Cancer immunotherapy targets and diagnostic, prognostic biomarker applications
By detecting and modulating the expression of biomarkers such as EGFR, Wnt, β-catenin, LINC00973, CD55, and CD59, the uncertainty of the role of the complement system in tumor immune escape was resolved, the sensitivity of immune checkpoint blockade therapy was restored, tumor growth was inhibited, and the therapeutic effect was improved.
Patent Information
- Application Number
- CN202310487949.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2022-04-29
- Filing Date
- 2023-04-28
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2043-04-28
AI Technical Summary
The role of the complement system in tumor immune escape induced by oncogenic signaling and its relationship with cytotoxic T cell activation are uncertain, leading to drug resistance to immune checkpoint blockade therapy in some cancer patients.
By detecting and modulating the expression levels of biomarkers such as EGFR, Wnt, β-catenin, LINC00973, CD55, and CD59, and using corresponding inhibitors or agonists, the activity of the complement system and CD8+ T cells can be regulated, restoring sensitivity to immune checkpoint blockade therapy.
It enhanced the efficacy of immune checkpoint blockade therapy in patients with EGFR-mutant non-small cell lung cancer, inhibited tumor growth, and improved the sensitivity and effectiveness of treatment.
Smart Images

Figure CN116699135B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of oncology, in particular to the use of a cancer immunotherapy target and a diagnostic, prognostic biomarker. BACKGROUND
[0002] The complement system is an important component of the immune response. However, its role in tumor immune escape induced by oncogenic signaling and its relationship to cytotoxic T cell activation remain largely uncertain. SUMMARY
[0003] The present application relates to the field of oncology, in particular to the use of a cancer immunotherapy target and a diagnostic, prognostic biomarker.
[0004] The present application provides the use of a marker in the preparation of a diagnostic, prognostic test reagent or kit for cancer, the marker being one or more of EGFR, Wnt, β-catenin, long non-coding RNA LINC00973, LNC1574203, CD55, CD59, CD73, C4d, C3a, C3b, C5a, C5b-9.
[0005] According to an embodiment of the present application, an elevated level of EGFR activation, an elevated level of Wnt pathway activation, an elevated level of activated β-catenin, an elevated level of long non-coding RNA LINC00973 expression, an elevated level of LNC1574203 expression, an elevated level of protein and mRNA expression of CD55, an elevated level of protein and mRNA expression of CD59, an elevated level of protein and mRNA expression of CD73, and various combinations of the six elevated levels, compared to a reference level, then predicts that the patient has an aggressive cancer, has an aggressive cancer in a progressive stage, or has a poor prognosis.
[0006] According to another embodiment of the present application, a decreased level of C4d expression, a decreased level of C3a expression, a decreased level of C3b expression, a decreased level of C5a expression, a decreased level of C5b-9 expression, and various combinations of the five decreased levels, compared to a reference level, then predicts that the patient has an aggressive cancer, has an aggressive cancer in a progressive stage, or has a poor prognosis.
[0007] According to another embodiment of the present application, the reference level is the level from a non-cancerous cell or an early stage cancer cell, or from the blood of a healthy individual, or from the blood of an early stage cancer patient.
[0008] According to another embodiment of the present application, the cancer is oral cavity cancer, oropharyngeal cancer, nasopharyngeal cancer, respiratory system cancer, urogenital system cancer, gastrointestinal cancer, central or peripheral nervous system tissue cancer, endocrine or neuroendocrine system cancer, or hematopoietic system cancer, glioma, sarcoma, epithelial carcinoma, lymphoma, melanoma, fibroma, meningioma, brain cancer, kidney cancer, biliary system cancer, pheochromocytoma, islet cell carcinoma, Li-Fraumeni tumor, thyroid cancer, parathyroid cancer, pituitary tumor, adrenal tumor, osteogenic sarcoma tumor, neuroendocrine system tumor, breast cancer, lung cancer, head and neck cancer, prostate cancer, esophageal cancer, tracheal cancer, liver cancer, bladder cancer, stomach cancer, pancreatic cancer, ovarian cancer, uterine cancer, cervical cancer, testicular cancer, colon cancer, rectal cancer, or skin cancer.
[0009] The present application also provides use of an EGFR inhibitor, a Wnt inhibitor, a β-catenin inhibitor, a LINC00973 inhibitor, a LNC1574203 inhibitor, a protein and mRNA inhibitor of CD55, a protein and mRNA inhibitor of CD59, a protein and mRNA inhibitor of CD73, or a pharmaceutical composition comprising the same, in the manufacture of a product for treating cancer.
[0010] According to an embodiment of the present application, the EGFR inhibitor, the Wnt inhibitor, the β-catenin inhibitor, the LINC00973 inhibitor, the LNC1574203 inhibitor, the protein and mRNA inhibitor of CD55, the protein and mRNA inhibitor of CD59, the protein and mRNA inhibitor of CD73, comprises a small molecule inhibitor, a polypeptide, a complementary inhibitory oligonucleotide, or a neutralizing antibody against EGFR, Wnt, β-catenin, LINC00973, LNC1574203, the protein and mRNA of CD55, the protein and mRNA of CD59, the protein and mRNA of CD73.
[0011] The present application also provides use of a C4d agonist, a C3a agonist, a C3b agonist, a C5a agonist, a C5b-9 agonist, or a pharmaceutical composition comprising the same, in the manufacture of a product for treating cancer.
[0012] According to an embodiment of the present application, the C4d agonist, the C3a agonist, the C3b agonist, the C5a agonist, the C5b-9 agonist, comprises a small molecule agonist against C4d, C3a, C3b, C5a, C5b-9.
[0013] The present invention elucidates a previously unknown mechanism, i.e. the carcinogenic EGFR or Wnt signaling inhibits the complement system through LINC00973-mediated upregulation of CD55 and CD59. This is the first report demonstrating that carcinogenic signaling inhibits cytotoxic CD8+ T cells in a complement-inhibition-dependent manner, revealing a novel intrinsic relationship between complement and CD8+ T cells regulation. Importantly, it also provides the first preclinical evidence that combined blockade of mCRP function and PD-1 / PD-L1 checkpoint can promote complement and CD+ T cell activation can be a rational strategy for human NSCLC treatment. The clinical significance of this regulation is demonstrated by the positive correlation between EGFR activation and the expression levels of active β-catenin, LINC00973, CD55, and CD59 in human NSCLC specimens, which is associated with the clinical invasiveness of tumors. These findings reveal an unknown mechanism of carcinogenic signal-dependent inhibition of the complement system and subsequent CD8+ T cells so far Figure 19 l) activated by tumor cells, and highlights the importance of EGFR / Wnt / β-catenin transactivation-mediated upregulation of CD55 and CD59 for tumor immune evasion. BRIEF DESCRIPTION OF DRAWINGS
[0014] Figure 1 and Figure 2 shows that EGFR activation increases the expression of CD55 and CD59 and inhibits the activation of the complement system and CD8+ T cells.
[0015] Figure 3 and Figure 4 shows that EGFR activation upregulates CD55 and CD59 by inhibiting miR-216b and miR-150, respectively.
[0016] Figure 5 、 Figure 6 and Figure 7 shows that EGFR activation induces LINC00973 expression to adsorb miR-216b and miR-150 to upregulate CD55 and CD59.
[0017] Figure 8 and Figure 9 shows that EGFR activation-induced β-catenin transactivation enhances LINC00973 expression and subsequent upregulation of CD55 and CD59.
[0018] Figure 10 and Figure 11 shows that GFR / β-catenin activation inhibits complement activation by upregulating CD55 and CD59 mediated by miR-216b and miR-150 adsorbed by LINC00973.
[0019] Figure 12 ,Figure 13 and Figure 14 EGFR / β-catenin activation was shown to inhibit immune cell function by upregulating CD55 and CD59.
[0020] Figure 15 , Figure 16 , Figure 17 and Figure 18 EGFR / β-catenin transactivation enhanced CD55 and CD59 expression was shown to promote tumor growth by inhibiting mouse complement activation and immune cell activation.
[0021] Figure 19 CD55 and CD59 silencing mediated complement activation was shown to promote immune checkpoint blockade therapy.
[0022] Figure 20 EGFR / β-catenin transactivation, LINC00973 expression, and CD55 and CD59 levels were shown to be positively correlated with each other and with the clinical invasiveness of the disease in human NSCLC specimens.
[0023] Figure 21 EGFR signaling was shown to upregulate Lnc1574203 expression possibly through β-catenin transcription.
[0024] Figure 22 Knocking down β-catenin was shown to inhibit the upregulation of CD73 expression by EGF treatment.
[0025] Figure 23 Knocking down Lnc1574203 was shown to inhibit the upregulation of CD73 expression by EGF treatment.
[0026] Figure 24 Inhibiting Dicer was shown to block the downregulation of CD73 expression by Lnc1574203 knockdown.
[0027] Figure 25 Expression of LINC00973 and C5 in lung adenocarcinoma and normal tissues was shown.
[0028] Figure 26 Correlation analysis of CD55 and CD59 expression in lung adenocarcinoma was shown.
[0029] Figure 27 Survival analysis of LINC00973 expression in lung adenocarcinoma patients was shown.
[0030] Figure 28 Expression of C3 and C5 in lung squamous carcinoma and normal tissues was shown.
[0031] Figure 29Correlation analysis of CD55 and CD59 expression in lung squamous carcinoma.
[0032] Figure 30 Survival analysis of CD59 expression in lung adenocarcinoma patients.
[0033] Figure 31 Expression of CD55, CD59, C3 and C5 in cholangiocarcinoma and normal tissues.
[0034] Figure 32 Correlation analysis of CD55 and CD59 expression in cholangiocarcinoma.
[0035] Figure 33 Expression of CD55, CD59 and C5 in hepatocarcinoma and normal tissues.
[0036] Figure 34 Correlation analysis of CD55 and CD59 expression in hepatocarcinoma.
[0037] Figure 35 Survival analysis of C3 expression in hepatocarcinoma patients.
[0038] Figure 36 Expression of LINC00973, CD55, CD59 and C5 in pancreatic carcinoma and normal tissues.
[0039] Figure 37 Correlation analysis of CD55, CD59 and LINC00973 expression in pancreatic carcinoma.
[0040] Figure 38 Survival analysis of LINC00973 and CD59 expression in pancreatic carcinoma patients.
[0041] Figure 39 Expression of CD55 and C5 in gastric adenocarcinoma and normal tissues.
[0042] Figure 40 Correlation analysis of CD55 and CD59 expression in gastric adenocarcinoma.
[0043] Figure 41 Survival analysis of CD59 expression in gastric adenocarcinoma patients. DETAILED DESCRIPTION
[0044] In order to make the purpose, technical scheme of the present application more clear, the present application is further described in detail below with reference to the drawings.
[0045] The complement system is a phylogenetically conserved branch of the innate immune response that functions through a coordinated cascade of over 30 proteins and enzymes and recognizes foreign pathogens and aberrantly surface molecule-expressing self-cells, triggering the release of inflammatory mediators, recruitment of immune cells, phagocytic responses, and cell lysis. The complement system can be activated by the classical pathway, the lectin pathway, and the alternative pathway. The classical pathway is triggered by direct binding of antibodies or complement component Clq to the surface of pathogens; the lectin pathway is triggered by binding of mannose-binding lectins to pathogen-associated molecular patterns (PAMPs) or apoptotic host cells; and the alternative pathway, which can account for 80% of total complement activation, is triggered by the spontaneous generation of C3b from cleavage of serum C3, followed by binding of C3b to the surface of pathogens (e.g., tumor cells) and amplification of complement activation. All activation pathways lead to the formation of the serine protease C3 convertase complex, which catalyzes the proteolytic cleavage of C3 plasma protein into C3a, a major anaphylatoxin, and C3b, an opsonin, which can coat antigen surfaces to mark them for phagocytosis by circulating macrophages. C3b complexes with other cleavage fragments of circulating complement proteins to form the C5 convertase, which cleaves C5 to trigger the terminal pathway, producing C5a and C5b; the latter subsequently binds to C6, C7, C8, and multiple C9 to form the C5b-9 terminal complement complex, also known as the membrane attack complex (MAC), which deposits in the lipid bilayer of cells, ultimately leading to membrane disruption and cell lysis. The complement system is generally considered a protective mechanism against tumor formation, although certain reports suggest that the complement system has pro-tumorigenic potential under certain conditions in certain cancers. The contribution of the complement system to cancer pathophysiology can depend largely on the nature of the tumor microenvironment.
[0046] The complement system is tightly regulated by membrane-bound complement regulatory proteins (mCRPs), such as CD46, CD55, and CD59. CD55 (also known as decay- accelerating factor, DAF) accelerates decay or disassembly of C3 and C5 convertases, leading to reduced formation of anaphylatoxins (C3a and C5a) and opsonins, and prevents MAC formation. CD59 inhibits MAC formation by preventing C9 polymerization and insertion of additional C9 molecules into the MAC complex, and by interfering with pore formation by C5b-8. Interestingly, CD55 and CD59 are overexpressed in multiple human cancer cells and can serve as biomarkers of tumor progression and targets for cancer immunotherapy. It has been reported that cytokines can increase or decrease the expression of mCRPs on tumor cells; however, whether oncogenic signals, especially those initiated by mutations in receptor tyrosine kinases, upregulate CD55 and CD59 to inhibit complement activation and protect tumor cells from immune attack remains unknown. Furthermore, although several types of cancer have shown promising responses to immune checkpoint blockade, a large fraction of cancer patients, including those with non-small cell lung cancer (NSCLC) harboring epidermal growth factor (EGF) receptor (EGFR) mutations, are resistant to anti-PD-1 antibody therapy. It is currently unknown whether tumor cells coordinate the regulation of the complement system and cytotoxic T cell activity and subsequently modulate immune checkpoint blockade responses.
[0047] In this patent, we demonstrate that EGFR activation or Wnt signaling in NSCLC cells increases the expression of CD55 and CD59, inhibits the complement system, and suppresses the subsequent macrophage phagocytosis and CD8+ T cell activation, a process mediated by the transcriptional upregulation of the beta-catenin- mediated long non-coding RNA (lncRNA) LINC00973, which sequesters microRNAs (miRs) targeting CD55 (miR-216b) and CD59 (miR-150). Inhibition of this regulation restores EGFR-induced complement inhibition and sensitizes EGFR-mutated NSCLC patients to immune checkpoint blockade therapy.
