A method for screening two-line hybrid wheat seed production parents with stable flowering period

Abstract

The present invention belongs to the field of molecular biology, and the specific field is a method for screening a two-line hybrid wheat seed production parent with a stable flowering period. The method can select a seed production combination with the same flowering period, and use its genotype as a marker to improve wheat with a stable flowering period. A combination of a sterile line and a restorer line whose growth degree days from sowing to flowering are stable between two years and whose growth degree days reach a significant level is selected, and the combination of this genotype is used as a seed production combination parent with a stable flowering period. The method can be used to efficiently identify and screen wheat with a stable flowering period.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and specifically relates to a method for screening two-line hybrid wheat seed production parents with stable flowering period. Background Art

[0002] Hybrid wheat has the potential to significantly increase wheat yield. Two-line hybrid wheat uses a "two-line method" breeding system of photothermosensitive sterile lines and restorer lines to create hybrid wheat varieties that are superior to parents or control varieties in yield, stress resistance and other traits. However, hybrid wheat often faces the problem of low and unstable seed production. The development process of two-line hybrid wheat parents is inconsistent, and the flowering period of seed production combinations does not meet each other from year to year. This is one of the main factors leading to its low and unstable seed production yield, which brings huge risks to hybrid wheat seed production and has become a difficult problem that needs to be overcome in the development of the hybrid wheat industry. Identifying and selecting wheat with stable flowering period for seed production is one of the most economical, effective and environmentally safe measures to solve the problem of inconsistent flowering period of seed production combinations and stabilize and improve the seed production yield of two-line hybrid wheat. In addition, this also helps to reduce the risk of hybrid wheat seed production. A large number of studies have shown that photoperiod genes and vernalization genes are key genes that determine the flowering period of wheat, but the flowering period of wheat of different genotypes is different due to the effects of external light and temperature conditions.

[0003] Calendar days from sowing to flowering are a common measurement indicator for wheat flowering period. Temporal and spatial differences can lead to different temperatures or light durations during wheat development, and the flowering period of wheat identified by this indicator is characterized by large and unstable changes in flowering period due to temporal and spatial differences, which often results in inconsistent flowering periods in seed production combinations in two-line hybrid wheat parents.

[0004] In recent years, molecular markers based on DNA sequence polymorphism have been highly valued by breeders at home and abroad. KASP technology (competitive allele-specific PCR) is one of the mainstream genotyping methods in the world. It accurately judges the double allele of SNP and InDel at a specific site based on the specific matching of primer terminal bases.

[0005] The breeding strategy of molecular marker-assisted selection, which is to use functional markers of target traits to assist variety selection, has become very mature. Among them, KASP markers based on wheat disease resistance, quality and other genes have been applied to molecular marker-assisted variety selection. KASP molecular markers for flowering-related vernalization genes and photoperiod genes were developed in 2016. Conventional phenotypic identification technology for wheat flowering period is also mature, but the combination of the two technical solutions cannot screen wheat with stable flowering period. Therefore, there has been no report on the application of flowering-stable wheat in hybrid wheat seed production. Summary of the invention

[0006] The object of the present invention is to provide a method for screening two-line hybrid wheat seed production parents with stable flowering period. The method utilizes wheat flowering period growth degree days as a new identification index, combined with flowering period-related molecular marker technology, to solve the problem of seed production risk caused by the above-mentioned hybrid wheat parents not flowering at the right time.

