of Western blotting results between the experimental group and the control group after lentivirus infection of target cells (DU 145).

[0028] Figure 6 This is a comparison chart showing the number of clones formed in the experimental group and the control group after lentivirus infection of target cells (LNcap).

[0029] Figure 7 This is a comparison chart showing the number of clones formed in the experimental group and the control group after lentivirus infection of target cells (DU 145).

[0030] Figure 8 A comparison of scratch test results between the experimental group and the control group after lentivirus infection of target cells (DU 145).

[0031] Figure 9 This is a comparison of the apoptosis results between the experimental group and the control group after lentivirus infection of target cells (DU 145).

[0032] Figure 10This is a comparison of the Transwell experiment results between the experimental group and the control group after lentivirus infection of target cells (LNcap). Detailed Implementation

[0033] Example 1

[0034] Embodiment 1 of the present invention provides a lentiviral product with prostate cancer inhibitory activity, carrying the RNAi target sequence RNAi-21904, wherein the RNAi-21904 fragment coding sequence is:

[0035] See Table 1. Figure 1 The RNAi target sequence was obtained through an endogenous target screening experiment. The quantitative PCR results from this experiment showed that in human prostate cancer cells (DU 145 cells), after infection with lentivirus, compared to the normal target cell group infected with the negative control lentivirus (shCtrl), the TDRKH gene knockdown efficiency in the shTDRKH-1 group (normal target cell group infected with the target gene (RNAi-21904) lentivirus) reached 69.5% (p<0.001). The TDRKH gene knockdown efficiency in the shTDRKH-2 group (normal target cell group infected with the target gene (RNAi-21905) lentivirus) was not significant. The TDRKH gene knockdown efficiency in the shTDRKH-3 group (normal target cell group infected with the target gene (RNAi-21905) lentivirus) reached 67.6% (p<0.001).

[0036] Table 1

[0037]

[0038] See Table 2. Figure 2 The human prostate cells (DU 145 cells) were identified by background detection. The background detection experiment showed that, according to the quantitative PCR results, the gene expression was relatively high in DU 145 and C4-2 cells compared to C4-2 cells (P<0.001), while there was no significant change in the gene expression in 22RV1 and LNcap cells.

[0039] Table 2

[0040]

[0041] The RNAi target sequence is mounted on a tool vector, BR-V108, which is derived from Shanghai Yibeirui Biopharmaceutical Co., Ltd.

[0042] Another aspect of Embodiment 1 of the present invention provides a method for constructing a lentiviral product with prostate cancer inhibitory effect, comprising: vector enzyme digestion, obtaining the target gene fragment, ligating the annealing product with the vector, transformation, colony PCR identification, and sequencing.

[0043] The vector enzymatic digestion reaction temperature is 37 °C, and the vector enzymatic digestion reaction time is 3 h.

[0044] The acquisition of the target gene fragment includes single-stranded primer synthesis and primer annealing to form double-stranded DNA.

[0045] The primer annealing process to form double-stranded DNA involves dissolving the synthesized paired primer powder in deionized water, heating it at 95 °C for 5 minutes using a PCR instrument, then holding it at 95 °C for 50 seconds, followed by a gradient cooling process of 0.7 °C (1 min) each time, and finally cooling it to 25 °C.

[0046] The ligation of the annealing product with the vector is specifically performed as follows: a 20 μL reaction system is prepared according to the Fermentas T4 DNA Ligase instructions, and the double-stranded DNA formed by primer annealing is reacted with the enzyme-digested vector at 16 ℃ for 2 h to achieve the ligation of the annealing product with the vector.

[0047] The transformation process is as follows: 10 μL of the annealed product combined with the vector is added to 100 μL of competent E. coli cells and incubated on ice for 30 min; after heat shock and cooling, 500 µL of antibiotic-free LB liquid medium is added, and the cells are shaken at 37 °C for 1 h at 200 rpm. 150 μL of the bacterial culture is then evenly spread on LB solid medium containing Amp (adenosine monophosphate) and incubated overnight at 37 °C to complete the transformation.

[0048] The heat shock temperature is 42 ℃, the heat shock time is 90 s, and the cooling time is 120 s.

[0049] The reaction conditions for colony PCR identification were as follows: 94 ℃, 3 min; 94 ℃, 30 s, 55 ℃, 30 s, 72 ℃, 30 s, 22 cycles; 72 ℃, 5 min.