[0048] The complement system is an important component of immune responses. However, its role in tumor immune escape induced by oncogenic signaling and its relationship with cytotoxic T cell activation remain largely uncertain. Here, we demonstrate that EGFR activation or Wnt signaling increases expression of complement regulatory proteins CD55 and CD59, thereby inhibiting the complement system and C3 and C5 convertase-dependent cytokine secretion, which contribute to CD8+ T cell activation. The enhanced expression of CD55 and CD59 is due to β-catenin-mediated upregulation of the lncRNA LINC00973, which sequesters miR-216b targeting CD55 and miR-150 targeting CD59. Knockdown of CD55 and CD59, CD55 / CD59 neutralizing antibody treatment, or knock-in mutation of TCF / LEF binding elements in the LINC00973 promoter region, activate the complement system and CD8+ T cells and suppress tumor growth, while these tumor suppressive effects are abolished by depletion of mouse hepatic C3 and C5. Importantly, combination therapy of anti-CD55 / CD59 antibodies and anti-PD-1 antibodies produces synergistic tumor suppression. Furthermore, EGFR phosphorylation, activated β-catenin, LINC00973 expression, and CD55 and CD59 levels are negatively correlated with Ml macrophage and CD8+ T cell infiltration and positively correlated with clinical invasiveness of human non-small cell lung cancer (NSCLC) specimens. These findings highlight the important role of EGFR / Wnt-induced and β-catenin-mediated upregulation of CD55 and CD59 in inhibiting the complement and CD8+ T cell activation, in favor of tumor immune evasion and immune checkpoint blockade resistance, and reveal the great potential of a novel cancer therapy of anti-CD55 / CD59 antibody and immune checkpoint inhibitor combination.
[0049] The present application provides a use of a cancer immunotherapy target and a diagnostic, prognostic biomarker, comprising: (1) determining detecting in cancer cells of a patient or in blood of a patient comprising: elevated levels of EGFR activation, Wnt pathway activation, activated β-catenin, long non-coding RNA LINC00973 expression, LNC1574203 expression, protein and mRNA expression of CD55, protein and mRNA expression of CD59, protein and mRNA expression of CD73, as compared to reference levels; (2) determining detecting in cancer cells of a patient or in blood of a patient comprising: decreased levels of C4d expression, C3a expression, C3b expression, C5a expression, C5b-9 expression, as compared to reference levels; and (3) blocking one or more than one of the states of EGFR activation, Wnt pathway activation, activated β-catenin, long non-coding RNA LINC00973 expression, LNC1574203 expression, protein and mRNA expression of CD55, protein and mRNA expression of CD59, protein and mRNA expression of CD73, using inhibitory methods; and (4) promoting C4d expression, C3a expression, C3b expression, C5a expression, C5b-9 expression, using activating methods; and / or (5) predicting a favorable response of the patient to a treatment method; the reference levels are levels in blood from non-cancer cells or early stage cancer cells or healthy individuals, or early stage cancer patients.
[0050] In optional embodiments, the cancer is a cancer of oral cavity, oropharynx, nasopharynx, respiratory system, urogenital system, gastrointestinal system, central or peripheral nervous system tissue, endocrine or neuroendocrine system, or hematopoietic system, glioma, sarcoma, epithelial carcinoma, lymphoma, melanoma, fibroma, meningioma, brain cancer, kidney cancer, biliary system cancer, pheochromocytoma, islet cell carcinoma, Li-Fraumeni tumor, thyroid cancer, parathyroid cancer, pituitary tumor, adrenal tumor, osteogenic sarcoma tumor, neuroendocrine system tumor, breast cancer, lung cancer, head and neck cancer, prostate cancer, esophageal cancer, tracheal cancer, liver cancer, bladder cancer, stomach cancer, pancreatic cancer, ovarian cancer, uterine cancer, cervical cancer, testicular cancer, colon cancer, rectal cancer, or skin cancer.
[0051] In optional embodiments, the determining method comprises using specific antibodies, performing ELISA, immunoassay, radioimmunoassay, immunohistochemistry, immunoradiometric assay, fluorescent immunoassay, gel electrophoresis, immunoblot analysis, in situ hybridization, flow cytometry, or microscopic assay.
[0052] In optional embodiments, the inhibiting method comprises using an EGFR inhibitor, a Wnt inhibitor, a beta-catenin inhibitor, a LINC00973 inhibitor, a LNC1574203 inhibitor, a protein and mRNA inhibitor of CD55, a protein and mRNA inhibitor of CD59, a protein and mRNA inhibitor of CD73, or any other method that inhibits EGFR activation, Wnt pathway activation, activated beta-catenin, long non-coding RNA LINC00973 expression, LNC1574203 expression, protein and mRNA expression of CD55, protein and mRNA expression of CD59, protein and mRNA expression of CD73.
[0053] In optional embodiments, the activating method comprises using a C4d agonist, a C3a agonist, a C3b agonist, a C5a agonist, a C5b-9 agonist, or any other method that activates C4d expression, C3a expression, C3b expression, C5a expression, C5b-9 expression.
[0054] In optional embodiments, the EGFR inhibitor, the Wnt inhibitor, the beta-catenin inhibitor, the LINC00973 inhibitor, the LNC1574203 inhibitor, the protein and mRNA inhibitor of CD55, the protein and mRNA inhibitor of CD59, the protein and mRNA inhibitor of CD73, comprises a small molecule inhibitor, a polypeptide, a complementary inhibitory oligonucleotide, or a neutralizing antibody against EGFR, Wnt, beta-catenin, LINC00973, LNC1574203, protein and mRNA of CD55, protein and mRNA of CD59, protein and mRNA of CD73.
[0055] In optional embodiments, the C4d agonist, the C3a agonist, the C3b agonist, the C5a agonist, the C5b-9 agonist, comprises a small molecule agonist against C4d, C3a, C3b, C5a, C5b-9.
[0056] In optional embodiments, the favorable response comprises a reduction in tumor size or burden, a retardation of tumor growth, a reduction in tumor-related pain, a reduction in cancer-related pathologies, a reduction in cancer-related symptoms, a prolongation of cancer progression-free period, a prolongation of disease-free interval, an induction of remission, a reduction in metastasis, a prolongation of patient survival, or an increase in tumor sensitivity to anti-cancer therapy, especially immunotherapy.
[0057] The application also provides a use of a cancer immunotherapy target and a diagnostic, prognostic biomarker, comprising: (1) determining whether the patient's cancer cells or blood contains: an elevated level of EGFR activation, Wnt pathway activation, activated β-catenin, long non-coding RNA LINC00973 expression, LNC1574203 expression, protein and mRNA expression of CD55, protein and mRNA expression of CD59, protein and mRNA expression of CD73, and various combinations of the six elevated levels compared to a reference level; (2) determining whether the patient's cancer cells or blood contains: a reduced level of C4d expression, C3a expression, C3b expression, C5a expression, C5b-9 expression, and various combinations of the five reduced levels compared to a reference level; (3) predicting that the patient has an invasive cancer if the patient's cancer cells or blood contains an elevated level of any of (1); (4) predicting that the patient's invasive cancer is in a progressive stage if the patient's cancer cells or blood contains an elevated level of any of (1); (5) predicting that the patient has a poor prognosis if the patient's cancer cells or blood contains an elevated level of any of (1); (6) predicting that the patient has an invasive cancer if the patient's cancer cells or blood contains a reduced level of any of (2); (7) predicting that the patient's invasive cancer is in a progressive stage if the patient's cancer cells or blood contains a reduced level of any of (2); (8) predicting that the patient has a poor prognosis if the patient's cancer cells or blood contains a reduced level of any of (2); the reference level is the level in non-cancer cells or early-stage cancer cells or blood of a healthy individual, or blood of an early-stage cancer patient.
[0058] In an alternative embodiment, if the patient is determined to have an invasive cancer, an inhibitor anti-cancer treatment is performed using one or more than two ways of blocking EGFR activation, Wnt pathway activation, activated β-catenin, long non-coding RNA LINC00973 expression, LNC1574203 expression, protein and mRNA expression of CD55, protein and mRNA expression of CD59, protein and mRNA expression of CD73.
[0059] In an alternative embodiment, if the patient is determined to have an invasive cancer, an activator anti-cancer treatment is performed using one or more than two ways of activating C4d expression, C3a expression, C3b expression, C5a expression, C5b-9 expression.
[0060] The application will be explained in detail in connection with specific experiments. The experimental methods described in the following examples are conventional methods, unless otherwise specified; the specific techniques or conditions not mentioned in the examples are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions; the reagents and materials described, unless otherwise specified, are commercially available.
[0061] The materials used in the experiments of the application are as follows:
[0062] anti-CD55 (E7G2U) (#31759), anti-CD46 (D6N7H) (#13241), anti-Dicer (D38E7) (#5362), anti-β-catenin (D10A8) (#8480), anti-EGFR (L858R mutant specific) (43B2) (#3197), and anti-EGFR (D38B1) (#4267) antibodies (for immunoblotting); anti-non-phospho-β-catenin (Ser33 / 37 / Thr41) (D13A1) (active-β-catenin) (#8814) antibody (for immunohistochemistry); a SignalStain DAB Substrate Kit (#8059), anti-rabbit IgG (HRP-conjugated) antibody (#7074), anti-mouse IgG (HRP-conjugated) antibody (#7076), anti-c-Jun (60A8) (#9165), anti-human Frizzled6 (#5158) (for immunoblotting), anti-CD8 antibody (#85336) (for immunohistochemistry), anti-SNIP / p140Cap (#3757) antibody (for immunoblotting), and anti-human EGFR phosphorylated Y1173 antibody (#4407) (for immunohistochemistry) were purchased from Cell Signaling Technology (Danvers, MA). Anti-tubulin (DM1A) (T9026) antibody (for immunoblotting), Liberase (5401054001), lepirudin (recombinant form of watermoccasin, H0393), and lipopolysaccharide (LPS) from Escherichia coli O127:B8 (L4516) were purchased from Sigma (St. Louis, MO). BAMBANKER (4987481582811) was purchased from Wako Chemicals (Osaka, Japan). Human cord blood CD34+ hematopoietic stem cells (CBP3401C) were obtained from STEMCELL EXPRESS (Folsom, CA). XAV939 (HY-15147) was purchased from MCE (Monmouth Junction, NJ). Anti-mouse C3b antibody (HM1065), anti-mouse C4d (HP8033) (for immunohistochemistry) were purchased from Hycult Biotech (Wayne, PA). Anti-mouse C5b-9 (bs-2673R) (for immunohistochemistry) was purchased from Bioss (Woburn, MA).Immobilon Protein Chemiluminescent HRP Substrate (WBKLS0100), Immobilon- P PVDF Membrane (IPVH00010), Chromatin Immunoprecipitation Kit (17-10085), RNA Immunoprecipitation Kit (17-704), Anti-Ago2 antibody (03-110) (for immunoprecipitation), and Anti-TCF-4 antibody (clone 6H5-3) (for electrophoretic mobility shift assay) were obtained from Millipore (Billerica, MA). Anti-human C5b-9 antibody (aE11) (LS-C663067) (for flow cytometry) was purchased from LifeSpan BioSciences (Seattle, WA). Anti-human C3b antibody (ab11871), Anti-human C4d antibody (ab183311), Anti-human C5b-9 antibody (ab55811) (for immunohistochemistry and immunofluorescence), Human Complement Factor H ELISA Kit (ab252359), Human Complement Factor B ELISA Kit (ab137973), Human Complement C3 ELISA Kit (ab108823), Human Complement C5 ELISA Kit (ab125963), Mouse Complement C3 ELISA Kit (ab263884), and Mouse Complement C5 ELISA Kit (ab264609) were purchased from Abeam (Cambridge, MA). PE-Cy7 Anti-Mouse CD8a antibody (53-6.7) (561097) (for flow cytometry), Fixation / Permeabilization Solution Kit (554714), and PE-Cy7 Anti-Human CD8 antibody (HIT8a) (566858) (for flow cytometry) were purchased from BD Biosciences (San Jose, CA).APC anti-human / mouse granulysin antibody (QA16A02) (372204), PE anti-mouse perforin antibody (S16009A) (154306) (for flow cytometry), PE anti-human perforin antibody (B-D48) (353303) (for flow cytometry), Zombie Violet fixable viability kit (423113), Alexa Fluor 647 anti-human CD11b antibody (M1 / 70) (101218), TruStain FcX anti-mouse CD16 / 32 monoclonal antibody (93) (101319), Brilliant Violet 510 anti-mouse CD11b antibody (M1 / 70) (101245), PE anti-mouse CD45 antibody (30-F11) (103106), PE / Cyanine 7 anti-mouse F4 / 80 antibody (BM8) (123114) (for flow cytometry), anti-human CD3 (HIT3a) (300302) (for co-stimulation), anti-human CD28 (CD28.2) (302902) (for co-stimulation) were purchased from BioLegend (San Diego, CA). Nano-Glo Luciferase Reporter Assay System (N1610) and Luciferase Reporter Assay System (E1910) were purchased from Promega (Madison, WI). ABCA Protein Detection Kit (23225), EGF Recombinant Human Protein Solution (PHG0311L), Revert First Strand cDNA Synthesis Kit (K1622), PowerUp SYBR Green Master Mix (A25742), NE-PER Nuclear and Cytoplasmic Extraction Reagents (78833), Anti-Human / Mouse Complement C3b Monoclonal Antibody (6C9) (MA1-70053) (for flow cytometry), Enzyme-Free Cell Dissociation Buffer (13150016), Iscove’s Modified Dulbecco’s Medium (IMDM) (12440053), TrypLE Express Enzyme (12605010), pHrodo Red, SE (P36600), 4',6-diamidino-2-phenylindole (DAPI) (P36931), ACK Lysis Buffer (A1049201), UltraCompe Beads (01-2222-41), Cytiva Ficoll-Paque PLUS Medium (45-001-750)), Fixable Aqua Dead Cell Staining Kit (L34965), and Dynabeads FlowComp Human CD14 Kit (11367D) were purchased from Thermo Fisher Scientific (Waltham, MA).Anti-mouse C5b-9 antibody (2A1) (sc-66190) (for flow cytometry) was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Human M-CSF (300-25), human IFN-γ (300-02), and human IL-4 (200-04) were purchased from PeproTech (Israel). Recombinant human / mouse Wnt-5a protein (645-WN-010), human IFN-γ Quantikine ELISA kit (SIF50), mouse IFN-γ Quantikine ELISA kit (SMIF00), human IL-1 β Quantikine ELISA kit (SLB50), mouse IL-1 β Quantikine ELISA kit (SMLB00C), human IL-6 Quantikine ELISA kit (S6050), mouse IL-6 Quantikine ELISA kit (SM6000B), human IL-17 Quantikine ELISA kit (S1700), mouse IL-17 Quantikine ELISA kit (SM1700), human TNF-α Quantikine ELISA kit (STA00D), mouse TNF-α Quantikine ELISA kit (SMTA00B), mouse complement C5a ELISA kit (DY2150), and human complement C5a ELISA kit (DY2037) were purchased from R&D Systems. Mouse complement C3a ELISA kit (NBP2-70037) and human complement C3a ELISA kit (NBP2-66755) and recombinant human Wnt-7b protein (H00007477-P01) were purchased from Novus Biologicals (Centennial, CO). RNeasy Mini kit (74104), QIAquick Gel Extraction kit (28706), QIAamp DNA Mini kit (51306), and Plasmid Midi kit (12145) were purchased from QIAGEN (Germantown, MD). Anti-human PD-1 antibody (J116) (BE0188) (for blocking), anti-mouse PD-1 antibody (29F.1A12) (BE0273) (for blocking), anti-human CD8 antibody (OKT-8) (BE0004-2) (for depletion), and IgG (MOPC-21) (BE0083) (for isotype control) were obtained from BioXCell (Lebanon, NH).