[0007] The method for screening two-line hybrid wheat seed production parents with stable flowering period according to the present invention comprises the following steps:

[0008] (1) For the tested sterile and restorer materials, the groups were divided according to the genotypes of the wheat vernalization gene Vrn-1 and the photoperiod gene Ppd-1. The sterile materials with the same genotype were grouped together, and the restorer materials with the same genotype were grouped together;

[0009] (2) Determine the growth degree-day value of each sterile material and restorer material with the same genotype, where the growth degree-day is the accumulated temperature from sowing to flowering, and the calculation formula is as follows:

[0010] Among them, TD, H, S and T i They represent the accumulated temperature from sowing to flowering, flowering date, sowing date and daily average temperature, among which the daily average temperature T i =(T max +T min ) / 2, when T i <T b When T i =0, where T max , T min and T b They represent the daily maximum temperature, daily minimum temperature and the basic temperature from wheat sowing to flowering;

[0011] (3) Combine sterile and restorer materials according to genotype;

[0012] (4) Calculate the average growth degree-day value of all sterile materials and all restorer materials in each genotype combination, combine the growth degree-day values ​​of each sterile material and restorer material for statistical analysis, and select the genotype combination with significant difference;

[0013] (5) For the genotype combination selected in step (4), further select a genotype combination in which the growing degree days of the sterile line and the restorer line are stable in different years, and select the sterile line material and the restorer line material with this combination genotype as the two-line hybrid wheat seed production parents with stable flowering period.

[0014] According to the method for screening two-line hybrid wheat seed production parents with stable flowering period of the present invention, the sequence of the KASP marker primer of the wheat vernalization gene Vrn-1 is as follows:

[0015] FAM primer: 5'AGAGTTTTCCAAAAAGATAGATCAATGTAAAT3',

[0016] HEX primer: 5'GAGTTTTCCAAAAAGATAGATCAATGTAAAC3',

[0017] Universal primer: 5′GTTAGTAGTGATGGTCCAATAATGCCAAA3′;

[0018] The sequence of the KASP marker primer for the photoperiod gene Ppd-1 is shown below:

[0019] FAM primer: 5'CAACTCCTTGAGATTCAAAGATTCAAG3',

[0020] HEX primer: 5'GCAACTCCTTGAGATTCAAAGATTCAAA3',

[0021] Universal primer: 5′CATCCTGCATCTGCAGGCATCTC3′;

[0022] FAM primer: 5'GTTTTGGCCTGGCCATCCTCC3',

[0023] HEX primer: 5'GTTTTGGCCTGGCCATCCTCA3',

[0024] Universal primer: 5′TATCAGGTGGTTGGGTGAGGACGT3′;

[0025] FAM primer: 5'GAGTTTGATCTTGCTGCGCCG3',

[0026] HEX primer: 5'CTGAGTTTGATCTTGCTGCGCCA3',

[0027] Universal primer: 5′CTTCCCCACAGCTCGTGGAGAA3′;

[0028] FAM primer: 5'CCGTTTTCGCGGCCTT3',

[0029] HEX primer: 5'GACGTTATGAACGCTTGGCA3',

[0030] Universal primer: 5'GGGTTCGTCGGGAGCTGT3'.

[0031] Beneficial technical effects of this application:

[0032] 1. For hybrid wheat breeding and industrial application, although the encounter of flowering period is of great significance in reducing the risk of seed production and increasing seed production yield in large-scale seed production, more people pay attention to the cross-fertilization characteristics that affect seed production yield, such as anther size, stigma exposure and glume opening angle. In addition, the inventors found that the conventional calendar day is used as an indicator for wheat flowering period identification. Due to the influence of time and space, the flowering period of seed production combinations in different years and regions varies greatly and is unstable. Therefore, even if combined with the breeding strategy of molecular marker-assisted selection, wheat with a stable flowering period cannot be screened out. Therefore, there has been no report on the technical solution of combining conventional breeding with the breeding system of molecular marker-assisted selection to screen wheat with a stable flowering period.

