Plasma tRFs / tiRNAs markers associated with lung adenocarcinoma and applications thereof

Abstract

The present application relates to a plasma tRFs / tiRNAs marker related to lung adenocarcinoma and application thereof, the plasma tRFs / tiRNAs marker is one or combination of tRF-1:29-Pro-AGG-1-M6, tRF-55:76-Tyr-GTA-1-M2;The nucleotide sequence of tRF-1:29-Pro-AGG-1-M6 is shown as SEQ ID NO:1;The nucleotide sequence of tRF-55:76-Tyr-GTA-1-M2 is shown as SEQ ID NO:2.The present application obtains a plasma tRFs / tiRNAs marker related to lung adenocarcinoma, through the development and application of the marker and diagnostic kit, the diagnosis of lung adenocarcinoma can be more convenient and easy to operate, and help is provided for finding small molecule drug targets with potential therapeutic value.

Description

Technical Field

[0001] This invention belongs to the field of biological diagnostics and medicine, specifically relating to a plasma tRFs / tiRNAs biomarker associated with lung adenocarcinoma and its application. Background Technology

[0002] Lung cancer has long been the leading cause of death from malignant tumors worldwide, with lung adenocarcinoma (LUAD) being the most prevalent subtype (Sung et al., 2021; Zhang et al., 2020). Despite significant advancements in treatment, the 5-year overall survival (OS) for LUAD remains below 15%, as a large proportion of patients are diagnosed only when symptoms become apparent (Al-Dherasi et al., 2021). While low-dose computed tomography (LDCT) is currently the most effective early diagnostic technique for lung adenocarcinoma, it suffers from significant drawbacks, including high cost and a high false-positive rate (National Lung Screening Trial Research Team et al., 2011). Traditional serum biomarkers such as carcinoembryonic antigen (CEA) and cytokeratin fragment antigen 21-1 (CYFRA21-1) often fail to achieve early diagnosis of lung adenocarcinoma due to insufficient specificity (I and Cho, 2015). Therefore, the discovery of new early diagnostic biomarkers is of great significance for conquering lung adenocarcinoma, and will provide practical and effective help for the timely detection, early treatment and even improvement of prognosis of lung adenocarcinoma.

[0003] With the aid of high-throughput sequencing technology, a large number of non-coding RNAs (ncRNAs) have been shown to play important roles in the occurrence and development of cancer (Zhou et al., 2011). Transfer RNA-derived non-coding small RNAs (tsRNAs) have received widespread attention, with their main members being tRNA-derived fragments (tRFs) and tRNA-derived stress-inducible RNAs (tiRNAs), which are obtained by nucleases through specific cleavage of precursor or mature tRNAs (Xu et al., 2017; Saikia and Hatzoglou, 2015). Research on tRFs / tiRNAs can be traced back to the 1970s, when Borek E et al. discovered that a large number of tRFs / tiRNAs in tumor tissues originated from highly turnover tRNAs (Borek et al., 1977). Subsequently, a series of studies detected abundant tRFs / tiRNAs in cells, tissues, and body fluids (Honda et al., 2015; Sharma et al., 2016; Godoy et al., 2018), demonstrating that stably present tRFs / tiRNAs play important regulatory roles in gene expression, protein translation, and epigenetic modification (Kuscu et al., 2018; Lyonset et al., 2020; Watanabe et al., 2011). Recent evidence indicates that tRFs / tiRNAs are aberrantly expressed in neurological diseases, metabolic diseases, and cancer (Oberbauer et al., 2018). Specifically, studies have shown that tiRNA-Gln-CTG-003, tiRNA-His-GTG-001, and tRF-Ala-AGC-002 are abnormally expressed in advanced ovarian cancer tissues, while 5'-tRF-LysCTT is significantly overexpressed in bladder cancer patients (Chen et al., 2021; Papadimitriou et al., 2020). Furthermore, Shao Y et al. showed that tRF-Leu-CAG is upregulated in non-small cell lung cancer tumor tissues and cell lines, and observed that its expression in non-small cell lung cancer serum is significantly correlated with tumor stage progression (Shao et al., 2017). Li J et al. found elevated expression of tRF-31-79MP9P9NH57SD in the serum of non-small cell lung cancer patients, and its expression level was associated with clinical stage and lymph node malignancy (Li et al., 2022). Therefore, there is reason to believe that tRFs / tiRNAs can serve as candidate molecular biomarkers for cancer monitoring.

[0004] Currently, there are no reported studies on the relationship between tRFs / tiRNAs and lung adenocarcinoma. If we could screen for... Using abnormally expressed plasma tRFs / tiRNAs in lung adenocarcinoma as biomarkers and developing corresponding diagnostic kits will greatly advance the current state of lung adenocarcinoma diagnosis. Summary of the Invention

[0005] The purpose of this invention is to provide a plasma tRFs / tiRNAs biomarker associated with lung adenocarcinoma and its application in the preparation of a kit for diagnosing lung adenocarcinoma. Furthermore, this invention also provides specific primers for the plasma tRFs / tiRNAs biomarker associated with lung adenocarcinoma and their applications.