[0063] DNA construction and mutagenesis
[0064] Polymerase chain reaction (PCR)-amplified human WT CTNNB1, EGFR, EGFR L858R, CD55, CD59, TCF-4, MLINC00973, and LINC00973 were cloned into pcDNA3.1 / hygro(+)-Flag, pCDH-CMV-MCS-EF1-Puro-SFB, pCDH-CMV-MCS-Flag-EF1-Puromycin, pCDH-CMV-MCS-Flag-EF1-Geneticin (G-418), pCDH-CMV-MCS-Flag-EF1-Blasticidin, pCDH-CMV-MCS-Flag-EF1-Zeocin, or pET32a vectors.
[0065] EGFR L858R and short hairpin RNA (shRNA) resistant β-catenin (rβ-catenin) were constructed. pGIPZ shRNAs were constructed by ligating oligonucleotides targeting human β-catenin, LINC00973, CD55, or CD59 into Xho I / Mlu I digested pGIPZ vectors. The following pGIPZ shRNA target sequences were used: control shRNA oligonucleotide, 5'-GCTTCTAACACCGGGAGGTCTT-3'; human β-catenin shRNA oligonucleotide, 5'-GCATAACCTTTCCCATCATCG-3'; mouse β-catenin shRNA oligonucleotide, 5'-CGTGAAATTCTTGGCTATTAC-3'; LINC00973 shRNA oligonucleotide, 5'-GGCACGACTTCTGGTCTATT-3'; MLINC00973 shRNA oligonucleotide, 5'-GCGTAACTTCTGGTCATTTAG-3'; human CD55 shRNA oligonucleotide, 5'-TGGTCCACAGCAGTCGAATTT-3'; mouse CD55 shRNA oligonucleotide, 5'-GTTAGTCTAGCTTATGATTAA-3'; human CD59 shRNA oligonucleotide, 5'-GATGCGTGTCTCATTACCAAA-3'; mouse CD59 shRNA oligonucleotide, 5'-CGGTGGTTTCTTCATGCAATA-3'; mouse C3 shRNA oligonucleotide, 5'-CCATCAAGATTCCAGCCAGTA-3'; and mouse C5 shRNA oligonucleotide, 5'-GCACGACTCCTGGTCTATTAC-3'.
[0066] Cell lines and cell culture conditions
[0067] H1395, H322M and 293T cells were obtained from ATCC. LA795 and MC38 cells used in the experiments were identified using short tandem repeat profiling at the Chinese Academy of Medical Sciences and Peking Union Medical College. Cells were maintained in complete medium containing Dulbecco’s modified Eagle’s medium (DMEM), 10% fetal bovine serum (FBS), 1,000 U / ml penicillin and 100 pg / ml streptomycin. Cells were serum-starved for 16 hours before EGF treatment. EGF at a final concentration of 100 ng / ml was used for cell stimulation. The cell lines used in this study were not found in the Common Misidentified Cell Lines Database maintained by the International Cell Line Authentication Committee and NCI Biosample. Cell lines were identified by short tandem repeat analysis and routinely tested for mycoplasma contamination. Cells were seeded at a density of 4 x 105 5 in 60 mm dishes or 1 x 105 5 in each well of a 6-well plate 18 hours before transfection. Transfection procedures were performed as previously described.
[0068] Western blot analysis
[0069] Proteins were extracted from cultured cells by modified buffer and then immunoblotted using the corresponding antibodies as previously described.
[0070] 5' and 3' rapid amplification of cDNA ends (RACE)
[0071] According to the manufacturer’s instructions, we used the SMARTer RACE cDNA Amplification Kit (Clontech, Palo Alto, CA) using 5'-RACE and 3'-RACE analysis to determine the transcription start and end sites of LINC00973 and MLINC00973. The gene-specific primers used for PCR in the RACE analysis were as follows: LINC00973, 5'-CCATGGACAAAGCCAAGGATTCAGTAAAG-3' (reverse) (5'-RACE) and 5'-GAAGGGGAGGAATTACTTATCCTTTGGC-3' (forward) (3'-RACE); MLINC00973, 5'-TGCTACTCAAAATCTCTGCTTGGAAAGA-3' (reverse) (5'-RACE) and 5'-ATTTGTTTGACATTGAATCTGAGCCTTG-3' (forward) (3'-RACE).
[0072] Fluorescence in situ hybridization in cells
[0073] Stellaris in situ hybridization (ISH) probes were designed against human LINC009734.2) using the Stellaris RNA ISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA, USA) at http: / / www.biosearchtech.com / stellarisdesigner (Stellaris Probe Designer version). Human H1395 cells were hybridized with Stellaris RNA ISH probes with slight modifications to the manufacturer's instructions available online at http: / / www.biosearchtech.com with LINC00973 labeled with Quasar 570. Briefly, cells were incubated with 20 nM of Quasar 570 labeled probes in hybridization buffer and hybridized overnight at 42 °C. Cells were washed in hybridization buffer at 42 °C and briefly in 0.1 x SSC. Cells hybridized with Quasar 570 labeled probes were initially incubated in 3% hydrogen peroxide to block potential endogenous peroxidases. Probes were detected using a 1 :400 dilution of peroxidase-conjugated anti-fluorescein-Ab (Roche Applied Sciences, Mannheim, Germany) followed by the addition of Cy3 labeled TSA substrate for 10 minutes (PerkinElmer, Waltham, MA, USA). Cell samples were mounted using ProLong Gold antifade mountant containing DAPI for nuclear staining (ThermoFisher Scientific, Waltham, MA, USA).
[0074] In situ hybridization
[0075] Formalin-fixed (4% paraformaldehyde; Sigma-Aldrich, St. Louis, MO) paraffin-embedded (FFPE) sections of human NSCLC samples were probed for in situ hybridization using double-digoxigenin (DIG)-labeled locked nucleic acid (LNA) probes (Exiqon, Vedbaek, Denmark) as previously described. Fixed and permeabilized cells were pre-hybridized in hybridization buffer and then hybridized with 25 nM LNA probes at 55°C for 1 hour for LINC00973: 5'-AATGCGAAGGAGTAACACAGCT-3' (predicted RNA Tm = 84°C), MLINC00973: 5'-AGTGATTTATTTGCATGCTAAT-3' (predicted RNA Tm = 81°C), miR-216b: 5'-TCACATTTGCCTGCAGAGATT-3' (predicted RNA Tm = 85°C), miR-150: 5'-CACTGGTACAAGGGTTGGGAGA-3' (predicted RNA Tm = 83°C), and scrambled probe 5'-TGTAACACGTCTATACGCCCA-3' (predicted RNA Tm = 87°C) as a negative control. DIG-labeled probes were detected by 1 :400 diluted peroxidase-conjugated anti-DIG-Ab (Roche Applied Sciences, Mannheim, Germany) followed by addition of DAB substrate for 10 minutes (Cell Signaling Technology, Danvers, MA, USA).
[0076] RNA immunoprecipitation
[0077] pMS2-GFP (Addgene) was co-transfected with pcDNA3.1-MS12, pcDNA3.1-MS12- LINC00973, pcDNA3.1-MS12-MLINC00973, pcDNA3.1-MS12-LINC00973-mut(miR-216b), pcDNA3.1-MS12-MLINC00973-mut(miR-150), pcDNA3.1-MS12-MLINC00973- mut(mmu-miR-216b), or pcDNA3.1-MS12-MLINC00973-mut(mmu-miR-150) into H1395, H322M, or LA795 cells. Forty-eight hours after transfection, RNA fractions isolated by RIP were quantified by NanoDrop ND1000 instrument (Thermo-Fisher Scientific, Waltham, MA) according to the manufacturer's instructions.
[0078] For anti-Ago2 RIP, H1395 and H322M cells were transfected with miR-216b, miR-150, or microRNA negative control. Forty-eight hours after transfection, cells were used for RIP experiments using anti-Ago2 antibody (Millipore).
[0079] Subcellular fractionation
[0080] Nuclei and cytosol were isolated using the Nuclei Extractor Kit from Active Motif (Carlsbad, CA).
[0081] Stoichiometry analysis
[0082] Copy numbers of LINC00973, miR-216b, and miR-150 were determined in H1395 cells treated with EGF for 0, 2, 4, 6, and 8 hours. The increase in LINC00973 quantity and decrease in miR-216b and miR-150 quantity between 0 and 2 hours, 2 and 4 hours, 4 and 6 hours, and 6 and 8 hours were calculated. Stoichiometry of LINC00973 binding to miR-216b and miR-150 was calculated based on the average of the increase or decrease in LINC00973, miR-216b, and miR-150 quantity over 8 hours.
[0083] Chromatin immunoprecipitation (ChIP) assay
[0084] ChlP was performed using Upstate Biotechnology's kit. Chromatin prepared from cells (in 15 cm dishes) was used to determine total DNA input amounts, and samples were incubated overnight with specific antibodies or normal rabbit or mouse immunoglobulin G. Human LINC00973 promoter-specific primers used for PCR were as follows: TBE1, 5'-TATTGAGAATCACAATTATG-3' (forward) and 5'-TGAACCCCAACAGGAAAATA-3' (reverse); TBE2, 5'- ATTTCAAATTATTGAGGGACT-3' (forward) and 5'-CTACTTAAGAAGCATACAGAA-3' (reverse); and TBE3, 5'-GCAGGGGAAGGGTTATGAACA-3' (forward) and 5'- TTCCTCGGATGGTTTCCCACA-3' (reverse). Mouse MLINC00973 promoter-specific primers used in PCR were as follows: TBE4, 5'-TAGGTTTGGTCTTCTCATTGT-3' (forward) and 5'- AGAATACAAGAGATGGAAGAG-3' (reverse); and TBE5, 5'-GGATTACCTTCTTGTTTTTTC-3' (forward) and 5'-AGAAACCAAAGTATTCCACGA-3' (reverse).
[0085] RNA pulldown
[0086] LINC00973, LINC00973-mut(miR-216b), LINC00973-mut(150), or lncRNA-225205 were transcribed in vitro from pSPT19-LINC00973, pSPT19-LINC00973-mut(miR-216b), pSPT19-LINC00973-mut(150), and pSPT19-225205 vectors, respectively. These lncRNAs were biotin-labeled with biotin RNA labeling mix (Roche) and T7 RNA polymerase (Roche), treated with RNase-free DNase I (Roche), and purified using RNeasy Mini kit (Qiagen, Valencia, CA). One mg of whole cell lysates of H1395 and H322M cells were incubated with 3 μg of purified biotinylated transcripts for 1 hour at 25°C; complexes were isolated using streptavidin agarose beads (Invitrogen). Precipitated RNA was detected by qRT-PCR analysis.
[0087] Quantitative real-time PCR
[0088] Total RNA was extracted from cell and tissue samples using TRIzol reagent according to the manufacturer's instructions (Invitrogen). Equal amounts of RNA samples were used for cDNA synthesis by TaqMan Reverse Transcription Kit (Applied Biosystems). Quantitative PCR analysis was performed using 7500 Real Time PCR System (Applied Biosystems) and SYBR Premix Ex Taq Kit (Takara Bio) with β-actin or U6 RNA (for miRNA) as an internal control.
[0089] The following primers were used for quantitative PCR: human CD55, 5'- CCAGCACCACCACAAATTGAC-3' (forward) and 5'-TCTCCAATCATGGTGAATCCT-3' (reverse); human CD59, 5'-AGGCATGCCAAATGTTCCATA-3' (forward) and 5'- GTTTTCATGCCCTGCTATCTG-3' (reverse); human LINC00973, 5'- ATGAAGCCACAGAGATTTGCT-3' (forward) and 5'-AGCCTTCAATTCCAGGGAAAG-3' (reverse); human CFH, 5'-AATTCATCCAGGTCTTCACAA-3' (forward) and 5'- ACTCCATTTTCCCATGTAGC-3' (reverse); human CFB, 5'-CGAGCTTTGAGGCTTCC-3' (forward) and 5'-TGATGTAGACCTCCTTCCG-3' (reverse); human C3, 5'- GCTGAAGGAAAAGGCCAAG-3' (forward) and 5'-CGGTGCTGGTTTTATGGTG-3' (reverse); human C4, 5'-CTCCATCTCAAAGGCAAGC-3' (forward) and 5'- AACACCGAGCAGGTCCA-3' (reverse); human C5, 5'-ATCAGGGCACAAAGTCCTC-3' (forward) and 5'-CTTCTGGCACCACTCGTAA-3' (reverse); human CD55 intron 2, 5'- AGTTCTGGGAATGGAATGTATCTTA-3' (forward) and 5'-AGTGTTAGGAAGAAAAACTCTTAAT-3' (reverse); human CD55 intron 3, 5'-TCTGGTGTTTGGGGGAAATAGTATC-3' (forward) and 5'- TTAGGTAACCTCAAAACTAATTAAAT-3' (reverse); human CD55 intron 8, 5'- AAGGCAATTACTGCCCTGAAACTGA-3' (forward) and 5'-ATGTAAGCCACAAAACCAATGCTGA-3' (reverse); human CD59 intron 1, 5'-GGTGTCCTAGCCGAACGCTGGCTTC-3' (forward) and 5'- CCGCTAGAGCTTCCCTTGAGACGAA-3' (reverse); human CD59 intron 2, 5'- GAAGTCTGACACAGGTCTCACAGGG-3' (forward) and 5'-CTAAGAATGGTCCTCAACTGACACT-3' (reverse);Human CD59 intron 5, 5'-ACTGTAATCCTCATTAGGCTTGCAT-3' (forward) and 5'-CCTGAGTCGGTTACTTAACCATAAT-3' (reverse); Human FZD1, 5'-ATCGAAGCCAACTCACAGTATTT-3' (forward) and 5'-CACGTTGTTAAGCCCCACG-3' (reverse); Human FZD2, 5'-GTGCCATCCTATCTCAGCTACA-3' (forward) and 5'-CTGCATGTCTACCAAGTACGTG-3' (reverse); Human FZD3, 5'-GTTCATGGGGCATATAGGTGG-3' (forward) and 5'-GCTGCTGTCTGTTGGTCATAA-3' (reverse); Human FZD4, 5'-CCTCGGCTACAACGTGACC-3' (forward) and 5'-TGCACATTGGCACATAAACAGA-3' (reverse); Human FZD5, 5'-CATGCCCAACCAGTTCAACC-3' (forward) and 5'-CGGCGAGCATTGGATCTCC-3' (reverse); Human FZD6, 5'-ATGGCCTACAACATGACGTTT-3' (forward) and 5'-GTTTACGACAAGGTGGAACCA-3' (reverse); Human FZD7, 5'-GTGCCAACGGCCTGATGTA-3' (forward) and 5'-AGGTGAGAACGGTAAAGAGCG-3' (reverse); Human FZD8, 5'-ATCGGCTACAACTACACCTACA-3' (forward) and 5'-GTACATGCTGCACAGGAAGAA-3' (reverse); Human FZD9, 5'-TGCGAGAACCCCGAGAAGT-3' (forward) and 5'-GGGACCAGAACACCTCGAC-3' (reverse); Human FZD10, 5'-GCTCATGGTGCGTATCGGG-3' (forward) and 5'-GAGGCGTTCGTAAAAGTAGCA-3' (reverse); Human LRP5, 5'-TGGCCCGAAACCTCTACTG-3' (forward) and 5'-GCACACTCGATTTTAGGGTTCT-3' (reverse); Human LRP6, 5'-ACGATTGTAGTTGGAGGCTTG-3' (forward) and 5'-ATGGCTTCTTCGCTGACATCA-3' (reverse); Human ACTB, 5'-ATGGATGACGATATCGCTGCGC-3' (forward) and 5'-GCAGCACAGGGTGCTCCTCA-3' (reverse);Human MIR216B, 5'-CGGGCAAATCTCTGCAGGCA-3' (forward) and 5'- CAGCCACAAAAGAGCACAAT-3' (reverse); human MIR150, 5'- CGGGCTCTCCCAACCCTTGT-3' (forward) and 5'- CAGCCACAAAAGAGCACAAT-3' (reverse); human RNU6, 5'- CTCGCTTCGGCAGCACA-3' (forward) and 5'- AACGCTTCACGAATTTGCGT-3' (reverse); mouse CD55, 5'- ATTGTCCAGAGCCACCAAAAAA-3' (forward) and 5'- TGTCCTACATCAGACTTGCTC-3' (reverse); mouse CD59, 5'- TTCAGATGCTGCCAGTTTAAC-3' (forward) and 5'- AAATGGCCACCAGAACCGAGG-3' (reverse); mouse MLINC00973, 5'- ATGATTGCTCATGGGTCCTGT-3' (forward) and 5'- GAGGCAGTGACACAGCTGGGA-3' (reverse); mouse C3, 5'- TCCAACAAGAACACCCTCA-3' (forward) and 5'- GGCTGGATAAGTCCCACA-3' (reverse); mouse C5, 5'- ACAGCCCAATCAAGTTCCT-3' (forward) and 5'- TTCAAGTCGTCACCCAGAG-3' (reverse); and mouse ACTB, 5'- GCTGTGCTGTCCCTGTATGCC-3' (forward) and 5'- GGAGAGCATAGCCCTCGTAGA-3' (reverse).