[0033] 2. According to the method of the present invention, the growing degree days from wheat sowing to flowering are used as an indicator of wheat flowering period, replacing the calendar days from sowing to flowering, which is a conventional indicator of wheat flowering period. This indicator identifies the wheat flowering period more stably and accurately, and can better screen wheat with a stable flowering period. The technical solution of the present application optimizes the measurement formula of wheat growing degree days from sowing to flowering, and uses the growing degree days as the flowering period phenotype. On this basis, combined with the genotype related to the existing flowering period of wheat, molecular markers are used to assist in screening out wheat with a stable flowering period, and a significant comparative analysis of the flowering period encounter time of wheat parent combinations is performed to screen wheat with a stable flowering period encounter time as a seed production parent combination, and the genotype of the combination is used as a selection marker for the seed production combination with a stable flowering period encounter time. So far, there has been no technical solution for systematic optimization and recombination using molecular markers and the identification index, nor has there been a set of related technical methods for solving the scientific problem of the flowering period encounter of two-line hybrid wheat to reduce the risk of large-scale hybrid wheat seed production.

[0034] 3. According to the method of the present invention, the photoperiod and vernalization genotype of wheat are identified by modern molecular biological means, the growing degree days from wheat sowing to flowering are used as the identification index of wheat flowering period phenotype, and molecular markers are used to assist in screening wheat with stable flowering period for seed production, thereby improving the selection efficiency. On this basis, the flowering period is adjusted by sowing time, providing technical guarantee for expanding the hybrid wheat production area and reducing the risk of hybrid wheat seed production. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The graph shows the results of Ppd-B1 genotyping, where the red dots represent the HEX allele type, the blue dots represent the FAM genotype, and the black dots represent the blank control. DETAILED DESCRIPTION

[0036] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the method, steps or conditions of the present invention are within the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0037] The term "growing degree-days (GDDs)" refers to the cumulative effective accumulated temperature value experienced to complete a certain growth stage under actual environmental conditions. It is an index based on temperature, representing the heat accumulated during the plant's growth period. GDDs are directly related to the plant's growth rate and growth stage.

[0038] "Flowering encounter time" refers to the flowering encounter period, that is, the difference between the time of the material with an early end flowering period and the material with a late start flowering period. The index for flowering period identification in the prior art is the calendar day from sowing to flowering, while the technical solution of the present application uses the growing degree days from sowing to flowering as the index for flowering period identification. It is well known that the flowering period of wheat identified by calendar days is affected by weather temperature, sowing time or climate change, and the flowering period of wheat may change every year. However, in the present application, the flowering period of wheat identified by growing degree days is relatively stable, less affected by temperature, sowing time or climate change, and the growing degree days required for its flowering period are relatively stable and have a smaller range of variation.

[0039] In the present application, the stability of flowering period takes into account the influence of temperature and sowing time. For example, in the embodiment, the variation of flowering period of the same genotype combination under different sowing period treatment conditions in 2018-2019 and 2019-2020 is studied.

[0040] In Table 4, the unit of “flowering period encounter time” (ie, “flowering period difference”) is “Δ calendar day, Δ growing degree day”.

[0041] Flowering period stability: In the examples of the present application, in order to screen wheat with a stable flowering period, the variation of two identification indicators of the wheat flowering period, "calendar days" and "growing degree days", between different years was compared.

[0042] Study the difference in growing degree days between sterile lines and restorer lines under different sowing period treatment conditions in different years. If the variation is small and the statistical analysis shows a significant difference, it means that the material with the gene identified by growing degree days as an indicator has a stable flowering period. Further, select the combination with small difference in growing degree days between years from the combination with good stability.

[0043] The term "flowering period" refers to "calendar days from sowing to flowering": when the inner and outer glumes of the florets in the upper part of half of the ears in each row open and the anthers shed pollen, it enters the flowering period, and the number of days from sowing to flowering is regarded as the flowering period.