[0006] The objective of this invention is achieved through the following technical solution: A plasma tRFs / tiRNAs biomarker associated with lung adenocarcinoma, wherein the plasma tRFs / tiRNAs biomarker is one or a combination of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2; the nucleotide sequence of tRF-1:29-Pro-AGG-1-M6 is shown in SEQ ID NO: 1; and the nucleotide sequence of tRF-55:76-Tyr-GTA-1-M2 is shown in SEQ ID NO: 2.

[0007] The application of the plasma tRFs / tiRNAs biomarkers in the preparation of a kit for diagnosing lung adenocarcinoma.

[0008] The present invention provides a kit for diagnosing lung adenocarcinoma, comprising primers for amplifying one or a combination of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2.

[0009] The primer sequences used to amplify tRF-1:29-Pro-AGG-1-M6 are as follows: F:5'-GATCGGCTCGTTGGTCTAGG -3' (SEQ ID NO: 3), R: 5'-CTTCCGATCTCGAGAATCATACC-3' (SEQ ID NO: 4).

[0010] The primer sequences used to amplify tRF-55:76-Tyr-GTA-1-M2 are as follows: F:5'- CAGTCCGACGATTCTCGAATCC -3' (SEQ ID NO: 5), R: 5'-GCTCTTCCGATCTTGGTCCTTC-3' (SEQ ID NO: 6).

[0011] The kit further includes internal control primers for amplifying internal control U6; the sequence of the internal control primers is as follows: F:5'-GCTTCGGCAGCACATATACTAAAAT-3' (SEQ ID NO: 7), R: 5'-CGCTTCACGAATTTGGCGTGTCAT-3' (SEQ ID NO: 8).

[0012] This invention also provides specific primers for plasma tRFs / tiRNAs biomarkers associated with lung adenocarcinoma. The specific primers for tRF-1:29-Pro-AGG-1-M6 are: F:5'-GATCGGCTCGTTGGTCTAGG -3', R:5'-CTTCCGATCTCGAGAATCATACC -3'; The specific primers for tRF-55:76-Tyr-GTA-1-M2 are: F:5'-CAGTCCGACGATCTCGAATCC-3', R:5'-GCTCTTCCGATCTTGGTCCTTC-3'.

[0013] The present invention also provides the application of the specific primers described herein in the preparation of diagnostic reagents for lung adenocarcinoma.

[0014] Compared with the prior art, the advantages of the present invention are as follows: This invention utilizes high-throughput sequencing technology to analyze the plasma tRFs / tiRNA expression profiles of lung adenocarcinoma patients and healthy controls. tiRNA-1:34-Val-CAC-2, tRF-1:29-Pro-AGG-1-M6, and tRF-55:76-Tyr-GTA-1-M2 were screened as candidate tRFs / tiRNAs and further validated by quantitative real-time polymerase chain reaction (qRT-PCR). Furthermore, receiver operating characteristic (ROC) curves were used to assess the diagnostic efficacy of plasma tRFs / tiRNAs. Finally, this invention employs bioinformatics techniques to predict potential target genes and regulatory networks of tRFs / tiRNAs, and further explores their major cellular biological functions and related molecular mechanisms in lung adenocarcinoma.

[0015] This invention screened seven tRFs / tiRNAs using qRT-PCR. The results showed that tiRNA-1:34-Val-CAC-2, tRF-1:29-Pro-AGG-1-M6, and tRF-55:76-Tyr-GTA-1-M2 were expressed in lung adenocarcinoma, matching the sequencing results. These three were selected as candidate tRFs / tiRNAs and used for further ROC curve analysis. Further validation of the candidate tRFs / tiRNAs showed that, compared with healthy subjects, tRF-55:76-Tyr-GTA-1-M2 was upregulated in lung adenocarcinoma, while the expression of tRF-1:29-Pro-AGG-1-M6 was significantly downregulated. The AUCs of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 reached 0.882 and 0.896, respectively, demonstrating better diagnostic value in patients with lung adenocarcinoma. This study also evaluated the correlation between their expression levels in lung adenocarcinoma and clinicopathological features. Results showed that tRF-55:76-Tyr-GTA-1-M2 expression was significantly increased in lung adenocarcinoma patients, suggesting a positive correlation with the malignancy of lung adenocarcinoma. Conversely, the expression level of tRF-1:29-Pro-AGG-1-M6 was negatively correlated with the clinical stage of lung adenocarcinoma, indicating that its high expression has great potential in inhibiting tumor progression. Furthermore, compared with preoperative levels, the expression of tRF-1:29-Pro-AGG-1-M6 was downregulated after tumor resection, while the expression level of tRF-55:76-Tyr-GTA-1-M2 was conversely increased. Therefore, it can be concluded that the expression levels of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 are closely related to the presence of tumors before and after surgery in patients with lung adenocarcinoma.

