Leuconostoc pseudomesenteroides and application thereof in preparation of medicine for preventing and treating inflammatory bowel disease
The application of Leuconostoc mesenteroides LL271 solves the problem of toxic side effects in existing treatments for inflammatory bowel disease, and provides a safe and effective probiotic preparation for relieving intestinal inflammation and improving intestinal mucosal damage, with potential clinical application prospects.
Patent Information
- Application Number
- CN202310150690.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-22
- Publication Date
- 2026-07-03
- Estimated Expiration
- 2043-02-22
Smart Images

Figure BDA0004090657650000081 
Figure BDA0004090657650000091 
Figure BDA0004090657650000101
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, and in particular to a strain of Leuconostoc mesenteroides with good probiotic properties and its application in the preparation of drugs for the prevention and treatment of inflammatory bowel disease. Background Technology
[0002] Inflammatory bowel disease (IBD) refers to a group of inflammatory bowel diseases of unknown cause, mainly characterized by mucosal and systemic inflammation. It is divided into ulcerative colitis (UC) and Crohn's disease (CD), and its incidence is increasing year by year. Commonly used IBD treatments, such as aminosalicylic acid anti-inflammatory drugs, immunosuppressants, or colectomy, can produce various toxic side effects. Therefore, there is an urgent need to develop safe and effective alternative therapies.
[0003] Leuconostoc lactis (L. lactis) belongs to the genus Leuconostoc and is a traditional probiotic that is Gram-positive, spherical, non-spore-forming, facultative anaerobic, and is mostly used as a starter culture in fermented dairy products. Currently, there are no reports on the use of Leuconostoc lactis for the treatment or prevention of inflammatory bowel disease. Summary of the Invention
[0004] The purpose of this invention is to provide a strain of Leuconostoc mesenteroides and its applications.
[0005] Specifically, the present invention provides the following technical solutions:
[0006] This invention provides Leuconostoc lactis LL271 (strain name abbreviated as 271), which was deposited on October 28, 2022, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, postcode 100101), classified and named Leuconostoc lactis, with accession number CGMCC No. 25974.
[0007] Leuconostoc lactis LL271 was isolated from fecal samples of healthy adults. Sequencing confirmed the 16S rDNA sequence of this strain, as shown in SEQ ID NO.1. In vitro experiments revealed that this strain possesses beneficial properties such as good acid and bile acid resistance, hydrophobicity, self-aggregation ability, and inhibition of common human pathogens. It also exhibits no hemolytic activity, no gelatinase activity, and sensitivity to selected antibiotics. A mouse colitis model demonstrated that this strain is harmless to animals and has the function of improving inflammatory bowel disease. It can reduce the disease activity index (DAI) and colonic length shortening in colitis mice, and lower colonic pathology scores, thereby reducing the degree of inflammatory damage. The Leuconostoc lactis LL271 provided by this invention shows good probiotic potential and excellent application prospects in the prevention and / or treatment of inflammatory bowel disease.
[0008] The present invention provides a microbial agent containing Leuconostoclactis LL271 as described above.
[0009] Preferably, the Leuconostoc lactis LL271 in the above-mentioned bacterial agent exists in the form of live bacteria.
[0010] The above-mentioned microbial agents can be liquid or solid.
[0011] The present invention also provides a method for preparing the above-mentioned bacterial agent, the method comprising the step of culturing Leuconostoc lactis LL271 to obtain a culture.
[0012] Preferably, the culture medium used for the culture is MRS medium containing defibrinated sheep blood; the volume percentage of defibrinated sheep blood in the culture medium is 4–5%.
[0013] The aforementioned defibrinated sheep blood specifically refers to defibrinated sterile sheep blood.
[0014] Preferably, the culture is carried out at 37°C and 5% (v / v) CO2.
[0015] In some embodiments of the present invention, the culture method of Leuconostoc lactis LL271 is as follows: using MRS medium containing 5% (v / v) defibrinated sterile sheep blood, cultured at 37°C under 5% (v / v) CO2 conditions.