[0044] In the following embodiments, the technical solution is implemented:

[0045] KASP marker primers for the vernalization gene Vrn-1 and photoperiod gene Ppd-1 of wheat were designed. The 5′ ends of the FAM primer and HEX primer contained specific adapters, GAAGGTGACCAAGTTCATGCT and GAAGGTCGGAGTCAACGGATT, respectively, which can be combined with fluorescent markers for fluorescence detection. After PCR amplification of the test materials and the detection markers, the SNP viewer2.0 software developed by LGC was used to read the detection data. The fluorescent color corresponds to the genotype corresponding to the detection site. According to the genotype of the test materials, the sterile lines and restorer lines of the test materials were divided into different groups. In order to avoid the interference of genotype differences on the selection of flowering period identification indicators, the sterile lines and restorer lines with the same genotype were selected as the materials for the stability analysis of flowering period.

[0046] Measurement of wheat sowing to flowering identification index: The wheat flowering period is measured using the calendar days and growing degree days from wheat sowing to flowering as indicators. The calculation methods of the calendar days and growing degree days from wheat sowing to flowering are as follows:

[0047] The calculation formula for the calendar day from sowing to flowering is: HD = HS, where HD, H and S are the calendar day from sowing to flowering, flowering date, and sowing date, respectively. The calculation formula for the difference in flowering period is: ΔHD = HD S -HD R , including HD S and HD R are the flowering dates of the sterile and restorer lines, respectively;

[0048] Growing degree days from sowing to flowering: Among them, TD, H, S and T i represents the accumulated temperature from sowing to flowering, flowering date, sowing date and daily average temperature, respectively. i =(T max +T min ) / 2, when T i <T b When T i =0, where T i , T max , T min and T b They represent the daily average temperature, daily maximum temperature, daily minimum temperature and the basic temperature from wheat sowing to flowering.

[0049] Screening of parent combinations for two-line hybrid wheat seed production with stable flowering period: The sterile lines and restorer lines with the same genotype were used as materials for flowering period stability analysis. The stability of the test materials from sowing to flowering calendar days and growing degree days in different years was analyzed through significance comparison. The growth degree days from sowing to flowering were stable in two years. On this basis, the sterile line and restorer line combinations were used as materials. The flowering period encounter time of the sterile line and restorer lines (calendar days and growing degree days as indicators respectively) was compared for significance and stability.

[0050] Example 1

[0051] Source of the tested parent: The tested sterile line is an excellent sterile line bred with BS366 as the parent, and can achieve more than 95% sterility when sown at the right time. Source of the tested restorer line: A high-generation restorer line bred with Baiyu 149 as the male parent.

[0052] Five groups of primers with the best effects in the test materials were designed, namely Vrn-A1_9K0001, Vrn1_new, Vrn-A1b-Marq, Exon7_C / T_Vrn-A1, and TaPpdBJ001. The sequences of the five groups of primers are shown in Table 1. According to the primer design requirements of the KASP technology, the 5′ ends of the FAM primer and the HEX primer contain specific adapters, GAAGGTGACCAAGTTCATGCT and GAAGGTCGGAGTCAACGGATT, respectively, which can be combined with fluorescent labels for fluorescence detection.

[0053] Cut the leaves of the experimental materials, and use the plant genomic DNA extraction kit to extract the genomic DNA of the wheat materials. The test genomic DNA is 10-30 ng / μL. The A260 / A280 ratio detected by the ultraviolet spectrophotometer Nanodrop2000 is about 1.8, and the A260 / A230 ratio is greater than 1.8.

[0054] The genomic DNA of the tested wheat material was used as a template, and 5 sets of primers were used for PCR amplification to obtain PCR amplification products. When the temperature of the PCR amplification product dropped below 40°C, the fluorescence value was read by scanning the FAM and HEX beams of the microplate reader, and the detection data was read using the SNP viewer 2.0 software developed by LGC. The composition and distribution of Vrn-A1, Ppd-B1 alleles and genotypes in the sterile line and the restorer line of the wheat material used in this embodiment were statistically analyzed.