[0016] This invention screened and identified tRF-55:76-Tyr-GTA-1-M2 and tRF-1:29-Pro-AGG-1-M6 as having high sensitivity and specificity in the diagnosis of lung adenocarcinoma.

[0017] This invention provides plasma tRFs / tiRNAs biomarkers associated with lung adenocarcinoma. The development and application of plasma tRFs / tiRNAs biomarkers and diagnostic kits can make the diagnosis of lung adenocarcinoma more convenient and easier, provide a foundation for clinical treatment, and help discover small molecule drug targets with potential therapeutic value.

[0018] The kit proposed in this invention, which is related to plasma tRFs / tiRNAs biomarkers and is used to diagnose lung adenocarcinoma, can be used for the auxiliary early diagnosis of lung adenocarcinoma patients. It helps to reflect the disease status of lung adenocarcinoma patients and provides better support for clinical treatment. Attached Figure Description

[0019] Figure 1 This is the expression profile of tRFs / tiRNAs in the plasma of patients with lung adenocarcinoma and healthy controls; Among them, (A) a heatmap of correlation coefficients for all samples, with darker colors in the panel indicating higher correlation coefficients between two samples; (B) a PCA plot of tRFs / tiRNAs expression profiles between lung adenocarcinoma patients and healthy controls; (C) a Venn diagram showing the number of tRFs / tiRNAs detected and collected in tRFdb in this project; and (D) a Venn diagram showing the commonly and specifically expressed tRFs / tiRNAs between early-stage lung adenocarcinoma and healthy controls, late-stage lung adenocarcinoma and healthy controls, and early-stage and late-stage lung adenocarcinoma.

[0020] Figure 2 This is a graph showing the plasma tRFs / tiRNAs subtype analysis of lung adenocarcinoma patients and healthy controls; Among them, (AC) the distribution of tRFs / tiRNAs isotypes in healthy controls, early-stage lung adenocarcinoma, and late-stage lung adenocarcinoma; (DF) the number of tRFs / tiRNAs isotypes corresponding to tRNA isoforms in healthy controls, early-stage lung adenocarcinoma, and late-stage lung adenocarcinoma; and (GI) the relationship between the frequency of tRFs / tiRNAs isotypes and their lengths in healthy controls, early-stage lung adenocarcinoma, and late-stage lung adenocarcinoma.

[0021] Figure 3 This is a graph showing the results of differential expression analysis of tRFs / tiRNAs in early-stage lung adenocarcinoma, late-stage lung adenocarcinoma, and healthy controls.

[0022] Among them, (A) a hierarchical clustering heatmap shows differentially expressed tRFs / tiRNAs between early-stage lung adenocarcinoma and healthy controls, late-stage lung adenocarcinoma and healthy controls, and early-stage and late-stage lung adenocarcinoma; (B) a volcano plot of differentially expressed tRFs / tiRNAs between early-stage lung adenocarcinoma and healthy controls, late-stage lung adenocarcinoma and healthy controls, and early-stage and late-stage lung adenocarcinoma; (C) seven tRFs / tiRNAs (tiRNA-1:34-Val-CAC-2, tRF-1:15-Ala-AGC-2-M11, tRF-1:24-Ser-AGA-1-M7, tRF-1:29-Pro-AGG-1-M6, tRF-55:76-Tyr-GTA-1-M2, tRF-59:75-Trp-CCA-1-M5 and tRF-61:77). The relative expression levels of -Thr-AGT-1-M2 in healthy controls, early-stage lung adenocarcinoma, and advanced-stage lung adenocarcinoma; p<0.05, p<0.01 and p < 0.001; ns, meaningless.

[0023] Figure 4 This is a graph showing the expression levels and diagnostic value of candidate plasma tRFs / tiRNAs in lung adenocarcinoma; Among them, (AC) the relative expression levels of tiRNA-1:34-Val-CAC-2, tRF-1:29-Pro-AGG-1-M6, and tRF-55:76-Tyr-GTA-1-M2 in lung adenocarcinoma patients compared with normal controls; (D, E) the diagnostic efficacy of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 in lung adenocarcinoma patients.

[0024] Figure 5 This is a graph showing the expression levels and diagnostic value of candidate plasma tRFs / tiRNAs in lung adenocarcinoma before and after surgery. The relative expression levels of (AC)tiRNA-1:34-Val-CAC-2, tRF-1:29-Pro-AGG-1-M6, and tRF-55:76-Tyr-GTA-1-M2 in patients with lung adenocarcinoma before and after surgery; and the diagnostic efficacy of (D, E)tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 in patients with lung adenocarcinoma before and after surgery.

[0025] Figure 6 This is a bioinformatics analysis diagram of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2; Among them, (A, B) the positions of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 in the cloverleaf secondary structure of tRNA and their target sites. (C) the target genes of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2. (D) GO enrichment analysis of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2. (E) KEGG pathway analysis of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2.