[0016] The bacterial culture obtained above can be prepared as a liquid bacterial agent directly or by adding excipients permitted in the field of microbial preparations. Alternatively, the bacterial cells in the bacterial culture can be collected and mixed with excipients permitted in the field of microbial preparations, such as freeze-drying protectants, and then prepared as a dry powder bacterial agent by vacuum freeze-drying.
[0017] Based on the function of Leuconostoc lactis LL271, this invention provides the following applications of this strain:
[0018] This invention provides the use of Leuconostoc lactis LL271 or the bacterial agent thereon in the preparation of a medicament for relieving intestinal inflammation and / or improving intestinal mucosal damage.
[0019] This invention provides the use of Leuconostoc lactis LL271 or the bacterial agent thereon in the preparation of medicaments for the prevention and / or treatment of colitis.
[0020] This invention provides the use of Leuconostoc lactis LL271 or the bacterial agent thereon in the preparation of medicaments for the prevention and / or treatment of inflammatory bowel disease.
[0021] Preferably, the inflammatory bowel disease is ulcerative colitis or Crohn's disease.
[0022] This invention provides the application of Leuconostoc lactis LL271 or the bacterial agent in inhibiting pathogenic bacteria.
[0023] Preferably, the inhibition of pathogens is for purposes other than disease diagnosis and treatment, including the inhibition of pathogens in the environment or food.
[0024] Leuconostoc lactis LL271 can also inhibit pathogens in vivo.
[0025] The present invention provides the use of Leuconostoc lactis LL271 or the bacterial agent thereon in the preparation of a drug for inhibiting pathogenic bacteria.
[0026] Preferably, the pathogens described in this invention are human pathogens, including but not limited to human pathogens derived from Shigella, Streptococcus, Salmonella, Escherichia, Staphylococcus, or Listeria.
[0027] In some embodiments of the present invention, the pathogenic bacteria are Shigella flexneri, Streptococcus suis, Salmonella typhimurium, enterocolitica, Staphylococcus aureus, Listeria monocytogenes and / or enterohemorrhagic Escherichia coli.
[0028] Preferably, the active ingredient of the above-described drug contains Leuconostoc lactis LL271 or the bacterial agent.
[0029] In the drug, Leuconostoc lactis LL271 is preferably present in live form.
[0030] In addition to Leuconostoc lactis LL271, the drugs described above may also contain other effective ingredients that have preventive and therapeutic effects on inflammatory bowel disease and / or contain carriers or excipients permitted in the pharmaceutical field.
[0031] In some embodiments of the present invention, the active ingredient of the above-mentioned drug contains a supplemental Leuconostoc lactis LL271 bacterial solution.
[0032] The method for preparing the above-mentioned supplementary Leuconostoc lactis LL271 bacterial suspension includes: preparing a bacterial suspension from Leuconostoc lactis LL271 that has been activated and cultured in a culture medium. The activation and culture time is preferably 24–36 h. The activation and culture conditions are preferably 37°C and 5% (v / v) CO2.
[0033] The above bacterial suspension can be prepared by suspending Leuconostoc lactis LL271 cells in phosphate-buffered saline (PBS, 1×) or other buffer solutions. The OD of the bacterial suspension... 600 The preferred value is 4–5.
[0034] The present invention also provides the use of the Leuconostoc lactis LL271 or the bacterial agent in the preparation of food, health products or pharmaceuticals.
[0035] The present invention provides a product comprising Leuconostoc lactis LL271.
[0036] Preferably, the product is food, health product, or medicine.
[0037] The beneficial effects of this invention are as follows: The Leuconostoc lactis LL271 provided by this invention has good acid and bile acid resistance, self-aggregation ability, hydrophobicity, and probiotic properties such as the ability to inhibit common human pathogenic microorganisms; at the same time, it can improve intestinal inflammation, has preventive and therapeutic effects on inflammatory bowel disease, and has high biocompatibility. It can be used as a probiotic preparation to alleviate inflammatory bowel disease, improve intestinal mucosal damage and colon inflammation, and provides a new strategy for the prevention and treatment of inflammatory bowel disease, with potential clinical application prospects.