[0050] Performance testing methods

[0051] I. Cell Infection: The lentivirus product provided in Example 1 was used to conduct the target cell infection experiment to determine the cell infection efficiency.

[0052] (a) The target cells are LNcap.

[0053] 1. Cell information for experiments

[0054]

[0055] 2. Virus Information

[0056]

[0057] 3. See results Figure 3 The control and target lentiviruses (Example 1) were infected with the target cells and observed under a microscope for fluorescence 72 hours. The results showed that the cell infection efficiency reached more than 80% and the cell state was normal.

[0058] (ii) The target cells are DU 145.

[0059] 1. Cell information for experiments

[0060]

[0061] 2. Virus Information

[0062]

[0063] 3. See results Figure 4 The control and target lentiviruses (Example 1) were infected with the target cells and observed under a microscope for fluorescence 72 hours. The results showed that the cell infection efficiency reached more than 80% and the cell state was normal.

[0064] II. Western Blot detection of target protein expression levels in target cells

[0065] 1. Genetic information

[0066]

[0067] 2. Experimental cell line / sample information

[0068] DU 145, human prostate cancer cells

[0069] 3. Experimental antibodies

[0070] 3.1 Primary Antibody Information

[0071]

[0072] 3.2 Secondary Antibody Information

[0073]

[0074] 4. Experimental parameters:

[0075] SDS-PAGE separating gel concentration: 10%

[0076] Protein loading amount: 20 µg

[0077] Colorimetric system: ECL method

[0078] 5. Test results can be found here. Figure 5 After lentiviral infection, compared with the shCtrl group, the expression of the protein TDRKH was downregulated in the shTDRKH group (after the lentiviral product provided in Example 1 infected the target cells).

[0079] III. Clonal Formation: The ability of infected cells to form clones on cell culture plates is used to indicate the tumorigenic capacity of cells infected with lentiviruses.

[0080] (a) The target cells are LNcap.

[0081] 1. Experimental parameters

[0082] Cell name: LNcap

[0083] Gene name: TDRKH

[0084] Cell seeding count: 500

[0085] Culture system: 6-well plate, 2 mL / well

[0086] Testing time: Inoculate onto a plate 5 days after infection, continue culturing for 8 days, changing the medium every 3 days.

[0087] 2. Experimental Grouping

[0088] Normal target cell group infected with shCtrl negative control lentivirus

[0089] Normal target cell group infected with shTDRKH target gene RNAi lentivirus (Example 1)

[0090] 3. See results Figure 6 After lentivirus infection, the number of clones in the shTDRKH group (after the lentivirus product provided in Example 1 infected the target cells) was reduced compared to the shCtrl group.

[0091] (ii) The target cells are DU 145.

[0092] 1. Experimental parameters

[0093] Cell name: DU 145

[0094] Gene name: TDRKH

[0095] Cell seeding count: 1000

[0096] Culture system: 6-well plate, 2 mL / well

[0097] Testing time: Inoculate onto a plate 5 days after infection, continue culturing for 8 days, changing the medium every 3 days.

[0098] 2. Experimental Grouping

[0099] Normal target cell group infected with shCtrl negative control lentivirus

[0100] Normal target cell group infected with shTDRKH target gene RNAi lentivirus (Example 1)

[0101] 3. See results Figure 7 After lentivirus infection, the number of clones in the shTDRKH group (after the lentivirus product provided in Example 1 infected the target cells) was reduced compared to the shCtrl group.

[0102] IV. Scratch Test

[0103] The target cells were DU 145.

[0104] 1. Experimental parameters

[0105] Target cells DU 145

[0106] Cell / well seeding count: 70,000

[0107] Target gene TDRKH

[0108] Culture system: 96-well plate, 100 μL / well

[0109] 2. Experimental Grouping

[0110] Normal target cell group infected with shCtrl negative control lentivirus

[0111] Normal target cell group infected with shTDRKH target gene RNAi lentivirus (Example 1)

[0112] 3. See the experimental results. Figure 8 After lentiviral infection, compared with the shCtrl group, the cell migration rate of the shTDRKH group (after the lentiviral product provided in Example 1 infected the target cells) decreased by 79% at 48h (P<0.01).

[0113] V. Apoptosis Experiment

[0114] 1. Experimental parameters:

[0115] Cell name: DU 145

[0116] Gene name: TDRKH

[0117] Culture system: 6-well plate, 2 mL / well

[0118] Detection time: when cell confluence reaches 85% (5 days after viral infection).