[0026] Figure 7 These are the amplification curves of tRF-1:29-Pro-AGG-1-M6, tRF-55:76-Tyr-GTA-1-M2, and U6.

[0027] Figure 8 These are the melting curves of tRF-1:29-Pro-AGG-1-M6, tRF-55:76-Tyr-GTA-1-M2, and U6. Detailed Implementation

[0028] The present invention will now be described in detail with reference to the accompanying drawings and embodiments: 1. Materials and Methods 1.1 Clinical Information All plasma samples involved in this invention were collected from lung adenocarcinoma patients and healthy individuals who visited Fujian Provincial Hospital between January 2021 and March 2022.

[0029] All patients with lung adenocarcinoma were pathologically confirmed and excluded patients with hypertension, diabetes, severe liver and kidney disease, metastases, and other systemic diseases. There were 19 males and 28 females, aged 28–80 years, with a mean age of 56.02 ± 10.42 years. The lung adenocarcinoma was staged according to the 2010 Tumor-Lymph Node-Metastasis (TNM) staging system of the International Union for Cancer Control (UICC) / American Joint Committee on Cancer (AJCC).

[0030] All healthy controls were excluded from having lung diseases, tumors, or other systemic diseases. There were 9 males and 12 females, aged 26 to 77 years, with a mean age of 47.71 ± 12.48 years.

[0031] Plasma samples from four individuals with early-stage lung adenocarcinoma, four with late-stage lung adenocarcinoma, and four healthy controls were randomly selected from all experimental subjects for sequencing analysis. The remaining samples were reserved for subsequent studies.

[0032] Plasma samples from 47 patients with lung adenocarcinoma were selected for quantitative real-time polymerase chain reaction (qRT-PCR) analysis.

[0033] Plasma samples from 12 patients with lung adenocarcinoma were selected to evaluate the expression levels and potential value of tRFs / tiRNAs before and after surgical resection of lung adenocarcinoma.

[0034] Collect and record all relevant clinical data of participants in detail.

[0035] This study obtained written informed consent from all participants and was approved by the Ethics Committee of Fujian Provincial Hospital (K2021-03-054).

[0036] 2. Extraction and pretreatment of plasma RNA First, total RNA was extracted from plasma using TRIzol LS reagent. Then, the concentration and purity of each RNA sample were assessed using a Nanodrop ND-1000 spectrophotometer. Next, the absorbance of all RNA samples was measured at 260 and 280 nm wavelengths, and the OD260 / OD280 ratio was calculated (the ratio should be 1.8–2.1). RNA integrity was then checked using agarose gel electrophoresis. Furthermore, the total RNA was pretreated to remove some RNA modifications that interfered with the construction of small RNA sequencing libraries. This process was as follows: 3'-aminoacyl (charged) deacylation to 3'-OH for 3'-linker ligation; 3'-cP (2',3'-cyclic phosphate) to 3'-OH for 3'-linker ligation; 5'-OH (hydroxyl) phosphorylation to 5'-P for 5'-linker ligation; and m1A and m3C demethylation for efficient reverse transcription.

[0037] 3. Library preparation and tRFs / tiRNAs sequencing Pretreated total RNA was used to prepare sequencing libraries. First, total RNA from each sample was sequentially ligated to 3' and 5' small RNA adapters. Then, cDNA was synthesized and amplified using Illumina's proprietary RT primers and amplification primers. Subsequently, PCR amplification fragments of 134–160 bp were extracted and purified from PAGE gels. Finally, the completed libraries were quantified using an Agilent 2100 Bioanalyzer. These libraries were denatured into single-stranded DNA molecules, captured on Illumina flow cells, amplified in situ as sequencing clusters, and sequenced for 50 cycles on an Illumina NextSeq 500 system according to the manufacturer's instructions.

[0038] 4. Data analysis of tRFs / tiRNAs sequencing Image analysis and base calling were performed using Solexa pipeline v1.8 (Off-Line Base Caller software, v1.8). Sequencing quality was checked by FASTQC. Raw data files in FASTQC format were generated by an Illumina sequencer. To check sequencing quality, a quality score plot was created for each sample. The quality score Q was logarithmically correlated with the base calling error probability (P). After checking sequencing quality with Illumina, sequencing reads were pruned with 5' and 3' adapters to remove useless reads (<14 nt or >40 nt in length) and recorded in FASTA format. Only one mismatch with the mature tRNA sequence was allowed in the FASTA-pruned reads, and then unmapped reads were aligned using bowtie software, allowing only one mismatch with the precursor tRNA sequence. The remaining reads were aligned, allowing only one mismatch with the miRDeep2 miRNA reference sequence. The abundance of tRFs / tiRNAs was assessed using their sequencing counts and normalized to one part per million of aligned read counts (CPM). Based on comparative statistical analysis (alignment rate, read length, fragment sequence bias), we determined whether the results could be used for subsequent data analysis. If so, expression profiles and differentially expressed tRFs / tiRNAs and miRNAs were calculated. A fold change ≥1.5 and a p-value ≤0.05 were used to screen for differentially expressed tRFs / tiRNAs. Principal component analysis (PCA), correlation analysis, pie charts, Venn diagrams, hierarchical clustering, scatter plots, and volcano plots were performed on the differentially expressed tRFs / tiRNAs using R or Perl.