[0038] Experiments using a C57BL / 6 mouse colitis model confirmed that pre-gavage treatment with Leuconostoc lactis LL271 suspension for 7 days had no significant toxic side effects on the experimental animals. After 7 days of formal intervention, symptoms such as diarrhea and bloody stools in mice were significantly reduced compared to the model group, DAI was significantly decreased, and symptoms of colonic shortening and phenotype were significantly improved. This reduced the pathological damage to the colon in colitis mice and lowered the histopathological score of colon tissue, demonstrating that Leuconostoc lactis LL271 can improve intestinal mucosal damage and inflammatory response in colitis mice. Attached Figure Description
[0039] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0040] Figure 1 The results of gelatinase activity detection of Leuconostoc mesenteroides LL271 in Example 2 of the present invention are shown; wherein, Staphylococcus aureus 25923 represents Staphylococcus aureus ATCC25923, and LL271 represents Leuconostoc mesenteroides LL271 (i.e. Leuconostoc mesenteroides CGMCC No.25974).
[0041] Figure 2This is a diagram showing the inhibition zone of Leuconostoc mesenteroides LL271 against common human pathogens in Example 2 of the present invention; wherein, Shigella flexneri 301 represents Shigella flexneri 2a 301, Streptococcus suis 43765 represents Streptococcus suis ATCC43765, Salmonella typhimurium 14028 represents Salmonella typhimurium ATCC14028, Enterocytogenes coli 24186 represents Enterocytogenes coli CICC24186, Staphylococcus aureus 25923 represents Staphylococcus aureus ATCC25923, Listeria monocytogenes BAA-679 represents Listeria monocytogenes ATCCBAA-679, and Enterohemorrhagic Escherichia coli 43895 represents Enterohemorrhagic Escherichia coli ATCC43895.
[0042] Figure 3 The following is a trend of body weight change in mice in each group over 14 days in Example 3 of this invention.
[0043] Figure 4 This is a statistical analysis chart of DAI (Diagnosis and Adsorption) of mice in each group during the DSS intervention period in Example 3 of the present invention.
[0044] Figure 5 This is an analysis of colon length and phenotype in each group of mice in Example 3 of the present invention.
[0045] Figure 6 This is a bar chart showing HE staining and pathological scoring of colonic mucosal tissues from each group of mice in Example 3 of the present invention.
[0046] Figure 3-6 In the figures, all values are presented as mean ± standard deviation; * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001. Figure 3-6 In the table, NC represents the control group, DSS represents the model group, LL271 represents the CGMCC No.25974 intervention group, and n=8. Detailed Implementation
[0047] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.
[0048] Example 1: Isolation and Identification of Leuconostoc strains
[0049] 1. Strains Isolation
[0050] Take an appropriate amount of healthy human fecal sample frozen at -80℃ and thaw it slowly on ice. After serial dilution with PBS, transfer 100 μL of the sample suspension at different dilutions to MRS + 5% (v / v) defibrinated sterile sheep blood medium, spread it evenly, and incubate it at 37℃ and 5% (v / v) CO2 for 2-4 days. Pick milky white opaque single colonies and pass them through three times for purification. The purified strain can be used for experiments or cryopreservation.
[0051] This invention evaluates the acid and bile salt resistance, antibiotic sensitivity, antibacterial activity, self-aggregation ability, hydrophobicity, and function in improving inflammatory bowel disease of an isolated strain of Leuconostoc mellitus (named Leuconostoc mellitus LL271) (all evaluation methods are described in Examples 2-3).
[0052] 2. Preservation of microbial strains
[0053] Add 1.5 mL of preservation solution to a 2 mL preservation tube, and autoclave at 121 °C for 15 min for later use. After three consecutive subcultures of Leuconostoc LL271 on MRS medium supplemented with 5% (v / v) defibrinated sterile sheep blood, scrape an appropriate amount of bacterial cells into the preservation tube using a sterile inoculation loop and thoroughly dissolve it in the preservation solution. Mix well and freeze at -80 °C. The preservation solution is Brain Heart Infusion (BHI) liquid medium supplemented with 20% (v / v) glycerol.