[0055] Table 1 Five groups of primers for detecting KASP markers in test materials

[0056]

[0057] In 2018 and 2019, 39 and 55 sterile lines were sown on October 13 and 19, respectively, and 154 and 205 restorer lines were sown on October 19 and 27, respectively. Each material was planted in 2 rows, 30 seeds per row, 1.5m row length, and 25cm row spacing. The field test was conducted at the Henan Dengzhou Hybrid Wheat Industrialization Experimental Base of Beijing Academy of Agricultural and Forestry Sciences (32.68°N, 112.08°E). The flowering period of the test materials was investigated and measured respectively. The survey data were sorted. The experimental results of the test are as follows Figure 1 The genotyping results are shown in Table 2.

[0058] Table 2 Statistics of genotypes of the tested materials based on typing results

[0059]

[0060]

[0061]

[0062] Note: a: HEX allele type, b: FAM allele type, -: heterozygous or blank genotype.

[0063] In the two years of 2018-2019 and 2019-2020, the amplification results of Vrn-A1 and Ppd-B1 molecular markers were counted into 8 genotypes numbered I, III, IV, V, VI, VII, VIII and XI, and the sterile lines and restorer lines were grouped according to the genotypes. The stability of the flowering period from sowing to flowering calendar day and growing degree day in different years was analyzed by statistical significance comparison.

[0064] Table 3 shows the calendar day difference and growing degree day difference of restorer materials and sterile materials with the same genotype, such as the calendar day difference and growing degree day difference of restorer materials and sterile materials with "I" group genotype, and performs statistical analysis.

[0065] Table 3 Comparative analysis of significance and stability of the tested materials from sowing to flowering in different years

[0066]

[0067]

[0068] Table 4 shows the calendar day difference and growing degree day difference between the restorer material and the sterile material for each genotype combination, and statistical analysis was performed.

[0069] Table 4 Comparative analysis of the significance and stability of flowering encounter time among genotypes in seed production combinations

[0070]

[0071] Table 4 Comparative analysis of the significance and stability of flowering encounter time among genotypes in seed production combinations (continued)

[0072]

[0073]

[0074] In Tables 3 and 4, “*” indicates significant difference with probability P < 0.05, “**” indicates extremely significant difference with probability P < 0.01, and “***” indicates significant difference with probability P < 0.001.

[0075] The stability of growing degree days from sowing to flowering and calendar days from sowing to flowering is compared between years as shown in Table 3. Taking genotypes Ⅰ, Ⅲ and Ⅵ as examples, the Δ growing degree days corresponding to Ⅰ, Ⅲ and Ⅳ in 2018-2019 and 2019-2020 were 75.6 and 80.8; 35.4 and 29.5; 56.2 and 41.5, respectively. In the two years, only the flowering period of genotype Ⅰ with Δ growing degree days as the indicator was significantly different, while the differences between genotypes Ⅲ and Ⅵ were not significant. Taking calendar days as the index, in 2018-2019 and 2019-2020, the corresponding Δ calendar days for Ⅰ, Ⅲ and Ⅳ were 5.4 and 5.4; 2.8 and 1.9; 4.1 and 3.0 days, respectively. Among them, only the flowering period of genotype Ⅰ with Δ calendar days as the index was significantly different in both years, while the flowering period of genotype Ⅲ with Δ calendar days as the index in 2018-2019 was significantly different, and the flowering period of genotypes Ⅲ and VI with Δ calendar days as the index in 2019-2020 was not significantly different. The difference between growing degree days and calendar days was shown in genotype Ⅲ. The flowering period with calendar days as the index was significantly different among the tested materials in 2018-2019, which was 2.76. * , but the difference between the tested materials in 2019-2020 was not significant, at 1.88. The flowering period based on calendar days cannot determine whether the material is stable. However, for genotype III, the flowering period based on growing degree days was 35.4 and 29.5 in the two years of Δ growing degree days, and the difference was not significant. It can be determined that the flowering period of the material of this genotype is unstable. By comparing the significance and stability of the differences in flowering period between genotypes I, III and IV, it can be concluded that the flowering period based on growing degree days can better determine the significance of the difference between genotypes and flowering period and thus determine its stability than the flowering period based on calendar days.