[0039] 5. QRT-PCR analysis RNA pretreatment and cDNA synthesis were performed using the rtStar™ tRF&tiRNA Pretreatment Kit and the rtStar™ First-Strand cDNA Synthesis Kit, respectively, according to the manufacturer's instructions. The synthesized cDNA was analyzed by qRT-PCR on a LightCycler 480 real-time quantitative PCR system (Roche, Switzerland) according to the manufacturer's 2× PCR MasterMix Kit protocol. All reactions were performed in triplicate, and the relative expression levels of tRFs / tiRNAs were calculated using a 2× PCR method. -ΔΔCt and 2 -ΔCt The method is used for calculation, with U6 as an intrinsic parameter.

[0040] The specific primers used for amplifying the sequences are shown in Table 1.

[0041] 5.1 Prepare Real-time PCR reaction systems for all cDNA samples separately. The system configurations are as follows: 2 × Master Mix 5 µl 0.5µl of 10µM PCR-specific primer F 0.5µl of 10µM PCR-specific primer R Add water to a total volume of 8µl Gently tap the bottom of the tube to mix the solution, then briefly centrifuge at 5000 rpm.

[0042] 5.2. Sample addition a. Add 8 μL of the mixture to each well of the 384-PCR plate.

[0043] b. Add the corresponding 2µl cDNA.

[0044] c. Carefully apply Sealing Film to seal the container and briefly centrifuge to mix.

[0045] d. Place the prepared PCR plate on ice before setting up the PCR program.

[0046] 5.3 Place the 384-PCR plate on a Realtime PCR instrument to perform the PCR reaction.

[0047] All indicators are performed according to the following procedure: 95℃, 10 min; 40 PCR cycles (95℃, 10 s; 60℃, 60 s (collect fluorescence)).

[0048] To establish the melting curve of the PCR product, after the amplification reaction, the following steps were performed: (95℃, 10 seconds; 60℃, 60 seconds; 95℃, 15 seconds); and the temperature was slowly increased from 60℃ to 95℃ (automatically by the instrument - Ramp Rate was 0.075℃ / second).

[0049] 5.4 Results and Calculations The target gene and housekeeping gene (U6) of each sample were subjected to Real-time PCR reactions. Based on the plotted serially diluted DNA standard curve, the concentration results of the target gene and housekeeping gene for each sample were directly generated by the machine. The corrected relative content of the target gene in each sample was obtained by dividing the concentration of its housekeeping gene by the concentration of its housekeeping gene.

[0050] like Figure 7 As shown, tRF-1-29-Pro-AGG-1-M6 was present in normal control blood samples and lung adenocarcinoma blood samples. Figure 7 a) tRF-55-76-Tyr-GTA-1-M2 ( Figure 7b) Internal reference U6(( Figure 7 c) All results were effectively amplified, consistent with the gene sequencing results. Figure 8 For tRF-1-29-Pro-AGG-1-M6 ( Figure 8 a), tRF-55-76-Tyr-GTA-1-M2 ( Figure 8 b) and internal reference U6 ( Figure 8 c) Melting curves. The fact that each melting curve shows a single specific peak indicates that the corresponding primer has good specificity.

[0051] Table 1 Primer sequences for qRT-PCR

[0052] Where F represents the forward primer (upstream primer); R represents the reverse primer (downstream primer). 6. Electrochemiluminescence immunoassay for the expression of CEA, NSE, and SCC in serum. Serum CEA, NSE, and SCC expression levels were quantitatively determined using the original kit on a Cobas E602 instrument (Roche Diagnostics, Switzerland) according to the manufacturer's instructions. The cutoff values ​​for CEA, NSE, and SCC were 5 ng / mL, 16.3 ng / mL, and 2.7 ng / mL, respectively.

[0053] 7. Bioinformatics analysis of tRFs / tiRNAs The exact location of each tRF in the secondary structure of derived tRNAs was determined using the GtRNAdb database (http: / / gtrnadb.ucsc.edu / ). Potential target genes of tRFs / tiRNAs were then mined using the TargetScan (http: / / www.targetscan.org / vert_72 / ) and Miranda (http: / / www.microrna.org / microrna / ) databases. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed on tRFs / tiRNAs using KOBAS 3.0 software.

[0054] 8. Statistical Analysis Statistical analyses were performed using SPSS Statistics 24.0 (SPSS, Chicago, IL) and GraphPad Prism 8.0 software (GraphPad Software, La Jolla, CA). Unpaired t-tests were used to assess differences between all lung adenocarcinoma patients and healthy controls. Paired t-tests were used to assess differences in lung adenocarcinoma patients before and after surgery. Diagnostic value was determined by calculating the area under the receiver operating characteristic (ROC) curve. All measurements are expressed as mean and standard error of the mean (SEM). The Youden index was used to calculate the optimal cutoff value for tRFs / tiRNAs. p < 0.05 was considered statistically significant.