[0054] 3. Identification of the 16S rRNA gene of the strain
[0055] use Genomic DNA was extracted from the isolated strain using a Genomic DNA purification kit. The 16S rRNA gene of *Leuconostoc mesenteroides* LL271 was amplified using universal primers for the 16S rRNA gene (27F, SEQ ID NO.2: AGAGTTTGATCCTGGCTCA; 1492R, SEQ ID NO.3: AAGTCGTAACAAGGTAGCCGT). The PCR amplification products were sequenced, and the obtained sequences were submitted to the NCBI online database (https: / / www.ncbi.nlm.nih.gov / ) for homology comparison and preliminary identification. The PCR reaction conditions and the composition of the PCR system (30 μL) are as follows:
[0056] PCR reaction system (30 μL): Premix Taq, 15 μL; ddH2O, 12 μL; forward and reverse primers (27F and 1492R), 1 μL each; genomic DNA, 1 μL.
[0057] PCR amplification conditions: pre-denaturation 94℃, 5 min; denaturation 94℃, 0.5 min; annealing 55℃, 0.5 min; extension 72℃, 0.5 min; 30 cycles; 72℃, 1 min.
[0058] Sequence alignment results showed that the sequence identity of the tested strain LL271 with the Leuconostoc lactis type strain KCKC3528 was 99.65%, exceeding the interspecies threshold of 98.75%. Therefore, the isolated strain was identified as a Leuconostoc lactis strain. Leuconostoc lactis LL271 (abbreviated as Leuconostoc lactis 271) was deposited on October 28, 2022, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, postcode 100101), and classified as Leuconostoc lactis, with accession number CGMCC No. 25974.
[0059] Example 2: Characteristic analysis of Leuconostoc mesenteroides CGMCC No. 25974
[0060] 1. Biochemical characteristics of Leuconostoc mesenteroides CGMCC No. 25974
[0061] The BioMerieux bacterial system sugar fermentation identification card (API 50CH) manufactured by bioMerieux, France, was used. In short, the sugar fermentation results of the logarithmic phase culture of strain CGMCC No. 25974, after being suspended in 50 CHL medium and adjusted to McFarland turbidity according to the instructions for 36 hours, are shown in Table 1. It can be seen that Leuconostoc mesenteroides CGMCC No. 25974 can ferment 12 sugars, including galactose.
[0062] Table 1. Identification chart of sugar fermentation reaction (50 CHL) of strain CGMCC No. 25974
[0063]
[0064]
[0065] Note: + indicates positive; – indicates negative; w indicates weak positive.
[0066] 2. Hemolytic activity assay of Leuconostoc mesenteroides CGMCC No. 25974
[0067] Three-generation activated Leuconostoc mesenteroides CGMCC No. 25974, grown to the logarithmic growth phase, was streaked onto MRS blood agar medium. After 24 hours of incubation, colony morphology and hemolysis were observed. Hemolysis was classified into α-hemolysis (a grass-green area appears around the colony), β-hemolysis (a clear area appears around the colony), and γ-hemolysis (no hemolysis occurs). The results showed that strain CGMCC No. 25974 had no hemolytic activity.
[0068] 3. Gelatinase activity assay of Leuconostoc mesenteroides CGMCC No. 25974
[0069] The CGMCC No. 25974 cells from the above two samples were suspended in PBS to form a bacterial suspension, and the suspension was adjusted to McFarland turbidity of 4.0 (OD). 4.0 10 μL of the culture was inoculated onto the surface of MRS + 3% (w / v) gelatin agar medium and incubated for 24 h. Then, saturated ammonium sulfate was evenly spread onto the surface of the medium, and the presence of a clear halo around the colonies was observed. Staphylococcus aureus ATCC25923 served as a gelatinase positive control (clear halo). Results are as follows: Figure 1 As shown, strain CGMCC No.25974 has no gelatinase activity.