[0076] Screening of combinations with stable flowering periods: On this basis, the sterile and restorer combinations are used as materials, and the flowering period encounter time of the sterile and restorer lines (calendar days and growing degree days are used as indicators, respectively) is compared for significance and stability. On the one hand, a statistically significant comparison is made on the flowering period encounter time of the sterile and restorer lines. In this embodiment, the difference in flowering period between the sterile and restorer combinations is significant, which means that the flowering period of the sterile line is different from that of the restorer line. Statistically, its credibility reaches more than 95%, which is indicated by *, indicating that there is a statistically significant difference in the time when the sterile and restorer lines meet. The second is the determination of stability, and the difference in the flowering period encounter time between the selected combinations in two years is compared.

[0077] As shown in Table 4, for the seed production parent combinations III×Ⅰ, VIII×Ⅰ:

[0078] In terms of genotype: the parent combinations III×Ⅰ and VIII×Ⅰ have different genotypes. According to Table 2, the genotype of III is aa-aa, while the genotype of I is aaaaa, and the genotype of VIII is baaaa.

[0079] Growing degree-day index: The growing degree-days of these two combinations were stable in 2018-2019 and 2019-2020. In 2018-2019, the Δ growing degree-days of the sterile line and the restorer line were 52.27℃d and 54.02℃d, respectively. In 2019-2020, the Δ growing degree-days of the sterile line and the restorer line were 74.44℃d and 75.46℃d. The difference in flowering period between the two years was stable whether measured by calendar days or growing degree-days.

[0080] Flowering period difference: The flowering period difference of these two combinations reached an extremely significant level, indicating that the flowering period difference of the sterile line and the restorer line was stable, indicating that the time difference between the sterile line and the restorer line was credible. The significant difference standard was P < 0.05 for significance and P < 0.01 for extremely significance.

[0081] The purpose of selecting the combination with statistically significant difference in flowering period is to select the combination with stable flowering period. Only the difference in flowering period between sterile line and recovery line is significant, indicating that the flowering period of the two is credible from statistical analysis. On this basis, by comparing the variation of the difference in flowering period of the combination in two years, the combination with smaller variation between the two years is selected as the combination with stable flowering period.

[0082] The following two examples are combinations where the flowering period encounters unstable timing:

[0083] Seed production combination Ⅰ×Ⅳ combination:

[0084] Genotype: According to Table 2, the genotype of parent Ⅰ is aaaaa, and the genotype of parent Ⅳ is --- aa;

[0085] Growing degree days: The flowering encounter time in 2018-2019 and 2019-2020 was described using growing degree days as an indicator of the flowering encounter time. The growing degree days of the parent combinations Ⅰ×Ⅳ in the two years were 82.52℃d and 49.83℃d, respectively;

[0086] Flowering encounter time: The flowering encounter time of parental combination Ⅰ×Ⅳ reached an extremely significant level (P<0.01), but the flowering encounter time in the two years was unstable, and the difference in encounter time was 32.69℃d.

[0087] Seed production combination IV×IV combination:

[0088] Genotype: According to Table 2, the genotype of parent IV is --- aa.

[0089] Growing degree days: The flowering encounter time in 2018-2019 and 2019-2020 was described by using growing degree days as an indicator of the flowering encounter time. The two-year parent combination IV×IV was 50.38℃d and 25.86℃d, respectively. The difference in the flowering encounter time of the parent combination IV×IV was not significant (P>0.05). At the same time, the flowering encounter time in the two years was also unstable, with a difference of 24.52℃d. This shows that the flowering period of the parents of this combination is unstable and the variation range of the flowering encounter time of the parents is large.