[0055] 9. Results 9.1 Expression profile of tRFs / tiRNAs in plasma As a core criterion for evaluating the rationality and reliability of sample selection, the closer the sample correlation coefficient is to 1, the higher the similarity between any two samples. This study, by calculating the sample correlation coefficient, indicates that the 12 selected plasma samples were suitable for this sequencing analysis, and the results are accurate and reliable. Figure 1 A). PCA results showed significant differences in tRFs / tiRNAs expression profiles between lung adenocarcinoma patients and healthy controls (Figure 1B). Figure 1 As shown in C, sequencing analysis of tRFs / tiRNAs identified a total of 506 tRNA derivatives, including 431 tRNA derivatives not annotated in the tRFdb database. Furthermore, as... Figure 1 As shown in D, there are common and specific expressions of tRFs / tiRNAs in early-stage lung adenocarcinoma and healthy controls, late-stage lung adenocarcinoma and healthy controls, and early-stage and late-stage lung adenocarcinoma.

[0056] 9.2 Plasma tRFs / tiRNAs Subtype Analysis Pie charts of tRFs / tiRNA distribution subtypes show that the number of each tRFs / tiRNA subtype differed between early-stage lung adenocarcinoma, late-stage lung adenocarcinoma, and healthy controls (Figures 2A, 2B, 2C). Compared to normal controls, the numbers of tRF-1, tRF-3a, tRF-3b, and tRF-5a were increased in early-stage and late-stage lung adenocarcinoma. Furthermore, tRF-1 and tRF-5b were significantly elevated in late-stage lung adenocarcinoma compared to early-stage lung adenocarcinoma. Figure 2As shown in sections D, E, and F, Arg-TCT, Leu-TAA, Phe-GAA, and Ser-CGA, present in lung adenocarcinoma, are four tRNA isoforms not found in healthy controls. Furthermore, although the tRNA isoforms share the same anticodon, the types and numbers of tRFs and tiRNAs are different in healthy controls, early-stage lung adenocarcinoma, and late-stage lung adenocarcinoma. The frequencies of tRFs / tiRNAs isoforms also differ among tRNAs of different sequence lengths. Figure 2 As shown in G, 2H, and 2I, this study further found that the frequencies of tRFs / tiRNAs subtypes with the same sequence length also differed significantly among the control group, early-stage, and late-stage lung adenocarcinoma.

[0057] 9.3 Differential expression analysis of tRFs / tiRNAs Unsupervised hierarchical clustering heatmaps revealed significant changes in tRFs / tiRNAs expression between any two groups in the healthy control group, early-stage lung adenocarcinoma group, and late-stage lung adenocarcinoma group (Figure 3A). Figure 3 As shown in Part B, 40 tRFs / tiRNAs were upregulated and 34 were downregulated between patients with early-stage lung adenocarcinoma and healthy controls; among the differentially expressed tRFs / tiRNAs between patients with advanced lung adenocarcinoma and healthy controls, 24 were upregulated and 25 were downregulated; compared with early-stage lung adenocarcinoma, patients with advanced lung adenocarcinoma showed increased expression of tRFs / tiRNAs and decreased expression of 16 tRFs / tiRNAs. Based on the CPM results, seven tRFs / tiRNAs (tiRNA-1:34-Val-CAC-2, tRF-1:15-Ala-AGC-2-M11, tRF-1:24-Ser-AGA-1-M7, tRF-1:29-Pro-AGG-1-M6, tRF-55:76-Tyr-GTA-1-M2, tRF-59:75-Trp-CCA-1-M5, and tRF-61:77-Thr-AGT-1-M2) that showed high homogeneity and heterogeneity among different groups were selected, and their expression levels were evaluated by qRT-PCR. The results showed that tiRNA-1:34-Val-CAC-2, tRF-1:24-Ser-AGA-1-M7, tRF-1:29-Pro-AGG-1-M6, tRF-55:76-Tyr-GTA-1-M2, and tRF-61:77-Thr-AGT-1-M2 were differentially expressed in lung adenocarcinoma. Figure 3C). Finally, based on the relative expression levels of each tRFs / tiRNAs, this project selected three differentially expressed tRFs / tiRNAs (tiRNA-1:34-Val-CAC-2, tRF-1:29-Pro-AGG-1-M6, and tRF-55:76-Tyr-GTA-1-M2) as candidate tRFs / tiRNAs for subsequent studies.