[0070] 4. Antimicrobial susceptibility testing of Leuconostoc mesenteroides CGMCC No. 25974 (E-test method)
[0071] The antimicrobial susceptibility testing performance standards (2018 edition) established by the Clinical and Laboratory Standards Association (CLSI) were used to select recommended antimicrobial agents of Leuconostoc spp.: penicillin, ampicillin, chloramphenicol, and minocycline. In short, the CGMCC No. 25974 bacterial suspension from the above three samples was adjusted to a McFarland turbidity of 0.5 (OD). 0.5 The sample was evenly spread on the surface of CAMHB + 5% (v / v) defibrinated horse blood medium, and an E-test strip was placed on the surface of the medium. After 24 h of incubation, the minimum inhibitory concentration (MIC) value was recorded. Streptococcus pneumoniae ATCC49619 was used as the quality control strain. The results are shown in Table 2. Strain CGMCC No. 25974 was sensitive to all four antibiotics.
[0072] Table 2. Antimicrobial susceptibility of strain CGMCC No. 25974 as determined by the E-test method.
[0073]
[0074] 5. Tolerance of Leuconostoc mesenteroides CGMCC No. 25974 to acids and bile salts.
[0075] The CGMCC No. 25974 bacterial suspension from step 3 above was inoculated into MRS liquid medium containing 3 g / L pepsin and pH 3.0, and MRS liquid medium containing 0.3% (w / v) bile salts, respectively, and incubated at 37°C for 3 h. The 0 h and 3 h culture media were serially diluted and inoculated into MRS agar medium. The total viable cell count at 0 h (N0) and the total viable cell count at 3 h (N1) were calculated. The survival rate of the strain in acidic and bile salt environments was calculated according to Formula 1.
[0076] Survival rate (%) = log CFU N1 / log CFU N0 (Formula 1)
[0077] The results are shown in Table 3. The survival rates of strain CGMCC No.25974 in pH 3.0 and MRS medium containing 0.3% bile salts were 87.23% and 76.00%, respectively.
[0078] 6. Adhesion-related experiments of Leuconostoc mesenteroides CGMCC No. 25974
[0079] Self-aggregation ability: The CGMCC No.25974 bacterial suspension in step 3 above was adjusted to McFarland turbidity 1.0, denoted as OD0; after culturing for 24 h, its McFarland turbidity was measured and denoted as OD1. The self-aggregation ability was calculated according to formula 2. The results are shown in Table 3. The average self-aggregation ability of strain CGMCC No.25974 was 95.00%.
[0080] Surface hydrophobicity of the strain: The CGMCC No.25974 bacterial suspension from step 3 above was adjusted to McFarland turbidity of 1.0, denoted as OD0; an equal volume of xylene was added, and the mixture was vigorously mixed for 2 min. After incubation for 1 h, the organic phase was removed, and the McFarland turbidity of the aqueous phase was measured and denoted as OD1. The surface hydrophobicity was calculated according to formula 2. The results are shown in Table 3. The average hydrophobicity of strain CGMCC No.25974 was 90.00%.
[0081] Self-aggregation / hydrophobicity (%) = [(OD0-OD1) / OD0] × 100% (Formula 2)
[0082] Adhesion effect on human colon cancer cells HT-29: 1×10 5 HT-29 cells were seeded in 24-well plates (with built-in cell spreaders) and cultured overnight. The cells were then washed three times with serum-free DMEM (1×) medium, and 1×10⁻⁶ cells / mL were added. 7A CFU / mL CGMCC No. 25974 bacterial suspension was prepared, with wells without bacterial suspension serving as the control group. After 3 hours of culture, the cells were washed three times with the above culture medium, then fixed with methanol, stained with Giemsa, and mounted. The adhesion of strain CGMCC No. 25974 was observed under a 1000x optical microscope, and the adhesion index was calculated. This was determined by randomly selecting 10 fields of view under the microscope and calculating the average number of bacteria adhering to HT-29 cells. An adhesion index <1 was considered weak adhesion; <50 was considered moderate adhesion; and >50 was considered strong adhesion. The results are shown in Table 3. The average adhesion index of strain CGMCC No. 25974 was 24.91 CFU / cell.