[0090] Lentivirus preparation
[0091] We transfected 293T cells in 150 mm dishes with 6 μg of lentiviral expression vector for the specific gene or shRNA, 6 μg pLP1, 6 μg pLP2, and 6 μg pLPVSV-G (Invitrogen), a plasmid encoding the G protein of vesicular stomatitis virus envelope. The next day the medium was changed. Lentivirus-containing medium was harvested 48 and 72 hours after transfection. Virus particles were concentrated and purified by ultracentrifugation (25,000 g for 2 hours at 4°C). Cells were infected with lentivirus (1 x 10 6 ) in the presence of 6 μg / ml polybrene (Sigma).
[0092] Purification of recombinant proteins
[0093] GST-TCF4 was expressed in bacteria and purified as previously described.
[0094] Genome editing
[0095] Genomic mutations were introduced into cells using the CRISPR / Cas9 system as previously described (84). Single guide RNAs (sgRNAs) were designed to target genomic regions adjacent to the human or mouse LEF / TCF binding element mutation site or the human miR-216b and miR-150 binding element (miR-216b / 150-BE) mutation using the CRISPR design tool (http: / / crispr.mit.edu / ) website. Annealed guide RNA oligos were inserted into PX458 vectors (Addgene, Cambridge, MA) digested with Bbsl restriction enzyme (85). Cells were seeded at 60% confluency and co-transfected with sgRNA (0.5 μg), single-stranded donor oligonucleotides (ssODNs) (20 pmol) used as templates to introduce mutations, and wild-type hSpCas9 labeled with GFP. Twenty-four hours after transfection, cells were trypsinized, diluted to obtain single cells, and seeded into 96-well plates. Genomic DNA was extracted from GFP-positive cells. Genotyping was performed by sequencing PCR products spanning the mutation region. The sgRNA target sequence for TBE1 was 5'-TTATAGAATATAATCAAAG-3'; the single-stranded donor oligonucleotide (ssODN) sequence for TBE1 was 5'-TACTAACAAAGTAAAATTATTTATTGAGAATCACAATTATGTACCAGATATTTAAAATAATATTAGTATGACTAGCCCGATAATAGAATATTAGCCAAAGTTCAGAAAGGCTAAGTAAATTATCCAAGTTCAACCATAAATATTATTTTCCTGTTGGGGTTCAAGCGCAAGTCTACCTGACTCTAAAATGCAAACTT-3'. The sgRNA target sequence for TBE2 was 5'-ATTCTCCATCAAAGTTCCTC-3'; the ssODN sequence for TBE2 was 5'-GAAATAGATAAAACATTTAAAATGTCTAGAAAGATTTCAGTTTATTTCAAATTATTGAGGGACTAATGGGCTATTCTCCGCCAAAGTTCCACACGGACATACTGCTCTAATTATATGTATTGATTATTCTATTTTTCTGTATGCTTCTTAAGTAGTAATGATTTTTTCCAGAATATGCCT-3'.The sgRNA target sequence of TBE3 is 5'-CTGAAGATCAAAGAATGTCA-3'; the ssODN sequence of TBE3 is 5'- GGAAGGGTTATGAACAGTTGTAGTTCTCTTTTGCTCTCAGCAAACAGGGACTTCACACATTTTAGTTAATCTGAAGGCCAAAGAATGTGATCGGAGAAAATATGTTAAAAGCAAAACAATCCTTTTGAAATTGTGGGAAACCATCCGAGGAAAGACAAACAT-3'. The sgRNA target sequence of TBE4 is 5'-TTTTCTTTGATTGTTGTGCC-3'; the ssODN sequence of TBE4 is 5'- ACTCCTATTATCCGTAGGTTTGGTCTTCTCATTGTGTCCTGGATTTCCTGGATATTTTGAGTTAGGATCTTTTTGCATTTTCGATATTCTTTGGCTGTTGTGCCGATGTTCTCTATGGAATCTTCTGCACCTGAGATTCTCTCTTCCATCTCTTGTATTCTGTTGCTGATGCTCAAATCTATGGTTCCAGATTGTTTCC-3'. The sgRNA target sequence of TBE5 is 5'-CCTTTGAAGGGCTGGATTCG-3'; the ssODN sequence of TBE5 is 5'- GTCTTCTTTTAGGTTTGTTGAGGGATTACCTTCTTGTTTTTTCTAGGGCATTGTTCCCGTTCTTGTATTGGTTTTTTTCTGTTATTAACCTTTGGGGGCTGGATTGGTAGAGAGATAATGTGTGAATTTGGTTTTGTCGTGGAATACTTTGGTTTCTCCATCTATGGTAATTGAGAGTTTGGCTGGGTATAGTAGCC-3'.The sgRNA target sequence for miR-216b / 150-BE is 5'-GAAAGACACTAGAAGCTCTT-3'; the ssODN sequence for miR-216b / 150-BE is 5'- CCAGAAAGAGCTGTGTGTATATTTTAGAAAGACACTAGAAGCTCCCAAAGACATGTGGACAGTTGTGGCTGCTCCTGAGCTGACACTAACTGCTCATGACTCCTCTGCAAAGAGAGTAGGTGGTTTCCTAGAGGAAGAAGTTTGGGTAATGAAGCCACAAGAGCCCGCTGATACATTTGCTAGGCACGACTTCTGGTCAT-3'.
[0096] Genotyping was performed by sequencing the amplified PCR products using the following primers spanning the mutation region. For TBE1, 5'-GCTTCTTATGTTAAAATTAGTG-3' (forward); 5'- ATAGCTTTCTAAATGACCAGA-3' (reverse); for TBE2, 5'-TCCAAATGCCATCCCACCTTT-3' (forward); 5'-TGCGCTTGAACCCCAACAGGA-3' (reverse); for TBE3, 5'- GACTGGGATACAAGTTCAAGA-3' (forward); 5'-CCTAGGTCAGAGTTGACTGCA-3' (reverse); for TBE4, 5'-GTCTCTGGTGAAAAATCTGGT-3' (forward); 5'- GTCTCTGGTGAAAAATCTGGT-3' (reverse); for TBE5, 5'-GGCTACTCCAGCTTGTTTCTT-3' (forward); 5'-GACCAGCAAACATCTTCAACA-3' (reverse); for miR-216b / 150-BE, 5'-CTTGCTCTGAATCCTATCATAGCTT-3' (forward); 5'- AGGATATGTAGAGGAATCATGTGGG-3' (reverse).
[0097] Luciferase reporter assay
[0098] pMIR-REPORT, pMIR-REPORT-LINC00973, pMIR-REPORT-MLINC00973, pMIR-REPORT-LINC00973-mut (miR-216b), pMIR-REPORT-LINC00973-mut (miR-150), pMIR-REPORT-MLINC00973-mut (mmu-miR-216b), or pMIR-REPORT-MLINC00973-mut (mmu-miR-150) and miR-216b mimic, miR-150 mimic, mmu-miR-216b mimic, mmu-miR-150 mimic, miR-216b inhibitor, miR-150 inhibitor, mmu-miR-216b inhibitor, mmu-miR-150 inhibitor, or miR-Control were introduced into H1395, H322M, or LA795 cells by lipofectamine-mediated gene transfer. Forty-eight hours after transfection, the relative luciferase activity was normalized to the Renilla luciferase activity.
[0099] pGL4.10 or pGL4.10-LINC00973 promoter and pcDNA3.1(+)-β-catenin, pcDNA3.1(+)-TCF4, pcDNA3.1(+)-TCF-4ΔN, or pcDNA3.1(+) were introduced into H1395 or H322M cells by lipofectamine-mediated gene transfer. Forty-eight hours after transfection, the relative level of luciferase activity was normalized to the level of Renilla luciferase activity and control.
[0100] TUNEL assay
[0101] Mouse tumor tissues were cut into 5 μm thick sections. Apoptotic cells were counted using the DeadEnd colorimetric TUNEL system (Promega) according to the manufacturer's instructions.
[0102] Complement deposition assay
[0103] Tumor cells were incubated with DMEM medium (10% FBS) supplemented or not with 25% v / v human serum (source of human complement system) and 25 μg / ml lepirudin (complete preservation of complement activity in human serum (86)) for 3 hours at 37°C. After washing, the expression of C3b and C5b-9 on the surface of tumor cells was determined by flow cytometry using the indicated antibodies.
[0104] Anaphylatoxin release assay
[0105] Tumor cells were incubated with DMEM medium (10% FBS) with or without the addition of 25% v / v human serum and 25 μg / ml lepirudin at 37°C for 3 hours. Anaphylatoxins (C3a and C5a) released from the supernatant were determined by ELISA according to the manufacturer's instructions.
[0106] Co-culture of tumor cells with PBMCs
[0107] After obtaining informed consent, peripheral blood mononuclear cells (PBMCs) were obtained from healthy donors and isolated by Ficoll-Paque Plus density gradient. PBMCs were treated with M-CSF (80 ng / ml) for 4 days, then with LPS (100 ng / ml) and IFN-γ (20 ng / ml) for 48 h, before co-culture with tumor cells in plates coated with anti-CD3 (2 μg / mL) and anti-CD28 (4 μg / mL) monoclonal antibodies and supplemented with 2 mM L-glutamine and 10% (v / v) human serum in RPMI 1640 medium. Tumor cells and PBMCs were harvested using TrypLE Express enzyme-free cell detachment buffer. Tumor cells were incubated with DMEM medium (10% FBS) supplemented with 25% v / v human serum and 25 μg / ml lepirudin at 37°C for 3 h, co-cultured with human PBMCs (PBMC:tumor cell ratio of 3: 1) in plates coated with anti-CD3 (2 μg / mL) and anti-CD28 (4 μg / mL) monoclonal antibodies in medium with 100 ng / ml LPS for 30 h (87).
[0108] Cytokine expression analysis
[0109] Tumor cells were co-cultured with human PBMCs. Cytokine protein levels in the supernatant were then probed by ELISA.
[0110] Complement activation modulated immune cell attack assay
[0111] Complement activation-regulated immune cell attack (CARIA) was analyzed as previously described (62). Briefly, we constructed a pCDH-CMV-nanoluciferase (NLuc)-EFl-puromycin lentiviral vector and stably expressed NLuc in tumor cells. NLuc activity reflecting CARIA (specific lysis) or without (basal NLuc activity) 0.25% Triton X-100 treatment was determined using Nano-Glo Luciferase Reporter Assay System (N1130, Promega, Madison, WI) under experimental conditions (experimental NLuc activity) or under (maximal NLuc) conditions. Tumor cells were co-cultured with human PBMCs. The percentage of CARIA (specific lysis) was calculated using the following equation: specific lysis (%) = 100 x (experimental NLuc activity - basal NLuc activity) / (maximal NLuc activity - basal NLuc activity).
[0112] Cell viability assay
[0113] Cell viability was determined using [3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium inner salt assay; MTS was performed according to the manufacturer's instructions (G5421, Promega, Madison, WI). Tumor cells were co-cultured with human PBMCs. The percentage of viable cells was calculated using the following equation: viable tumor cells (%) = 100 x ((experimental absorbance - absorbance of non-co-cultured PBMCs) / absorbance of non-co-cultured tumor cells).
[0114] Preparation of primary human macrophages
[0115] Enriched monocytes were obtained from isolated PBMCs by magnetic activated cell sorting (MACS) and selection using anti-CD14 antibody-coated Dynabeads. Monocytes were differentiated into macrophages (M0) in the presence of 80 ng / ml M-CSF for 4 days in RPMI 1640 medium supplemented with 2 mM L-glutamine, 10% (v / v) human serum; M0 macrophages were polarized into Ml macrophages for 48 hours with LPS (100 ng / ml) and IFN-g (20 ng / ml), or into M2 macrophages for 48 hours with IL-4 (20 ng / ml). Unless otherwise specified, all in vitro phagocytosis assays were performed using Ml macrophages. Macrophages were harvested using TrypLE Express.
[0116] Flow cytometry-based phagocytosis assay
[0117] All in vitro phagocytosis assays were performed by co-culturing GFP-expressing tumor cells with donor-derived macrophages at a 1 : 1 macrophage:tumor cell ratio in ultra-low attachment 96-well U-bottom plates in serum-free IMDM for 1-2 hours at 37°C in a humidified incubator containing 5% CO2. GFP-expressing tumor cells were collected from the plates using TrypLE Express, incubated with DMEM media supplemented with 25% v / v human serum and 25 pg / ml lepirudin (10% FBS) for 3 hours at 37°C, and washed prior to co-culture. For all assays, M1 macrophages were collected from the plates using TrypLE Express. Following co-culture, plates were placed on ice to stop the phagocytosis assay; samples were centrifuged at 400g for 5 minutes at 4°C and human macrophages were identified with A647-labeled anti-CD11b staining. Samples were analyzed by flow cytometry on a LRS Fortessa analyzer (BD Biosciences) or a CytoFLEX system (Beckman), both using high-throughput auto samplers. Phagocytosis was measured as the number of CD11b+GFP+ macrophages, quantified as a percentage of the total number of CD11b+ macrophages. Each phagocytic reaction (with independent donors and experimental groups) was performed at least in triplicate. To account for the innate variability in the original phagocytic levels of donor-derived macrophages, phagocytosis was normalized to the highest technical replicate for each donor. All biological replicates correspond to independent human macrophage donors.