[0058] 9.4 Expression levels and diagnostic efficacy of candidate plasma tRFs / tiRNAs in lung adenocarcinoma The specific expression levels of tiRNA-1:34-Val-CAC-2, tRF-1:29-Pro-AGG-1-M, and tRF-55:76-Tyr-GTA-1-M2 in the plasma of patients with lung adenocarcinoma were further analyzed by qRT-PCR. Compared with the normal control group, the expression level of tRF-1:29-Pro-AGG-1-M6 was significantly downregulated in lung adenocarcinoma, while the expression level of tRF-55:76-Tyr-GTA-1-M2 was significantly upregulated (Figures 4B and 4C). However, as... Figure 4 As shown in Figure A, there was no significant difference in plasma tiRNA-1:34-Val-CAC-2 expression in lung adenocarcinoma compared to healthy controls. Further analysis was conducted to determine the diagnostic value of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 in lung adenocarcinoma. The AUCs for tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 were 0.882 (95% CI = 0.794–0.970) and 0.896 (95% CI = 0.821–0.970), respectively. Furthermore, the optimal cutoff values ​​for tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 were 0.9575 (sensitivity 85.7%, specificity 76.6%) and 2.277 (sensitivity 78.7%, specificity 85.7%), respectively. Therefore, it is concluded that tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 have great potential in the diagnosis of lung adenocarcinoma.

[0059] 9.5 Correlation between expression levels of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 and clinicopathological features The correlation between the expression levels of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 and clinicopathological features was further evaluated. As shown in Table 2, the expression of tRF-1:29-Pro-AGG-1-M6 was associated with TNM stage, N stage, and CEA expression levels, but not with age, sex, T stage, M stage, diameter, or NSE and SCC expression levels. Furthermore, the expression of tRF-55:76-Tyr-GTA-1-M2 in lung adenocarcinoma was significantly associated with TNM stage, T stage, N stage, M stage, diameter, and CEA and SCC expression levels, but not with age, sex, or NSE expression levels.

[0060] Table 2. Expression levels of tRF-1-29-Pro-AGG-1-M6 and tRF-55-76-Tyr-GTA-1-M2 Correlation with clinicopathological features of lung adenocarcinoma patients

[0061] 9.6 Expression and potential value of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 in lung adenocarcinoma before and after surgery The value of three candidate tRFs / tiRNAs in monitoring lung adenocarcinoma treatment was evaluated by analyzing their expression in 12 pairs of preoperative and postoperative plasma samples. Although there was no difference in tiRNA-1:34-Val-CAC-2 expression before and after lung adenocarcinoma surgery, the expression of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 was significantly downregulated and upregulated, respectively, after surgery compared to preoperative levels. Further ROC analysis demonstrated that the expression levels of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 before and after lung adenocarcinoma surgery could effectively help differentiate patients' treatment status, with AUCs of 0.899 (95% CI = 0.770–1.000) and 0.896 (95% CI = 0.745–1.000), respectively. The above findings confirm that tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 can serve as valuable plasma biomarkers for assessing the surgical outcomes of patients with lung adenocarcinoma.

[0062] 9.7 Prediction and functional analysis of potential target genes of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 In addition to showing the positions of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 on the cloverleaf secondary structure of their respective tRNAs, Figure 6A and Figure 6 B also shows their respective target sites. The regulatory network diagrams of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 show that one tsRNA can correspond to multiple mRNAs ( Figure 6 C). GO functional analysis showed that the target genes of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 are widely distributed in the cytoplasm, nucleus, and nucleoplasm, playing an important role in the nucleus. Furthermore, these target genes also play a role in cell growth and development through biological processes such as promoting protein binding and the binding of identical proteins. Figure 6 D). KEGG pathway enrichment analysis showed that the target genes of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 were mainly enriched in cancer-related signaling pathways, including metabolic pathways, pyrimidine metabolism, MAPK signaling pathway, calcium signaling pathway, and HIF-1 signaling pathway, etc. Figure 6 E).

[0063] 10. Analysis of the present invention Lung adenocarcinoma is currently the most prevalent subgroup of lung cancer. A key reason for the poor prognosis of lung adenocarcinoma is that many patients cannot receive timely and effective diagnosis and treatment. TsRNAs, as emerging biomarkers, have been increasingly discovered by researchers due to their stable presence in bodily fluids and are being actively used for disease diagnosis, treatment, and monitoring (Xue et al., 2017; Zhang et al., 2021). Recent studies have shown that key members of tsRNAs, tRFs and tiRNAs, are biomarkers with great potential, influencing tumor development and progression by acting on protein translation and gene expression in tumor cells (Ivanov et al., 2011; Haussecker et al., 2010; Zhu et al., 2020). This invention analyzes the expression profiles of tRFs / tiRNAs in the plasma of lung adenocarcinoma patients using high-throughput sequencing technology. An unexpected discovery was made of 431 novel tRFs / tiRNAs not annotated in the tRFdb database; further research on these will help uncover their value in lung adenocarcinoma. Furthermore, compared with healthy controls, 350 and 344 differentially expressed tRFs / tiRNAs were observed in early-stage and advanced-stage lung adenocarcinoma, respectively. Complementary isoform identification of tRFs / tiRNAs revealed abnormally elevated expression levels of tRF-1, tRF-3a, tRF-3b, and tRF-5a in lung adenocarcinoma patients. Further analysis revealed that the isoforms tRF-1, tRF-3a, tRF-3b, and tRF-5a, corresponding to the tRNA isoforms Arg-TCT, Leu-TAA, Phe-GAA, and Ser-CGA, respectively, were abnormally expressed in lung adenocarcinoma, even though they were not expressed in healthy controls. In addition, previous studies have indicated differential expression of tRFs / tiRNAs in lung adenocarcinoma tissue samples. This study reveals, from another perspective, the abnormal expression of tRFs / tiRNAs in plasma samples from lung adenocarcinoma patients, which supports the exploration of tRFs / tiRNAs as potential biomarkers for lung adenocarcinoma.