[0083] Table 3. Acid and bile salt tolerance and cell adhesion of strain CGMCC No. 25974
[0084]
[0085] Note: Values are mean ± standard deviation.
[0086] 7. Determination of the ability of Leuconostoc mesenteroides CGMCC No. 25974 to inhibit common human pathogens.
[0087] The following strains were adjusted to 10: Shigella flexneri 2a 301, Streptococcus suis ATCC43765, Salmonella typhimurium ATCC14028, Escherichia coli CICC24186, Staphylococcus aureus ATCC25923, Listeria monocytogenes ATCCBAA-679, enterohemorrhagic Escherichia coli ATCC43895, and strain CGMCC No.25974. 8 CFU / mL, and a suitable amount of pathogenic bacterial suspension was evenly spread onto the surface of MRS agar medium using a cotton swab. Then, 15 μL of CGMCC No. 25974 bacterial suspension was inoculated onto the surface of the medium and incubated for 24 hours. The size of the inhibition zone was measured, i.e., the distance of the inhibition zone from the edge of the colony. Results are as follows: Figure 2 As shown in Table 4, CGMCC No. 25974 showed inhibitory effects on all human pathogens tested, with the strongest inhibitory effect on Shigella flexneri.
[0088] Table 4. Inhibitory effects of CGMCC No. 25974 on common human pathogens.
[0089]
[0090] Note: Values are presented as mean ± standard deviation.
[0091] Example 3: Evaluation of the anti-inflammatory function of Leuconostoc mesenteroides CGMCC No. 25974
[0092] A DSS colitis model was established using C57BL / 6 mice, and the mice were treated with CGMCC No. 25974 bacterial suspension via gavage (200 μL / mouse, approximately 3 × 10⁻⁶ bacteria). 8 CFU). Experimental Design: Six-week-old mice were acclimatized to an SPF environment at 25°C with a 12-hour light / dark cycle for 3 days, fed with standard rodent feed and sterilized water. They were randomly divided into three groups (n=8): a control group (NC group), a model group (DSS group), and a CGMCC No.25974 intervention group (LL271 group). From day -7 to day 6, mice in the LL271 and DSS groups were administered 200 μL of CGMCC No.25974 and PBS bacterial suspensions daily by gavage, respectively. From day 0 to day 6, mice in the DSS and LL271 groups received 3% (w / v) DSS in drinking water. The mice's weight, fecal characteristics, and occult blood status were recorded daily. The Disease Activity Index (DAI) was calculated according to Formula 3 based on the scoring criteria shown in Table 5. After the experiment, mice were euthanized by cervical dislocation, the colon was dissected, the colonic phenotype was observed, and the length was measured. Photographs were taken, and the distal colonic tissue was fixed with 4% paraformaldehyde for H&E staining. The pathological scoring criteria are shown in Table 6.
[0093] Table 5 DAI Scoring Criteria
[0094]
[0095] Note: / indicates that this score is not available. DAI = Weight Loss Score + Stool Characteristics Score + Occult Blood Score (Formula 3).
[0096] Table 6 Pathological Scoring Criteria
[0097]
[0098] The results are shown in Tables 7, 8, and 9. Figure 3 , Figure 4 , Figure 5 , Figure 6 As shown, strain CGMCC No. 25974 had no obvious toxic side effects on experimental animals and could effectively alleviate the symptoms of acute colitis in mice. Table 7 and Figure 3The results showed that no mice died after pre-gavage with CGMCC No. 25974 bacterial suspension for 7 days (-7 to -1 day). Daily weighing revealed stable average weight gain, good activity and mental state, and no difference in weight change between the intervention and control groups. Compared with the NC group, the DSS and LL271 groups showed varying degrees of weight loss after drinking DSS (0-6 days). The DSS group showed a significant decrease in weight starting from day 4 (P<0.05), which persisted until the end of the experiment. In contrast, strain CGMCC No. 25974 slowed the weight loss in mice, and the weight loss was alleviated compared to the DSS group starting from day 6 (P<0.05). Table 8 and Figure 4 The results showed that, compared with the NC group, the DAI score of mice in the DSS group was significantly higher from day 2 (P<0.05), and this phenomenon continued until the end of the experiment; while strain CGMCCNo.25974 could reduce the DAI score of mice, and the DAI score was significantly lower than that of the DSS group from day 3 (P<0.05), and this phenomenon continued until the end of the experiment.