[0118] Live cell microscopy-based phagocytosis assay
[0119] Live-cell microscopy-based phagocytosis assays were performed as previously described (88). Briefly, tumor cells were harvested using TrypLE Express, labeled with pHrodo Red succinimidyl ester (dilution 1 :30,000) in PBS for 1 h at 37 °C according to the manufacturer’s instructions, and then washed twice with DMEM containing 10% FBS and 100 U / ml penicillin / streptomycin. Tumor cells were then incubated with DMEM medium (10% FBS) supplemented with 25% v / v human serum and 25 pg / ml lepirudin for 3 h at 37 °C. Donor-derived macrophages were harvested using TrypLE Express and added to a clear plate and allowed to adhere for 1 h at 37 °C. Then, pHrodo Red-labeled tumor cells (macrophage:tumor cell ratio of 1 : 1) in serum-free IMDM were added to the plate. The plate was centrifuged at 50 g for 2 min to force the tumor cells close to the adherent macrophages. Then, the phagocytosis assay plate was placed in an incubator at 37 °C and imaged using IncuCyte (Essen). These images were acquired using a 20x objective with 800 ms exposure per field. Phagocytosis events were calculated as the number of pHrodo Red+events per well, and these values were normalized to the maximum number of events across technical replicates. The threshold for identifying pHrodo Red+events was set based on intensity measurements of pHrodo Red-labeled cells without macrophages.
[0120] Development of humanized mice
[0121] NOG-EXL (NOD.Cg-Prkdcscidll2rgtm1SugTg(SV40 / HTLV-IL3, CSF2)10-7Jic / JicTac) (13395) mice (6-12 weeks of age) were purchased from Taconic Biosciences. Humanized mice engrafted with human CD34+ hematopoietic stem cells (HSCs) were developed according to previous studies. Briefly, cryopreserved human umbilical cord blood-derived CD34+ cells (StemExpress, Folsom, CA) were thawed in a 37 °C incubator and prepared for transplantation according to the manufacturer’s instructions. Then, 3-5 x 104 HSCs were transplanted intravenously into NOG-EXL mice (MBR-1520R-4, Hitachi Power Solutions Co., Ltd., Ibaraki, Japan) that received 1.5 Gy of whole-body X-ray irradiation 1 day before transplantation. After 8-10 weeks of HSC transplantation, the chimerism of human leukocytes (frequency of human CD45+ cells among total PBMCs) was determined by flow cytometry. Mice with >25% chimerism of engrafted human CD45+ cells in the total PBMC population were used for animal studies.
[0122] Animal studies
[0123] Female “615” mice were purchased from Tianjin Blood Research Institute. Female 5-7 week old C57B1 / 6 mice were purchased from Beijing Vital River Laboratory Animal Technology Co. Ltd. All mice were housed in specific pathogen-free conditions, provided with standard chow, and allowed free access to weakly acidic hypochlorous acid water in a 12:12 light / dark cycle with lights on at 8:00 am. The temperature was maintained at 22 °C (20-26 °C) and the humidity was 45% (40-60%). The design and procedures of animal studies were approved by the Institutional Animal Care and Use Committee (IACUC) of the National Cancer Center / National Clinical Medical Center for Cancer / Cancer Hospital, Chinese Academy of Medical Sciences, Peking Union Medical College.
[0124] LA795 cells (1.0 x 10 6 ) were resuspended in Hanks’ balanced salt solution (Gibco) and injected subcutaneously into the right side of “615” mice to examine tumor size and mouse survival. Tumors were excised 23 days after tumor cell inoculation.
[0125] MC38 cells (3.0 x 10 6 ) were resuspended in Hanks’ balanced salt solution (Gibco) and injected subcutaneously into the right flank of C57B1 / 6 mice to examine tumor size. Tumors were excised 20 days after tumor cell inoculation.
[0126] A mouse model of C3 and C5 depletion was established in “615” mice by expressing mouse C3 shRNA and C5 shRNA using an AAV8 delivery system (90). Briefly, adeno-associated virus 8 (AAV8) expressing non-targeting shRNA (AAV8-shControl) or C3 shRNA and C5 shRNA (AAV8-C3 / C5 shRNA) (VectorBuilder, Guangzhou, China) were produced in HEK293T cells. The virus was injected into mice at an amount of 2 x 1011 12 copies (cp) / kg through the tail vein. Four weeks after virus injection, mice were sacrificed for analysis or received subcutaneous injection of mouse NSCLC LA795 cells (1 x 10 6 ) with or without EGFRL858R expression. Tumors were excised 17 days after injection.
[0127] H1395 or H322M cells (4.0 x 10 6) resuspended in Hanks' balanced salt solution (Gibco) and injected subcutaneously into the right flank at day 0. Where indicated, 1.5 mL pooled human serum (samples from 5 healthy individuals mixed as a source of human complement system) was injected intraperitoneally (ip) every three days after tumor cell inoculation (91) humanized mice; anti-human PD-1 (100 pg per mouse, clone Jl 16, BE0188, BioXCell) or anti-human CD55 (100 pg per mouse, clone BRIC216, 9404, International Blood Group Reference Laboratory) and anti-human CD59 (100 pg per mouse, clone BRIC229, 9409, International Blood Group Reference Laboratory) antibodies or immunoglobulin G (IgG, 100 pg per mouse, clone MOPC-21, BE0083, BioXCell) were injected intraperitoneally into humanized mice at days 3, 6, 9, 12, 16, 20, 23 after tumor cell inoculation; XAV939 (30 mg / kg) was injected intraperitoneally into humanized mice once a day after tumor cell inoculation; humanized mice were treated with oral gavage with vehicle or the EGFR inhibitor gefitinib (80 mg / kg) 5 days per week after tumor formation (~120 mm3) to check tumor size or mouse survival.
[0128] From day 7 after inoculation, the size of all tumors was measured every 3-4 days. Measurements were performed manually by assessing the longest dimension (length (L)) and the longest perpendicular dimension (width (W)). Tumor volume was estimated according to the equation: (L x W 2 ) / 2. CO2 inhalation was used for euthanizing mice. Mice tumors were dissected, fixed in 4% formaldehyde and embedded in paraffin. For survival analysis, deaths were assigned to the number of days the primary tumor burden reached 2.5 cm and / or the score value of the animal condition was lower than the value allowed by the animal protocol. No statistical method was used to pre-determine the sample size. For all experiments, each group included at least six mice according to the available information on variability of the immune checkpoint blockade experiments. Animals arriving at the facility were randomly placed in cages, five mice per cage, and randomly grouped before treatment. During the experiment and the evaluation of the results, the researchers did not see the assignment.
[0129] Preparation of single cell suspensions from mouse tumor samples
[0130] Single cell suspensions of mouse solid tumor samples were obtained by mechanical dissociation using a straight razor and then enzymatically digested in 10 ml RPMI containing 10 pg / ml DNase I (Sigma-Aldrich) and 25 pg / ml Liberase (Sigma-Aldrich) for 30-60 min at 37°C with vigorous pipetting every 10 min to promote dissociation. After a maximum of 60 min, the dissociation reaction was quenched with cold 4°C RPMI containing 10% FBS, filtered through a 100 pm filter and centrifuged at 400g for 10 min at 4°C. Red blood cells in the sample were lysed by resuspending the tumor pellet in 5 ml ACK lysis buffer for 5 min at room temperature. The lysis reaction was quenched by adding 20 ml RPMI containing 10% FBS and the sample was centrifuged at 400g for 10 min at 4°C. The sample was analyzed directly or resuspended in BAMBANKER, aliquoted into cryotubes and frozen prior to subsequent analysis.
[0131] Isolation of tumor infiltrating leukocytes
[0132] Single cell suspensions of mouse tumor samples were obtained (as described above), frozen samples were thawed for 3-5 min at 37°C, washed with DMEM containing 10% FBS and centrifuged at 400g for 5 min at 4°C. Tumor infiltrating leukocytes were isolated by gradient centrifugation on 40-80% Percoll (P1644, Sigma-Aldrich).
[0133] Flow cytometry
[0134] Tumor infiltrating leukocytes or human PBMCs were stained with phycoerythrin (PE)-Cy7 labeled anti-mouse CD8a (clone 53-6.7) or PE-Cy7 labeled anti-human CD8 (clone HIT8a) antibodies. Dead cells were excluded using the Fixable Aqua Dead Cell Stain Kit. For intracellular staining, cells were stained with antibodies against cell surface markers for 30 min, fixed, permeabilized with the Fixation / Permeabilization Solution Kit and stained with APC anti-human / mouse granzyme B (clone QA16A02), PE anti-mouse perforin (clone S16009A) or PE anti-human perforin (clone B-D48) antibodies.
[0135] FACS and in vivo phagocytosis analysis of mouse tumor samples
[0136] Single-cell suspensions of mouse tumor samples were obtained (as described above), frozen samples were thawed at 37 °C for 3-5 min, washed with DMEM containing 10% FBS, and centrifuged at 400 g for 5 min at 4 °C. The samples were then resuspended in FACS buffer at a concentration of 1 million cells per milliliter and blocked with monoclonal CD16 / 32 antibody for 15 min on ice before staining with antibodies recognizing target proteins. Samples were stained for 30 min on ice, washed twice with FACS buffer, and resuspended in buffer containing 1 pg / ml DAPI before analysis. Fluorescence compensation was performed using single-stained UltraComp eBeads. Gating for immunolabeling and DAPI was performed using a fluorescence minus one control. Flow cytometry was performed on a FACSAria II cell sorter (BD Biosciences) or a LRS Fortessa analyzer (BD Biosciences). FACSDiva software was used for data collection. Flow cytometry data were analyzed using FlowJo V10. Phagocytosis was measured as the percentage of tumor-associated macrophages that were CD11b+F4 / 80+and also expressed GFP.
[0137] Patient tissue samples
[0138] Patient groups were randomly distributed by age and gender. The sample size was sufficient for statistical analysis. We retrospectively collected surgically resected, formalin-fixed, and paraffin-embedded NSCLC tissue samples (Beijing, China) from the Biobank of the National Cancer Center / National Clinical Medical Research Center / Cancer Hospital, Chinese Academy of Medical Sciences. Tissue samples from 200 patients who underwent surgery for pathologically diagnosed cancer between 2003 and 2014 were selected as an independent cohort, including 200 cases of lung adenocarcinoma (LUAD) and 200 pairs of adjacent normal specimens. All patients received standard treatment after surgery. From our previous clinical trial study (registration number: ChiCTR-OIC-17013726) (73), we recruited 24 NSCLC patients as another independent cohort, who all received two cycles of sintilimab (an anti-PD-1 antibody) and then underwent surgery for clinical response evaluation. Positron emission tomography-computed tomography was obtained at baseline and before surgery. Responses were assessed according to RECIST version 1.1. The use of human NSCLC specimens, database, and research protocol were approved by the Institutional Review Board of the National Cancer Center / National Clinical Medical Research Center / Cancer Hospital, Chinese Academy of Medical Sciences. All tissue samples were collected in accordance with the informed consent policy. All patients obtained written informed consent upon admission to use their tissues, blood, or other samples for scientific research and to protect patient privacy.
[0139] We obtained clinical data by reviewing patients' medical history. Pathological stage was assessed according to the American Joint Committee on Cancer / International Union Against Cancer TNM staging system, 8thedition (93).
[0140] Histological evaluation and immunohistochemical staining
[0141] Mouse tumor tissues were fixed and prepared for staining. Specimens were stained with Mayer's hematoxylin followed by eosin (H&E) (Biogenex Laboratories, San Ramon, CA). Slides were mounted using Universal Mount (Research Genetics, Huntsville, AL).
[0142] Tissue sections from paraffin-embedded human NSCLC specimens were stained with antibodies or LNA probes. These proteins were quantitatively scored in tissue sections according to the percentage of positive cells and staining intensity as defined previously. Likewise, we quantitatively scored LINC00973, MLINC00973, miR-216b and miR-150 by ISH in tissue sections. The following proportional scores were assigned: 0 if 0% of tumor cells were positively stained, 1 if positive cells ranged from 0% to 1%, 2 if positive cells ranged from 2% to 10%, 3 if positive cells ranged from 11% to 30%, 4 if positive cells ranged from 31% to 70%, and 5 if positive cells ranged from 71% to 100%. We also rated staining intensity on a scale of 0 to 3: 0, negative; 1, weak; 2, moderate; 3, strong. The proportional and intensity scores were combined to obtain a total score (ranging from 1 to 8) as previously described. Scores were compared to overall survival, defined as the time from the date of diagnosis to death or last known follow-up date.
[0143] Statistics and reproducibility
[0144] All statistical data are expressed as mean ± SD. All experiments were independently repeated at least three times with similar results. Significant differences in the means obtained in control and experimental groups were analyzed. Pairwise comparisons were made using a two-tailed t-test. P values less than 0.05 were considered significant. Experiments were not randomized, and the investigator did not assess whether the experimental conditions and results were evaluator-blinded unless otherwise noted.
[0145] The results obtained in the above experiments were analyzed as follows.
[0146] EGFR activation increases expression of CD55 and CD59 and inhibits complement system and CD8+ T cell activation
[0147] To determine whether EGFR activation modulates the expression of mCRPs, we treated H1395 and H322M NSCLC cells with EGF for 24 hours. Among others Figure 1 a is H1395 cells treated with or without EGF (100 ng / ml) for 24 hours. Immunoblot analysis was performed with the indicated antibodies. b-e shRNAs against CD55 and CD59 were expressed in H1395 cells. The indicated cells were treated with or without EGF (100 ng / ml) for 24 hours and then incubated with DMEM medium (10% FBS) supplemented with 25% v / v human serum and 25 μg / ml lepirudin for 3 hours. Tumor cell surface expression of C3b and C5b-9 in b was determined by flow cytometry with the indicated antibodies. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001. The amount of anaphylatoxins (C3a and C5a) in the supernatant was determined by ELISA in c. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001. Cells were co-cultured with human PBMCs in d. The expression of the indicated cytokines in the culture medium was examined. Data are presented as mean ± SD of seven independent experiments using different human donors; ns, not significant; ***P < 0.001. Cells were co-cultured with human PBMCs in e. The expression of granzyme B and perforin in CD8+ T cells was examined by flow cytometry with the indicated antibodies. Data are presented as mean ± SD of seven independent experiments using different human donors; ns, not significant; ***P < 0.001.