[0064] This invention screened seven tRFs / tiRNAs using qRT-PCR. The results showed that tiRNA-1:34-Val-CAC-2, tRF-1:29-Pro-AGG-1-M6, and tRF-55:76-Tyr-GTA-1-M2 were expressed in lung adenocarcinoma, matching the sequencing results. These three were selected as candidate tRFs / tiRNAs and used for further ROC curve analysis. Further validation of the candidate tRFs / tiRNAs showed that, compared with healthy subjects, tRF-55:76-Tyr-GTA-1-M2 was upregulated in lung adenocarcinoma, while the expression of tRF-1:29-Pro-AGG-1-M6 was significantly downregulated. In contrast, tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 had AUCs of 0.882 and 0.896, respectively, demonstrating better diagnostic value in patients with lung adenocarcinoma. More encouragingly, this invention also evaluated the correlation between their expression levels in lung adenocarcinoma and clinicopathological features. The results showed that tRF-55:76-Tyr-GTA-1-M2 expression was significantly elevated in patients with lung adenocarcinoma, suggesting a positive correlation with the malignancy of lung adenocarcinoma. Meanwhile, the expression level of tRF-1:29-Pro-AGG-1-M6 was negatively correlated with the clinical stage of lung adenocarcinoma, indicating that its high expression has great potential in inhibiting tumor progression. Furthermore, compared to preoperative levels after lung adenocarcinoma surgery, the expression of tRF-1:29-Pro-AGG-1-M6 was downregulated after tumor resection, while the expression level of tRF-55:76-Tyr-GTA-1-M2 was conversely increased. Therefore, it can be concluded that the expression levels of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2 are closely related to the presence of tumors before and after surgery in lung adenocarcinoma patients. This invention screened and determined that tRF-55:76-Tyr-GTA-1-M2 and tRF-1:29-Pro-AGG-1-M6 have high sensitivity and specificity in the diagnosis of lung adenocarcinoma.

[0065] This invention explores the downstream regulatory mechanisms of tRF-55:76-Tyr-GTA-1-M2 and tRF-1:29-Pro-AGG-1-M6, revealing their involvement in multiple key biological signaling pathways, such as metabolic pathways, pyrimidine metabolism, calcium signaling pathways, MAPK signaling pathways, and HIF-1 signaling pathways. The results indicate that tRF-55:76-Tyr-GTA-1-M2 and tRF-1:29-Pro-AGG-1-M6 influence the occurrence and progression of lung adenocarcinoma through these tumor-related signaling pathways, providing direction for further exploration of their mechanisms.

[0066] In summary, the study of this invention revealed the expression profile of tRFs / tiRNAs in the plasma of patients with lung adenocarcinoma and determined that tRF-55:76-Tyr-GTA-1-M2 and tRF-1:29-Pro-AGG-1-M6 can serve as biomarkers for the diagnosis of lung adenocarcinoma.

Claims

1. The application of specific primers for detecting plasma tRFs / tiRNAs biomarkers in the preparation of a kit for diagnosing lung adenocarcinoma, characterized in that: The plasma tRFs / tiRNAs markers are one or a combination of tRF-1:29-Pro-AGG-1-M6 and tRF-55:76-Tyr-GTA-1-M2; the nucleotide sequence of tRF-1:29-Pro-AGG-1-M6 is shown in SEQ ID NO: 1; the nucleotide sequence of tRF-55:76-Tyr-GTA-1-M2 is shown in SEQ ID NO:

2.

2. The application as described in claim 1, characterized in that: The specific primers for tRF-1:29-Pro-AGG-1-M6 are: F:5'-GATCGGCTCGTTGGTCTAGG -3', R:5'-CTTCCGATCTCGAGAATCATACC-3'.

3. The application according to claim 1 or 2, characterized in that: The specific primers for tRF-55:76-Tyr-GTA-1-M2 are: F:5'- CAGTCCGACGATCTCGAATCC -3', R:5'-GCTCTTCCGATCTTGGTCCTTC-3'.

4. The application according to claim 1, characterized in that: The kit also includes internal reference primers for amplifying internal reference U6; the sequences of the internal reference primers are: F: 5'-GCTTCGGCAGCACATATACTAAAAT-3', R: 5'-CGCTTCACGAATTTGCGTGTCAT-3'.

Images