[0099] Table 7 Daily weight statistics of mice in each group
[0100]
[0101] Note: Compared with the DSS group, *, P<0.05; ***, P<0.001.
[0102] Table 8. DAI scores of mice in each group
[0103]
[0104] Note: Compared with the DSS group, *, P<0.05; **, P<0.01; ***, P<0.001.
[0105] also, Figure 5 The results in Table 9 show that the colon length in the DSS and LL271 groups was shorter than that in the NC group, and the colon in the LL271 group was significantly longer than that in the DSS group (P<0.001). Meanwhile, the colon of mice in the NC group showed better elasticity, and the feces in the intestines were granular; the colon of mice in the DSS group showed poor elasticity, with no feces or bloody stools and significant edema; the colon elasticity of mice in the LL271 group was significantly restored compared to the DSS group, and the feces in the intestines were granular with no significant edema or bloody stools. Histopathological results... Figure 6As shown in Table 9, compared with the NC group, the pathological scores of the LL271 and DSS groups were significantly higher, but the pathological score of the LL271 group was significantly lower than that of the DSS group (P < 0.01). Specifically, the colonic tissue structure of the NC group mice was intact, with no obvious inflammatory changes; the colonic tissue of the DSS group mice showed severe pathological damage, including diffuse mucosal ulcers, loss of mucosal epithelium and crypt structures replaced by proliferating connective tissue, and a severe reduction in the number of goblet cells; the inflammatory response was severe, invading the submucosa, with abundant lymphocyte infiltration; multifocal edema was observed in the submucosa, with loose connective tissue and a small amount of lymphocyte infiltration; the colonic tissue of the LL271 group mice showed milder pathological damage, with focal mucosal necrosis, a slight reduction in the number of goblet cells, a milder inflammatory response, and a small amount of lymphocyte infiltration.
[0106] Table 9. Colon length and pathological scores of mice in each group.
[0107]
[0108] Note: Compared with the DSS group, **, P<0.01; ***, P<0.001.
[0109] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. Leuconostoc lactis LL271, characterized in that, It is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 25974.
2. A microbial agent, characterized in that, The bacterial agent contains Leuconostoclactis LL271 as described in claim 1.
3. The method for preparing the microbial agent according to claim 2, characterized in that, The method includes the step of culturing the Leuconostoc lactis LL271 to obtain a culture.
4. The preparation method according to claim 3, characterized in that, The culture medium used was MRS medium containing defibrinated sheep blood; The volume percentage of defibrinated sheep blood in the culture medium is 4-5%.
5. The use of Leuconostoc lactis LL271 as described in claim 1 or the bacterial agent as described in claim 2 in the preparation of a medicament for relieving intestinal inflammation and / or improving intestinal mucosal damage.
6. The use of Leuconostoc lactis LL271 as described in claim 1 or the bacterial agent as described in claim 2 in the preparation of a medicament for the prevention and / or treatment of colitis.
7. The use of Leuconostoc lactis LL271 as described in claim 1 or the bacterial agent as described in claim 2 in the preparation of a medicament for the prevention and / or treatment of inflammatory bowel disease.
8. The use of Leuconostoc lactis LL271 as described in claim 1 or the bacterial agent as described in claim 2 in the preparation of a drug for inhibiting pathogenic bacteria; The pathogens are Shigella flexneri, Streptococcus suis, Salmonella typhimurium, enterocolitica, Staphylococcus aureus, Listeria monocytogenes, or enterohemorrhagic Escherichia coli.
9. The application according to any one of claims 5 to 8, characterized in that, The active ingredient of the drug contains Leuconostoc lactis LL271 as described in claim 1 or the bacterial agent as described in claim 2.