[0148] Figure 2Figure 6. CD55 and CD59 expression in H322M cells treated with EGF. a) Immunoblot analysis of H322M cells treated with or without EGF (100 ng / ml) for 24 h. Immunoblot analysis was performed with the indicated antibodies. b-e) shRNAs against CD55 and / or CD59 were expressed in H322M cells. The indicated cells were treated with or without EGF (100 ng / ml) for 24 h. The indicated cells were then incubated with or without 25% v / v human serum and 25 μg / ml lepirudin in DMEM medium (10% FBS) for 3 h. Representative results of C3b and C5b-9 expression on the tumor cell surface determined by flow cytometry with the indicated antibodies in B. c) Expression of C3b and C5b-9 on the tumor cell surface was determined by flow cytometry with the indicated antibodies. Data are presented as mean ± SD (n = 6). HS, human serum; ns, not significant; ***P < 0.001. d) The amount of anaphylatoxins (C3a and C5a) in the supernatant was determined by ELISA. Data are presented as mean ± SD (n = 6); HS, human serum; ns, not significant; ***P < 0.001. e) The cells were co-cultured with human PBMCs. The expression of the indicated cytokines in the culture medium was detected. Data are presented as mean ± SD of seven independent experiments using different human donors; HS, human serum; ns, not significant; ***P < 0.001. f) H1395 cells were treated with or without EGF (100 ng / ml) for 12 h. The relative expression levels of CFH, CFB, C3 and C5 mRNA were measured using quantitative PCR. Data are presented as mean ± SD (n = 6); ns, not significant. g) H1395 cells were treated with or without EGF (100 ng / ml) for 12 h. The expression levels of Factor H, Factor B, C3 and C5 in the cell culture supernatant were detected. Data are presented as mean ± SD (n = 6); ns, not significant. h) H1395 cells were treated with or without EGF (100 ng / ml) for 24 h, and then incubated with DMEM medium (10% FBS) supplemented with 25% v / v human serum and 25 μg / ml lepirudin for 3 h. After that, the cells were co-cultured with human PBMCs. The expression levels of granzyme B and perforin in CD8+ T cells were detected by flow cytometry with the indicated antibodies. Representative results are shown.
[0149] The results show that the expression of CD55 and CD59 was significantly enhanced, but not the expression of CD46 Figure 1 a) As expected, EGF treatment inhibited complement activation, which was reflected in the inhibition of C3b and C5b-9 (a marker of all-pathway activation) Figure 1 b; Figure 2 b and c), the release of anaphylatoxins C3a and C5a was reduced Figure 1 c, Figure 2d) and, secretion of IFN-g, TNF-a, IL-6, IL-1 b and IL-17 in co-culture with human peripheral blood mononuclear cells (PBMCs) is reduced Figure 1 d, Figure 2 e) This inhibition is abolished by combined depletion of CD55 and CD59 induced by respective shRNA expression Figure 1 b-d, Figure 2 c-e) which causes more C5b-9 deposition than depletion of CD55 or CD59 alone Figure 2 c right panel). Depletion of CD55 and CD59 and CD55 alone also significantly enhanced C3b deposition Figure 2 c left panel) and release of C3a and C5a Figure 2 d), indicating a role of CD55 in complement activation. Notably, depletion of CD55 and CD59 did not induce complement activation in the absence of human serum Figure 2 c-e). Moreover, EGF treatment did not change the expression levels of intracellular mRNA (Extended Data Fig Figure 2 f) or extracellular proteins Figure 2 g) of the complement inhibitors Factor H and Factor B or the complement proteins C3 and C5. These results indicate that EGFR activation in NSCLC cells suppresses complement activation by upregulating CD55 and CD59.
[0150] EGFR activation in tumor cells reduces expression of cytotoxic granules B (GzmB) and perforin (PFN) in CD8+ T cells and suppresses CD8+ T cell activation. Cytokines, such as IFN-g, TNF-a, IL-6, IL-1 b and IL-17, can be secreted by complement-mediated antigen presenting cells and CD4+ T cells (44) to maintain CD8+ T cell activity. To determine whether activation of EGFR in tumor cells modulates CD8+ T cell activity, we co-cultured EGF-treated or untreated H1395 cells with human PBMCs containing CD8+ T cells and showed that EGFR activation suppressed the activity of isolated CD8+ T cells, reflected in reduced expression of granzyme B and perforin Figure 1 e, Figure 2 h). This suppression was abolished by depletion of CD55 and CD59, which largely enhanced expression of granzyme B and perforin PFN Figure 1 e). These results strongly suggest that EGFR activation increases expression of CD55 and CD59, thereby suppressing the complement system, complement system-dependent cytokine secretion and subsequent CD8+ T cell activation.
[0151] EGFR activation upregulates CD55 and CD59 by inhibiting miR-216b and miR-150, respectively
[0152] To determine the mechanism by which EGFR activation induces increased expression of CD55 and CD59, we expressed luciferase reporter genes driven by the promoters of CD55 and CD59. Figure 3Hl 395 cells were treated with or without EGF (100 ng / ml) for 12 h. Relative expression levels of CD55 and CD59 mRNAs were measured using quantitative PCR. Data are presented as mean ± SD (n = 6); ***P < 0.001. b, f, h are immunoblot analyses performed with the indicated antibodies. Hl 395 cells were transfected with small interfering RNA (siRNA) against Dicer in B. Cells were then treated with or without EGF (100 ng / ml) for 24 h. In c, Hl 395 cells expressing the luciferase reporter were fused with the wild-type (WT) 3'UTR or the corresponding mutant (MUT) of CD55 and CD59 genes with miR-Control, miR-150-mimics or miR-216b mimics. The relative luciferase activity normalized to that in the miR-Control group is shown in cells expressing the luciferase reporter without the fused 3'UTR. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001. In d, Hl 395 cells expressing the luciferase reporter fused with the wild-type (WT) 3'UTR or the corresponding mutant (MUT) of CD55 and CD59 genes were transfected with miR-Control, miR-150-inhibitor or miR-216b-inhibitor. The relative luciferase activity normalized to that in the miR-Control group is shown in cells expressing the luciferase reporter without the fused 3'UTR. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001. In e, Hl 395 cells were transfected with miR-Control, miR-150-mimics or miR-216b-mimics. Cells were treated with or without EGF (100 ng / ml) for 12 h. Relative expression levels of CD55 and CD59 mRNAs were measured using quantitative PCR. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001. In f, Hl 395 cells were transfected with miR-Control, miR-150-mimics or miR-216b-mimics. Cells were treated with or without EGF (100 ng / ml) for 24 h. In g, Hl 395 cells were transfected with miR-Control, miR-150-inhibitor or miR-216b-inhibitor. Cells were treated with or without EGF (100 ng / ml) for 12 h. Relative expression levels of CD55 and CD59 mRNAs were measured using quantitative PCR. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001.H1395 cells were transfected with miR-Control, miR-150-inhibitor or miR-216b- inhibitor. Cells were treated with or without EGF (100 ng / ml) for 24 hours.
[0153] Figure 4In A, d, e, k, m, n, immunoblot analysis was performed with the indicated antibodies. In A, luciferase reporter driven by the promoters of CD55 and CD59 was co-transfected with EGFR-expressing vector into 293T cells. Cells were treated with or without EGF (100 ng / ml) for 8 hours. Luciferase activity was measured. Relative luciferase activity was normalized to the group without EGF treatment. Data are presented as mean ± SD (n = 6); ns, not significant. In B, H1395 cells were treated with or without EGF (100 ng / ml) for 12 hours. Relative RNA expression levels of CD55 and CD59 gene transcriptional introns were measured using quantitative PCR. Data are presented as mean ± SD (n = 4); ns, not significant. In C, H322M cells were treated with or without EGF (100 ng / ml) for 12 hours. Relative expression levels of CD55 and CD59 mRNA were measured using quantitative PCR. Data are presented as mean ± SD (n = 6); ***P < 0.001. In D, H1395 and H322M cells were transfected with or without one of two different small interfering RNAs (siRNAs) against Dicer. In E, H322M cells were transfected with small interfering RNA (siRNA) against Dicer. These cells were then treated with or without EGF (100 ng / ml) for 24 hours. In F, H1395 and H322M cells were transfected with siRNA against Dicer. Cells were then treated with or without EGF (100 ng / ml) for 12 hours. Relative expression levels of CD55 and CD59 mRNA were measured using quantitative PCR. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001. In G, miRNA encoding prediction algorithm (http: / / www.mircode.org / index.php) - predicted miRNAs on CD55 and CD59 mRNA and their target sequences. In H, H322M cells expressing luciferase reporter were fused with wild-type (WT) 3'UTR or the corresponding mutants (MUT) of CD55 and CD59 genes with or without transfection of miR-Control, miR-150-mimics or miR-216b mimics. Relative luciferase activity in cells expressing luciferase reporter without fusion of 3'UTR was shown, which was normalized to the relative luciferase activity in the miR-Control group. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001. In I, H322M cells expressing luciferase reporter were fused with wild-type (WT) 3'UTR or the corresponding mutants (MUT) of CD55 and CD59 genes with or without transfection of miR-Control, miR-150-inhibitor or miR-216b inhibitor.shows relative luciferase activity normalized to relative luciferase activity in miR-Control in cells expressing luciferase reporter without fusion 3'UTR. Data are presented as mean ± SD (n=6); ns, not significant; ***P<0.001. H322M cells were transfected with miR-Control, miR-150-mimics or miR-216b-mimics in j. Cells were treated with or without EGF (100 ng / ml) for 12 hours. Relative expression levels of mRNA of CD55 and CD59 genes were measured using quantitative PCR. Data are presented as mean ± SD (n=6); ns, not significant; ***P<0.001. H322M cells were transfected with miR-Control, miR-150-mimics or miR-216b-mimics in k. Cells were treated with or without EGF (100 ng / ml) for 24 hours. H322M cells were transfected with miR-Control, miR-150-inhibitor or miR-216b-inhibitor in 1. Cells were treated with or without EGF (100 ng / ml) for 12 hours. Relative expression levels of mRNA of CD55 and CD59 were measured using quantitative PCR. Data are presented as mean ± SD (n=6); ns, not significant; ***P<0.001. H322M cells were transfected with miR-Control, miR-150-inhibitor or miR-216b-inhibitor in m. Cells were treated with or without EGF (100 ng / ml) for 24 hours. H1395 and H322M cells were treated with or without EGF (100 ng / ml) for 24 hours in n, o. Immunoblot analysis was performed with indicated antibodies (n). Relative protein expression levels of c-Jun and SRCIN1 were measured. Data are presented as mean ± SD (n=3); ns, not significant (o).
[0154] Results show that EGF treatment did not change the activity of CD55 and CD59 promoters Figure 4 a) or the expression levels of CD55 and CD59 introns Figure 4 b) in H1395 cells, indicating that EGF-enhanced CD55 and CD59 expression is not regulated at the transcriptional level. Nonetheless, quantitative PCR analysis showed that EGF treatment increased the levels of CD55 and CD59 mRNA Figure 3 a). Given that mRNA expression can be regulated by microRNA (miRNA)-dependent regulation, we depleted Dicer Figure 4 d), a ribonuclease essential for miRNA biogenesis. We found that Dicer depletion increased the protein levels of CD55 and CD59 (Figure 3 b) and mRNA Figure 4 f) expression, and abrogated the effect of EGF on CD55 and CD59 expression Figure 3 b, Figure 4 e-f), indicating that EGF-induced upregulation of CD55 and CD59 expression is mediated by specific miRNAs that target CD55 and CD59 mRNA degradation.
[0155] Sequence analysis by miRNA code prediction algorithm (http: / / www.mircode.org / index.php) revealed that miR-216b-5p and miR-150-5p (subsequently miR-216b and miR-150 were used) have potential binding sites in the 3' untranslated region (UTR) of human CD55 and CD59 mRNA, respectively Figure 4 g). 3'UTR-luciferase reporter assay showed that luciferase activity was reduced in cells expressing the luciferase gene (fused to the wild type (WT) 3'UTR of CD55 and CD59 genes) due to endogenous expression of miR-216b and miR-150, respectively. However, this reduction was alleviated by the expression of mutants containing the substitution of AGAGAUU with GAGAGCC in the CD55 UTR and UGGGAG with CAAAGA in the CD59 UTR Figure 3 c). A similar alleviation was observed by the expression of inhibitors of miR-216b and miR-150, which are oligonucleotides complementary to miR-216b and miR-150, respectively Figure 3 d). Moreover, overexpression of miR-216b and miR-150 reduced luciferase activity of the luciferase gene (fused to the 3'UTR of CD55 and CD59 genes of WT, but not of mutants) Figure 3 c). In agreement with these findings, EGF-enhanced expression of CD55 and CD59 mRNA Figure 3 e) and protein Figure 3 f) was inhibited by overexpression of miR-216b and miR-150. Conversely, in H1395 Figure 3 g-h) and H322M cells, expression of miR-216b and miR-150 inhibitors increased CD55 and CD59 mRNA Figure 3 g) and protein Figure 3 h) expression. It has been shown that miR-150 and miR-216b regulate c-Jun and SRCIN1, respectively. However, EGF treatment did not change the expression levels of c-Jun or SRCIN1 (Extended Data Figure 4n-o), indicating that miR-216b and miR-150 differentially regulate the expression of the corresponding target proteins in the signaling context. These results indicate that EGFR activation upregulates the expression of CD55 and CD59, respectively, by inhibiting miR-216b and miR-150.
[0156] EGFR activation induces LINC00973 expression to sequester miR-216b and miR-150, while upregulating CD55 and CD59
[0157] Figure 5Figure 6. Identification of the binding sites of miR-216b and miR-150 on LINC00973. a, b, Schematic diagram of the binding sites of miR-216b and miR-150 on LINC00973. c, The 5' and 3' sequences of LINC00973 were obtained using the rapid amplification of cDNA ends (RACE). The PCR products amplified from the 5' and 3' sequences of LINC00973 and the known region of LINC00973 sequence were separated on agarose gel. The sizes of the sequences were indicated according to the sequencing results of the PCR products. d, The PCR products obtained using the primers of LINC00973 were sequenced. The full-length sequence of LINC00973 is shown. e, The expression levels of LINC00973 were determined using Gene Expression Profiling Interactive Analysis (GEPIA). LUAD, lung adenocarcinoma; TPM, transcripts per million; T, tumor; N, normal; num, number of samples. f, Total cell lysates and cytosol and nuclear fractions were prepared from H322M cells. RNA was extracted and purified from the cell fractions prepared from the same number of cells. The relative expression levels of ACTB (cytosol control), RNU6-1 (nuclear control) and LINC00973 RNA were measured using quantitative PCR. Data are presented as mean ± SD (n = 6); ***P < 0.001. g, H322M cells were treated with or without EGF (100 ng / ml) for the indicated periods of time. The relative expression levels of LINC00973 RNA were measured using quantitative PCR. Data are presented as mean ± SD (n = 6); *P < 0.05, ***P < 0.001. h, RNA immunoprecipitation (RIP) plot of anti-GFP antibody for detecting miRNAs endogenously associated with LINC00973. i, MS2-GFP was co-transfected with MS12, MS12-LINC00973 or MS12-lncRNA-225205 into H322M cells. GFP-RIP and subsequent microRNA qRT-PCR were performed to detect lncRNA-associated microRNAs. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001. j, Schematic diagram showing the mutation of the binding sites of miR-216b and miR-150 on LINC00973. k, l, MS2-GFP was co-transfected with MS12, MS12-LINC00973, MS12-LINC00973-mut (miR-216b) (k), MS12-LINC00973-mut (miR-150) (l) or control MS12-lncRNA-225205 into H322M cells. GFP-RIP and subsequent microRNA qRT-PCR were performed to detect lncRNA-associated microRNAs. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001.m H322M cells were transfected with biotin-conjugated LINC00973 or IncRNA-225205, followed by a streptavidin pulldown assay and subsequent microRNA qRT-PCR to detect the associated endogenous microRNAs. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001. n, o H322M cells were transfected with biotin-conjugated LINC00973, LINC00973-mut (miR-216b) (n), LINC00973-mut (miR-150) (o), or control IncRNA-225205, followed by a streptavidin pulldown assay and subsequent microRNA qRT-PCR to detect the associated endogenous microRNAs. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001.