[0090] The existing molecular marker-assisted selection breeding strategy combined with the conventional calendar day index of wheat flowering period still cannot screen out wheat with a stable flowering period, so there has been no report on a technical solution that combines conventional breeding with the molecular marker-assisted selection breeding system to screen wheat with a stable flowering period. The wheat flowering period based on the growing degree day as an indicator combined with the existing molecular markers can screen wheat with a stable flowering period.

[0091] This method can be used to select seed production combinations with the same flowering period, and use their genotypes as markers to improve wheat with stable flowering period. A combination of sterile lines and restorer lines with stable growth degree days from sowing to flowering in two years and a significant level of growth degree days is selected, and the genotype of this combination is used as the parent of the seed production combination with stable flowering period. This method can be used to efficiently identify and screen wheat with stable flowering period.

[0092] Example 2

[0093] Source of the tested parent: The tested sterile line is an excellent sterile line bred with BS366 as the parent, and can achieve more than 95% sterility when sown at the right time. Source of the tested restorer line: A high-generation restorer line bred with Baiyu 149 as the male parent.

[0094] The above five sets of primers were used, namely Vrn-A1_9K0001, Vrn1_new, Vrn-A1b-Marq, Exon7_C / T_Vrn-A1, and TaPpdBJ001, as shown in Table 1. According to the primer design requirements of the KASP technology, the 5′ ends of the FAM primer and the HEX primer contained specific linkers, GAAGGTGACCAAGTTCATGCT and GAAGGTCGGAGTCAACGGATT, respectively, which can be combined with fluorescent labels for fluorescence detection.

[0095] Cut the leaves of the experimental materials, and use the plant genomic DNA extraction kit to extract the genomic DNA of the wheat materials. The test genomic DNA is 10-30 ng / μL. The A260 / A280 ratio detected by the ultraviolet spectrophotometer Nanodrop2000 is about 1.8, and the A260 / A230 ratio is greater than 1.8.

[0096] The genomic DNA of the tested wheat material was used as a template, and 5 sets of primers were used for PCR amplification to obtain PCR amplification products. When the temperature of the PCR amplification product dropped below 40°C, the fluorescence value was read by scanning the FAM and HEX beams of the microplate reader, and the detection data was read using the SNP viewer 2.0 software developed by LGC. The composition and distribution of Vrn-A1, Ppd-B1 alleles and genotypes in the sterile line and the restorer line of the wheat material used in this embodiment were statistically analyzed.

[0097] In 2020, 4 sterile lines and 4 restorer lines were sown on October 30. Each material was planted in 2 rows, 30 seeds per row, 1.5m row length, and 25cm row spacing. The field test was conducted at the Dengzhou Hybrid Wheat Industrialization Experimental Base of Beijing Academy of Agricultural and Forestry Sciences in Henan (32.68°N, 112.08°E). The flowering period of the test materials was investigated and measured respectively. The survey data were sorted. The detected genotypes and flowering period growth degree days are shown in Table 5.

[0098] Table 5 Genotypes of tested materials and tested combinations of flowering period and growing degree days

[0099]

[0100] Flowering period unstable combination: As shown in Table 5, for seed production parent combination 2 "V×VIII",

[0101] In terms of genotype: the genotypes of V×VIII are different. According to Table 2, the genotype of V is -aaaa and the genotype of VIII is baaaa.

[0102] Growing degree day index: In 2018-2019 and 2019-2020, the Δ growing degree days of the sterile line and the restorer line of this parent combination V×VIII were -27.08℃d and 27.33 respectively, and the Δ growing degree days of the sterile line and the restorer line in 2020-2021 was 58℃d. Compared with the previous two years, the flowering period of this combination is unstable, and the genotype of this combination can be used as the basis for selecting combinations with unstable flowering periods. This is consistent with the identification results in Example 1.

[0103] Flowering period stable combination: As shown in Table 5, for the seed production parent combination 3 "Ⅲ×Ⅲ",

[0104] In terms of genotype: According to Table 2, the III genotype is aa-aa.