[0119] 2. Experimental Groups:

[0120] Normal target cell group infected with shCtrl negative control lentivirus

[0121] Normal target cell group infected with shTDRKH lentivirus targeting the target gene (Example 1)

[0122] 3. See the experimental results. Figure 9 After lentiviral infection, compared with the shCtrl group, the number of apoptotic cells in the shTDRKH group (after the lentiviral product provided in Example 1 infected the target cells) increased (P<0.01).

[0123] VI. Transwell Experiment

[0124] 1. Experimental parameters

[0125] Target cells: LNcap

[0126] Gene name: TDRKH, human

[0127] Cell / well seeding count: 50,000

[0128] Culture system: 24-well plate, 100 μL / well for the inner chamber and 600 μL / well for the outer chamber.

[0129] Incubation time (hours): 16 hours

[0130] 2. Experimental Grouping

[0131] Normal target cell group infected with shCtrl negative control lentivirus

[0132] Normal target cell group infected with shTDRKH target gene RNAi lentivirus

[0133] 3. See the experimental results. Figure 10 After lentiviral infection, compared with the shCtrl group, the Transwell transfer rate of the shTDRKH group (after the lentiviral product provided in Example 1 infected the target cells) decreased by 85% (P<0.001).

Claims

1. A lentiviral product with prostate cancer inhibitory activity, characterized in that, It carries at least one of the RNAi target sequences RNAi-21904 and RNAi-21906, wherein the coding sequences of RNAi-21904 and RNAi-21906 fragments are AAGGACATGGCCACAGAAACA and ATTGGATAAGCTTGTCAATGA, respectively.

2. The lentiviral product with prostate cancer inhibitory effect according to claim 1, characterized in that, The RNAi target sequence is mounted on a tool vector, which is BR-V108.

3. A method for constructing a lentiviral product with prostate cancer inhibitory activity according to claim 1 or 2, characterized in that, include: Vector digestion, acquisition of target gene fragment, ligation of annealing product with vector, transformation, colony PCR identification, and sequencing.

4. The method for constructing a lentiviral product with prostate cancer inhibitory effect according to claim 3, characterized in that, The enzyme digestion reaction temperature of the vector is 25-75 ℃, and the enzyme digestion reaction time of the vector is 3-12 h.

5. The method for constructing a lentiviral product with prostate cancer inhibitory activity according to claim 3, characterized in that, The acquisition of the target gene fragment includes at least single-stranded primer synthesis and primer annealing to form double-stranded DNA.

6. The method for constructing a lentiviral product with prostate cancer inhibitory activity according to claim 5, characterized in that, The primer annealing process to form double-stranded DNA involves dissolving the synthesized paired primer powder in deionized water, heating it at 90-100 ℃ for 4-6 minutes using a PCR instrument, then incubating it at 92-95 ℃ for 50-60 seconds, followed by a gradient cooling process, and finally cooling it to 25 ℃.

7. The method for constructing a lentiviral product with prostate cancer inhibitory activity according to claim 5, characterized in that, The ligation of the annealing product with the vector is specifically achieved by reacting the double-stranded DNA formed by primer annealing with the enzyme-digested vector at 10-20 ℃ for 1-3 h.

8. The method for constructing a lentiviral product with prostate cancer inhibitory activity according to claim 7, characterized in that, The transformation process involves adding the annealed product to the carrier and then incubating it in competent E. coli cells on ice for 20-40 minutes. After heat shock and cooling, the cells are then cultured in culture medium to complete the transformation.

9. The method for constructing a lentiviral product with prostate cancer inhibitory activity according to claim 8, characterized in that, The heat shock temperature is 40-45 ℃, the heat shock time is 80-100 s, and the cooling time is 100-150 s.

10. The method for constructing a lentiviral product with prostate cancer inhibitory activity according to claim 9, characterized in that, The reaction conditions for colony PCR identification were as follows: 92-96 ℃, 2-4 min; 92-96 ℃, 20-40 s, 50-60 ℃, 20-40 s, 70-75 ℃, 20-40 s, 22 cycles; 70-75 ℃, 4-6 min.

Citation Information

Patent Citations

  • Recombinant slow virus vector, recombinant slow virus and stem cell containing recombinant slow virus

    CN102154369B

  • Lentivirus for prostatic cancer as well as preparation method and application of lentivirus

    CN116590244A

  • Lentivirus for neuroblastoma gene therapy as well as preparation method and application of lentivirus

    CN116622652A