[0158] Figure 6In particular, a is H1395 cells were treated with or without EGF (100 ng / ml) for 7 hours. Fluorescence in situ hybridization (FISH) assay was performed using probes against LINC00973 (left panel). The proportion of LINC00973 distribution in the nucleus and cytosol was calculated. ***P < 0.001 (right panel). B is total cell lysate and cytosolic and nuclear fractions were prepared from H1395 cells. RNA was extracted and purified from cell fractions prepared from the same number of cells. Relative expression levels of ACTB (cytosolic control), RNU6-1 (nuclear control) and LINC00973 RNA were measured using quantitative PCR. Data are presented as mean ± SD (n = 6); ***P < 0.001. c is H1395 cells were treated with or without EGF (100 ng / ml) for the indicated time periods. Relative expression levels of LINC00973 RNA were measured using quantitative PCR. Data are presented as mean ± SD (n = 6). *P < 0.05, ***P < 0.001. d is MS2-GFP was co-transfected into H1395 cells with MS12, MS12-LINC00973 or MS12-lncRNA-225205. GFP-RIP followed by microRNA qRT-PCR was performed to detect lncRNA-associated microRNAs. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001. e, f MS2-GFP was co-transfected into H1395 cells with MS12, MS12-LINC00973, MS12-LINC00973-mut (miR-216b) (e), MS12-LINC00973-mut (miR-150) (f) or control MS12-lncRNA-225205, GFP-RIP followed by microRNA qRT-PCR was performed to detect lncRNA-associated microRNAs. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001. g is H1395 cells were transfected with biotin-conjugated LINC00973 or lncRNA-225205, followed by streptavidin pull-down assay and subsequent microRNA qRT-PCR to detect associated endogenous microRNAs. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001. h, i H1395 cells were transfected with biotin-conjugated LINC00973, LINC00973-mut (miR-216b) (h), LINC00973-mut (miR-150) (i) or control lncRNA-225205, followed by streptavidin pull-down assay and subsequent microRNA qRT-PCR to detect associated endogenous microRNAs.Data are expressed as mean ± SD (n = 6); ns, not significant; ***P < 0.001.
[0159] Figure 7H1395 and H322M cells expressing luciferase reporter were transfected with miR-Control, miR-150-mimics, or miR-216b-mimics. Relative luciferase activity normalized to that in miR-Control is shown. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001. b. H1395 and H322M cells were transfected with miR-Control, miR-150-mimics, or miR-216b-mimics. Relative expression levels of LINC00973 RNA were measured using quantitative PCR. Data are presented as mean ± SD (n = 6); ns, not significant. c. H1395 and H322M cells were transfected with miR-Control, miR-150-mimics, or miR-216b-mimics, followed by RIP and subsequent lncRNA qRT-PCR using an antibody against Ago2 to detect the indicated microRNA-associated lncRNAs. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001. d. H1395 and H322M cells were transfected with LINC00973, LINC00973-mut(miR-216b), LINC00973-mut(miR-150), or lncRNA-225205. Relative expression levels of LINC00973 and lncRNA-225205 RNA were measured using quantitative PCR. Data are presented as mean ± SD (n = 6); ns, not significant; ***P < 0.001. e. H1395 and H322M cells were transfected with LINC00973, LINC00973-mut(miR-216b), LINC00973-mut(miR-150), or lncRNA-225205. Total RNA was extracted from the cells. Relative expression levels of miR-216b or miR-150 miRNAs were measured using quantitative PCR. Data are presented as mean ± SD (n = 6); ns, not significant; **P < 0.01; ***P < 0.001. f. H1395 and H322M cells were treated with or without EGF (100 ng / ml) for 12 h. Total RNA was extracted from the cells. Copy numbers of LINC00973, miR-216b, and miR-150 in the indicated cells were quantified using quantitative PCR. Data are presented as mean ± SD (n = 6). ***P < 0.001.Copy numbers of LINC00973, miR-216b and miR-150 in H1395 cells treated with EGF for 0h, 2h, 4h, 6h and 8h were determined in g. Stoichiometry of LINC00973 binding to miR-216b and miR-150 was calculated. In h, H1395 and H322M cells were stably transfected with or without LINC00973 shRNA. Cells were treated with or without EGF (100 ng / ml) for 12 hours. Relative expression levels of LINC00973 RNA were measured using quantitative PCR. Data are presented as mean ± SD (n = 6); ns, not significant; **P < 0.01; ***P < 0.001. In i, H1395 and H322M cells were stably transfected with or without LINC00973 shRNA. Cells were treated with or without EGF (100 ng / ml) for 24 hours. Immunoblot analysis was performed with the indicated antibodies. j, k show a schematic representation of miR-216 and miR-150 binding element (miR-216b / 150-BE) on LINC00973. Genomic DNA was extracted from parental H1395 (j) and H322M (k) cells and two individual clones of H1395 (j) and H322M (k) cells with miR-216b / 150-BE knock-in mutation. PCR products were amplified from the indicated DNA fragments and separated on agarose gel. C1, clone 1; C2, clone 2. Sequencing data of parental H1395 (j) and H322M (k) and two individual clones of H1395 (j) and H322M (k) cells with miR-216b / 150-BE knock-in mutation are shown. Red lines with arrows indicate sgRNA targeting sequences. Red lines without arrows indicate protospacer adjacent motifs (PAMs). Mutated nucleotides are indicated with blue arrows. Positions of miR-216b / 150-BE with or without mutated nucleotides are indicated by solid red boxes. Silent mutations of the indicated nucleotides were introduced into the sequences to avoid repeated cleavage by Cas9. In l, relative expression levels of CD55 and CD59 mRNAs in parental H1395 and H322M cells and the indicated clones of H1395 and H322M cells with miR-216b / 150-BE knock-in mutation were measured using quantitative PCR. Data are presented as mean ± SD (n = 6); ***P < 0.001. WT, wild type; C1, clone 1; C2, clone 2. In m, immunoblot analysis was performed with the indicated antibodies in the indicated cells.
[0160] Long non-coding RNAs (lncRNAs) regulate their downstream targets by competitively binding to common microRNAs, functioning as competitive endogenous RNAs (ceRNAs) and miRNAs. Analysis of the recognition sequences for miR-216b and miR-150 using the miRcode prediction algorithm revealed that LINC00973 is the only lncRNA containing both one and two target sequences for miR-216b and miR-150, respectively. Figure 5 ab). Rapid amplification of cDNA ends (RACE) results revealed the full-length transcribed sequence of gene LINC00973 (ab). Figure 5 The CD (database name) is 2039 nt in length and includes 2 exons and 1 intron (http: / / asia.ensembl.org / index.html). Analysis of the TCGA and genotype tissue expression (GTEx) databases using gene expression profile interaction analysis (GEPIA) showed that LINC00973 expression in human lung adenocarcinoma specimens was significantly higher than in adjacent healthy lung tissue. Figure 5 e). Fluorescence in situ hybridization (FISH) analysis of H1395 cells showed that LINC00973 was located in the cytosol and nucleus. Figure 6 a), and this distribution is achieved through H1395 ( Figure 6 b) Cell grading analysis within the cells further confirmed this. Furthermore, EGF treatment did not significantly alter the localization of LINC00973. Figure 6 a).
[0161] Notably, EGF treatment in H1395 and H322M cells enhanced the expression of LINC00973 in a time-dependent manner. Figure 6 c). We then performed RNA immunoprecipitation (RIP) on lysates of H1395 and H322M cells co-expressing the MS2-GFP fusion protein with either LINC00973 or the control lncRNA-225205, which did not contain miR-216b or miR-150 binding sites (5 h). Subsequent qPCR analysis showed that only LINC00973 was associated with miR-216b and miR-150. Figure 6 d, Figure 5 i), and this association is defined by LINC00973 for miR-216b ( Figure 6 e) or miR-150 ( Figure 6 f) Mutations in the binding sequence ( Figure 5 j) Elimination. Similar results were obtained using a pull-down assay with biotin-conjugated WT or mutant LINC00973 and control lncRNA-225205. Figure 6g-i). These results indicate that EGFR activation enhances the expression of LINC00973 binding to miR-216b and miR-150.
[0162] To further confirm that LINC00973 binds to miR-216b and miR-150, we fused the luciferase gene with the first 200 5' nucleotides of LINC00973 (Luc-973) with or without LINC00973 (WT or mutant containing the binding sequence of miR-216b and miR-150). We examined whether the expression of miR-216b and miR-150 could reduce the luciferase activity by degrading the mRNA of the fusion gene. We found that the luciferase activity of H1395 and H322M cells expressing the luciferase gene fused with WT LINC00973 was reduced. This decrease was exacerbated by the overexpression of miR-216b and miR-150 Figure 7 a), which did not change the level of endogenously expressed LINC00973 Figure 7 b). Notably, the expression of LINC00973 with mutations in the miR-216b or miR-150 binding sites abolished the inhibitory effect induced by the overexpression of miR-216b or miR-150, respectively Figure 7 a). The interaction between LINC00973 and miR-216b / miR-150 was further confirmed by RNP immunoprecipitation (RIP) analysis using an Ago2 antibody known to associate with microRNAs. We found that endogenous LINC00973 but not IncRNA-225205 was specifically enriched under the condition of miR-216b and miR-150 overexpression in H1395 and H322M cells Figure 7 c). Moreover, the overexpression of LINC00973 Figure 7 d) reduced the levels of free miR-216b and free miR-150 Figure 7 e). These results indicate that LINC00973 binds to miR-216b and miR-150.
[0163] To quantify the copy number of LINC00973, miR-216b and miR-150 in cells, we performed qPCR and showed that H1395 and H322M cells express approximately 80 copies of LINC00973 and 150 copies of miR-216b and miR-150. However, EGF treatment significantly increased the copy number of LINC00973 and reduced the expression of miR-216b and miR-150 (Extended Data Figure 4f), indicating that upregulated LINC00973 is sufficient to sequester miR-216b and miR-150. Stoichiometric analysis indicated that the binding ratio of LINC00973 to miR-216b and miR-150 was 1 :0.856:1.314 in H1395 cells treated with EGF for 8 hours Figure 7 g). Notably, depletion of LINC00973 Figure 7 h) reduced basal and EGF-upregulated levels of CD55 and CD59 in H1395 and H322M cells Figure 7 i). Furthermore, we used CRISPR / Cas9 genome editing knock-in technology (53) in H1395 cells Figure 7 j) to mutate the miR-216b and miR-150 binding nucleotides in LINC00973 (miR-216b / 150-BE) Figure 5 k). We found that knock-in expression of miR-216b / 150-BE mutants reduced mRNA Figure 7 l) and protein Figure 7 m) expression of CD55 and CD59. These results strongly suggest that EGFR activation induces LINC00973 expression to sequester miR-216b and miR-150, while upregulating CD55 and CD59.
[0164] EGFR activation-induced β-catenin transactivation enhances LINC00973 expression and subsequent upregulation of CD55 and CD59
[0165] To determine the mechanism by which EGF enhances LINC00973 expression, we analyzed the promoter region of LINC00973. Figure 8Figure 6. LINC00973 is a direct target of LEF / TCF. a, Schematic diagram showing three potential LEF / TCF binding elements (TBEs; CTTTG(A / T)(A / T)) in the promoter region of LINC00973. b, c, Genomic DNA was extracted from parental H1395 (b) and H322M (c) cells and two individual clones of H1395 (b) and H322M (c) cells with knock-in mutations (AT to GC) in the three TBEs. PCR products were amplified from the indicated DNA fragments and separated on agarose gels. CI, Clone 1; C2, Clone 2. Sequencing data of parental H1395 (b) and H322M (c) cells and two individual clones of H1395 (b) and H322M (c) cells with knock-in mutations (AT to GC) in the three TBEs are shown. The arrowed red lines indicate sgRNA targeting sequences. The red lines without arrows indicate protospacer adjacent motifs (PAMs). Mutated nucleotides are indicated by black arrows. The three TBEs with or without mutated nucleotides are indicated by solid red boxes. Silent mutations of the indicated nucleotides were introduced into the sequences to avoid repeated cleavage by Cas9. d, Parental H1395 and H322M cells and the indicated clones of H1395 and H322M cells with knock-in mutations (AT to GC) in TBE1 and TBE3 of the LINC00973 promoter were stimulated with or without EGF (100 ng / ml) for 12 h. The relative expression levels of LINC00973 RNA were measured using quantitative PCR. Data are presented as mean ± SD (n = 6); ***P < 0.001. CI, Clone 1; C2, Clone 2. e, f, H322M cells were stably transfected with or without β-catenin shRNA and then recombined with the indicated RNA interference (RNAi)-resistant (r) β-catenin (rβ-catenin) or transfected with or without miR-216b inhibitor (e) or miR-150 inhibitor (f). These cells were treated with or without EGF (100 ng / ml) for 24 h. Immunoblotting analysis was performed with the indicated antibodies. g, h, H322M cells were stably transfected with or without LINC00973 shRNA#1 or LINC00973 shRNA#2 and then transfected with or without miR-216b inhibitor (g) or miR-150 inhibitor (h). These cells were treated with or without EGF (100 ng / ml) for 24 h. Immunoblotting analysis was performed with the indicated antibodies. i, Parental H1395 and H322M cells and the indicated clones of H1395 and H322M cells with knock-in mutations (AT to GC) in TBE1 and TBE3 were stimulated with or without EGF (100 ng / ml) for 24 h. Immunoblotting analysis was performed with the indicated antibodies. CI, Clone 1; C2, Clone 2.j, k are parental Hl 395 or H322M cells with or without knock-in mutation (AT to GC) in TBE2 of LINC00973 promoter trans fected with or without miR-216b (j) or miR-150 (k) inhibitors. Cells were treated with or without EGF (100 ng / ml) for 24 hours. Immunoblot analysis was performed with indicated antibodies. C2, clone 2. 1 is EGFRL858R stably expressed in Hl 395 or H322M cells with or without knock-in mutation (AT to GC) in TBE2 of LINC00973 promoter. β-catenin shRNA was expressed in these cells followed by recombination expression of RNA interference (RNAi) resistant (r) β-catenin (rβ-catenin) or LINC00973 shRNA. Immunoblot analysis was performed with indicated antibodies. m, n are EGFRL858R stably expressed in Hl 395 or H322M cells. These cells were then transfected with or without miR-216b mimic (m) or miR-150 mimic (n). Immunoblot analysis was performed with indicated antibodies. o is Hl 395 cells treated with or without Wnt-7B or Wnt-5A (200 ng / ml) for 12 hours. Relative RNA expression level of LINC00973 and relative expression level of CD55 and CD59 mRNAs were measured using quantitative PCR. Data are presented as mean ± SD (n = 6). ns, not significant; ***P < 0.001. p is relative mRNA expression level of indicated Fzd receptors, LRP5 and LRP6 measured using quantitative PCR. Data are presented as mean ± SD (n = 4). q, Immunoblot analysis was performed with indicated antibodies. r is Hl 395 cells treated with or without Wnt-7B (200 ng / ml) for 12 hours. Relative RNA expression level of LINC00973 and relative expression level of CD55 and CD59 mRNAs were measured using quantitative PCR. Data are presented as mean ± SD (n = 4); ns, not significant; **P < 0.01; ***P < 0.001.