[0105] Growing degree-day index: The growing degree-days of combination III×III were stable in 2018-2019 and 2019-2020. In 2018-2019 and 2019-2020, the Δ growing degree-days of sterile and restorer lines were 35.36℃d and 29.50℃d, respectively. In 2020-2021, the Δ growing degree-days of sterile and restorer lines were 31.5℃d. Compared with the previous two years, the flowering encounter time of this combination was stable. The genotype of this combination can be used as the basis for selecting a combination with stable flowering period, which is consistent with the identification results in 1.

[0106] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for screening two-line hybrid wheat seed production parents with stable flowering period, characterized in that: The method comprises the following steps: (1) For the sterile and restorer lines tested, the wheat vernalization genes Vrn-1 and photoperiod genes Ppd-1 The genotypes of the materials were divided into groups, the sterile materials with the same genotype were grouped into one group, and the restorer materials with the same genotype were grouped into one group; Wherein, the wheat vernalization gene Vrn-1 The sequences of the KASP tagging primers are shown below: FAM primer: 5'AGAGTTTTCCAAAAAGATAGATCAATGTAAAT3', HEX primer: 5'GAGTTTTCCAAAAAGATAGATCAATGTAAAC3', Universal primer: 5′GTTAGTAGTGATGGTCCAATAATGCCAAA3′; The photoperiod gene Ppd-1 The sequences of the KASP tagging primers are shown below: FAM primer: 5'CAACTCCTTGAGATTCAAAGATTCAAG3', HEX primer: 5'GCAACTCCTTGAGATTCAAAGATTCAAA3', Universal primer: 5′CATCCTGCATCTGCAGGCATCTC3′; FAM primer: 5'GTTTTGGCCTGGCCATCCTCC3', HEX primer: 5'GTTTTGGCCTGGCCATCCTCA3', Universal primer: 5′TATCAGGTGGTTGGGTGAGGACGT3′; FAM primer: 5'GAGTTTGATCTTGCTGCGCCG3', HEX primer: 5'CTGAGTTTGATCTTGCTGCGCCA3', Universal primer: 5′CTTCCCCACAGCTCGTGGAGAA3′; FAM primer: 5'CCGTTTTCGCGGCCTT3', HEX primer: 5'GACGTTATGAACGCTTGGCA3', Universal primer: 5′GGGTTCGTCGGGAGCTGT3′; The specific operation in step (1) is: cut the leaves of the experimental materials, use the plant genomic DNA extraction kit to extract the genomic DNA of the wheat materials, use the above five sets of primers to perform PCR amplification, obtain PCR amplification products, and group the sterile lines and restorer lines according to genotypes based on the amplification results; (2) Determine the growing degree-day value of each sterile material and restorer material with the same genotype. The growing degree-day is the accumulated temperature from sowing to flowering. The calculation formula is as follows: TD = , where TD, H, S and T i They represent the accumulated temperature from sowing to flowering, flowering date, sowing date and daily average temperature, among which the daily average temperature T i = (T max + T min ) / 2, when T i <T b When T i =0, where T max , T min and T b They represent the daily maximum temperature, daily minimum temperature and the basic temperature from wheat sowing to flowering; (3) Combine sterile and restorer materials according to genotype; calculate the average growth degree-day value of all sterile materials and all restorer materials in each genotype combination, perform statistical analysis on the growth degree-day value of each sterile material and restorer material, and select the genotype sterile and restorer combinations with statistically significant differences; the said significant difference means the probability P < 0.05; (4) For the genotype combination selected in step (3), further compare the growth degree day difference between the sterile line and the restorer line in different years, and screen the genotype combination with stable growth degree day difference between years, and select the sterile line material and the restorer line material with this genotype combination as the two-line hybrid wheat seed production parents with stable flowering period.

Images