[0166] Figure 9In particular, a is the relative luciferase activity normalized to the activity in the group without EGF treatment. Data are expressed as mean ± SD (n = 6). ns, not significant; ***P < 0.001. b is Hl 395 and H322M cells stably transfected with or without active β-catenin (deletion of β-catenin 1-89 aa). The relative expression level of LINC00973 RNA was measured using quantitative PCR. Data are expressed as mean ± SD (n = 6). ***P < 0.001. c is parental Hl 395 and H322M cells and indicated clones of Hl 395 and H322M cells with knock-in mutation (AT to GC) in TBE2 of LINC00973 promoter stimulated with or without EGF (100 ng / ml) for 12 hours. The relative expression level of LINC00973 RNA was measured using quantitative PCR. Data are expressed as mean ± SD (n = 6). ns, not significant; ***P < 0.001. CI, clone 1; C2, clone 2. d is parental Hl 395 and H322M cells and indicated clones of Hl 395 and H322M cells with knock-in mutation (AT to GC) in TBE2 of LINC00973 promoter stimulated with or without EGF (100 ng / ml) for 12 hours. ChIP analysis was performed using anti-β-catenin antibody or anti-TCF4 antibody. Scatter plots show the amount of immunoprecipitated DNA expressed as a percentage of total input DNA. Data are expressed as mean ± SD (n = 6). ns, not significant; ***P < 0.001. CI, clone 1; C2, clone 2. e is purified bacterially expressed GST or GST-TCF4 on glutathione sepharose beads and incubated with indicated probes or antibodies. EMSA assessed the association of biotin-labeled or unlabeled oligonucleotides containing WT TBE2 or mutant TBE2 of LINC00973 promoter with purified GST or GST-TCF4. f, g are Hl 395 cells stably transfected with or without β-catenin shRNA and then transfected with expression of indicated RNA interference (RNAi) resistant (r) β-catenin (rβ-catenin) recombinant or in the presence or absence of miR-216b inhibitor (f) or miR-150 inhibitor (g). Cells were treated with or without EGF (100 ng / ml) for 24 hours. Immunoblot analysis was performed with indicated antibodies.H, i H1395 cells were stably transfected with or without LINC00973 shRNA#1 or LINC00973 shRNA#2, then transfected with or without miR-216b inhibitor (h) or miR-150 inhibitor (i). Cells were treated with or without EGF (100 ng / ml) for 24 hours. Immunoblot analysis was performed with the indicated antibodies. j, k H1395 and H322M cells with knock-in mutation (AT to GC) in TBE2 of LINC00973 promoter were transfected with or without miR-216b inhibitor (j) or miR-150 inhibitor (k). The indicated cells were treated with or without EGF (100 ng / ml) for 24 hours. Immunoblot analysis was performed with the indicated antibodies.
[0167] It was found that this region contains three common LEF / TCF binding elements (TBE; CTTTG(A / T)(A / T)) ( Figure 8 a) Previous reports indicated that EGFR activation leads to LEF / TCF activation mediated by β-catenin. Luciferase reporter assay in H1395 and H322M cells indicated that EGF treatment significantly induced luciferase activity driven by LINC00973 promoter, and this activity was further enhanced by overexpression of β-catenin or TCF-4, and inhibited by expression of truncated and inactive TCF-4 mutants ( Figure 9 a) In addition, overexpression of active β-catenin (deletion of 1-89 amino acids) increased the expression level of endogenous LINC00973 ( Figure 9 b) These results strongly suggest that β-catenin / LEF / TCF activation induced by EGFR activation enhances the expression of LINC00973.
[0168] To determine the key TBEs of LINC00973 responsible for β-catenin regulation, we used CRISPR / Cas9 knock-in technology to mutate AT to GC in TBE1-3 in H1395 and H322M cells ( Figure 8 b-c) Only TBE2 mutation reduced the basal and EGF-induced LINC00973 expression ( Figure 9 c, Figure 8 d) Chromatin immunoprecipitation (ChIP) analysis with anti-β-catenin or anti-TCF4 antibodies showed that EGF treatment induced the binding of β-catenin or TCF4 to the WT promoter of LINC00973, but not to the promoter with TBE2 mutation ( Figure 9d). Moreover, electrophoretic mobility shift assay (EMSA) showed that biotin-labeled oligonucleotides containing WT but not mutated TBE2 of LINC00973 were able to bind to TCF4 Figure 9 e). This association was reduced by unlabelled WT but not TBE2 mutated oligonucleotides and recognized by anti-TCF4 antibody, which resulted in a shift in mobility in the gel. These results indicate that the beta-catenin / LEF / TCF complex binds to TBE2 of LINC00973 promoter to respond to EGFR activation and induce LINC00973 expression.
[0169] Depletion of beta-catenin in H1395 and H322M cells inhibited EGF-induced CD55 Figure 9 f, and CD59 Figure 9 g); this inhibition was relieved by expression of inhibitors of WT beta-catenin and miR-216b Figure 9 f) and miR-150 Figure 9 g). Similarly, LINC00973 depletion inhibited EGF-induced CD55 Figure 9 h) and CD59 Figure 9 i) expression was abolished by expression of inhibitors of miR-216b Figure 9 h) and miR-150 Figure 9 i). As expected, TBE2 Figure 9 j, k), but not TBE1 or TBE3 Figure 8 i), mutation knock-in expression blocked EGF-induced CD55 Figure 9 j) and CD59 Figure 9 k) expression and this effect was abolished by expression of inhibitors of miR-216b Figure 9 j) and miR-150 Figure 9 k), respectively. Moreover, EGF R L858R, which occurs predominantly in NSCLC, caused an increase in CD55 and CD59 levels in H1395 and H322M cells and this increase was inhibited by beta-catenin depletion or LINC00973 depletion, by TBE2 mutation knock-in LINC00973 Figure 8 l), by expression of miR-216b Figure 8 m) or miR-150 Figure 8 n). These results indicate that EGF-induced beta-catenin transactivation enhances LINC00973 expression, leading to upregulation of CD55 and CD59, respectively, by sequestering miR-216b and miR-150.
[0170] It is well known that β-catenin can be activated by WNT signaling. It has been previously shown that human lung adenocarcinoma cells mainly express Wnt-5A and Wnt-7B. Treatment of H1395 cells with these Wnt ligands showed that Wnt-7B but not Wnt-5A enhanced the expression of LINC00973, CD55 and CD59 Figure 8 o). Moreover, quantitative PCR analysis of 10 Fzd receptors, LRP5 and LRP6 showed that Fzd6 was highly expressed in H1395 cells Figure 8 p). Depletion of Frizzled6 Figure 8 q) decreased Wnt-7B-induced expression of LINC00973, CD55 and CD59 Figure 8 r). These results indicate that, similarly to EGFR activation, Wnt signaling induces LINC00973 upregulation mediated by ββ-catenin transactivation, CD55 and CD59 in a Frizzled6-dependent manner.
[0171] EGFR / β-catenin activation mediates CD55 and CD59 inhibition of complement activation by upregulating miR-216b and miR-150 adsorbed by LINC00973
[0172] We next examined the effect of upregulated CD55 and CD59 by EGFR-β-catenin-LINC00973-miR-216b / miR-150 signaling on complement activation. Figure 10In particular, a-c are H 1395 cells with or without β-catenin shRNA expression stimulated with or without EGF (100 ng / ml) for 24 hours or H 1395 cells with knock-in mutation (AT to GC) in the TBE2 of the LINC00973 promoter. d-f are miR-216b-mimics, miR-150-mimics, miR-216b-inhibitor, miR-150-inhibitor or shRNAs against CD55 and CD59 expressed in H 1395 cells. These cells and the corresponding parental cells were treated with or without EGF (100 ng / ml) for 24 hours. a, d are H 1395 cells incubated with DMEM medium (10% FBS) supplemented with 25% human serum and 25 μg / ml lepirudin for 3 h. The expression of C3b and C5b-9 on the tumor cell surface was determined by flow cytometry with the indicated antibodies. Grey indicates the isotype control. Data are expressed as mean ± SD (n=6); ns, not significant; ***P<0.001. CI, clone 1; C2, clone 2. b, e are H 1395 cells incubated with DMEM medium (10% FBS) supplemented with 25% v / v human serum and 25 μg / ml lepirudin for 3 hours. Anaphylatoxins (C3a and C5a) in the supernatant were determined by ELISA. Data are expressed as mean ± SD (n=6); ns, not significant; ***P<0.001. CI, clone 1; C2, clone 2. c, f are H 1395 cells co-cultured with human PBMCs. The expression of the indicated cytokines in the culture medium was detected. Data are expressed as mean ± SD of seven independent experiments using different human donors; ns, not significant; ***P<0.001. CI, clone 1; C2, clone 2.
[0173] Figure 11In particular, a-c are H322M cells expressing or not β-catenin shRNA in TBE2 of LINC00973 promoter or H322M cells with knock-in mutation (AT to GC) stimulated or not with EGF (100 ng / ml) for 24 hours. d-f are miR-216b-mimics, miR-150-mimics, miR-216b-inhibitor, miR-150-inhibitor or shRNA against CD55 and CD59 expressed in H322M (d-f) or H1395 (d, e) cells. Cells and corresponding parental cells were treated with or without EGF (100 ng / ml) for 24 hours. a, d are the indicated cells were incubated for 3 hours with DMEM medium (10% FBS) supplemented with 25% v / v human serum and 25 μg / ml lepirudin. C3b and C5b-9 expression on tumor cell surface was determined by flow cytometry with the indicated antibodies. Grey indicates isotype control. Data are expressed as mean ± SD (n = 6); ns, not significant; ***P < 0.001. CI, clone 1; C2, clone 2. b, e are the indicated cells were incubated for 3 hours with DMEM medium (10% FBS) supplemented with 25% v / v human serum and 25 μg / ml lepirudin. Anaphylatoxins (C3a and C5a) in the supernatant were determined by ELISA. Data are expressed as mean ± SD (n = 6); ns, not significant; ***P < 0.001. CI, clone 1; C2, clone 2. c, f indicated cells were co-cultured with human PBMCs. Expression of indicated cytokines was detected. Data are expressed as mean ± SD of seven independent experiments using different human donors. ns, not significant; ***P < 0.001. CI, clone 1; C2, clone 2. g-i are H1395 cells and EGFRL858R expressing cells with β-catenin shRNA expressed or not in TBE2 of LINC00973 promoter or knock-in mutation (AT to GC). j-l are H1395 cells and EGFRL858R expressing cells with knock-in mutation (AT to GC) or shRNA against CD55 and CD59 expressed in TBE2 of LINC00973 promoter. miR-216b-inhibitor and miR-150-inhibitor were expressed in indicated cells. g, j are the indicated cells were incubated for 3 hours with DMEM medium (10% FBS) supplemented with 25% v / v human serum and 25 μg / ml lepirudin. C3b and C5b-9 expression on tumor cell surface was determined by flow cytometry with the indicated antibodies. Grey indicates isotype control. Data are expressed as mean ± SD (n = 6); ns, not significant; ***P < 0.001. CI, clone 1; C2, clone 2.h, k Cells were incubated with DMEM medium (10% FBS) supplemented with 25% v / v human serum and 25 pg / ml lepirudin for 3 hours. Anaphylatoxins (C3a and C5a) were measured in the supernatant by ELISA. Data are expressed as mean ± SD (n = 6); ns, not significant; ***P < 0.001. CI, clone 1; C2, clone 2. i, 1 Cells were co-cultured with human PBMCs. Expression of the indicated cytokines was detected in the culture medium. Data are expressed as mean ± SD of seven independent experiments using different human donors; ns, not significant; ***P < 0.001. CI, clone 1; C2, clone 2.
[0174] We found that β-catenin knockdown and TBE2 mutant knock-in expression abrogated the EGF-induced suppression and triggered complement activation, reflected in enhanced deposition of C3b and C5b-9 on the tumor cell surface Figure 10 a), release of C3a and C5a Figure 10 b), and secretion of IFN-γ, TNF-α, IL-6, IL-1 β, and IL-17 Figure 10 c). Moreover, depletion of miR-216b or miR-150 reduced complement activation and abrogated EGF-induced complement modulation, whereas overexpression of miRNA-150 or miR-216b or depletion of CD55 and CD59 enhanced complement activation, which was resistant to EGF-dependent suppression Figure 10 d-f). Similar to EGF treatment, expression of EGFRL858R in H1395 cells exerted a similar inhibitory effect on complement activation, which was dependent on β-catenin and TBE2-mediated upregulation of LINC00973 Figure 11 g-i). This suppression was abrogated by depletion of CD55 and CD59, whereas depletion of miR-216b and miR-150 inhibited TBE2 mutant-enhanced complement activation Figure 11 j, Figure 11 k and Figure 11 l). These results indicate that EGF R activation-induced β-catenin transactivation in NSCLC cells suppresses complement activation through upregulation of CD55 and CD59 by LINC00973-adsorbed miR-216b and miR-150.
[0175] EGFR / β-catenin activation suppresses immune cell function through upregulation of CD55 and CD59
[0176] To determine the effect of complement activation by EGFR inhibition on immune cell-mediated tumor cell survival, we expressed nanoluciferase in H1395 and H322M cells, which were co-cultured with PBMCs in human serum.
[0177] Figure 12C1, clone 1; C2, clone 2. c, d, miR-216b-mimics, miR-150-mimics, miR-216b-inhibitor, miR-150-inhibitor or shRNAs against CD55 and CD59 were expressed in H1395 cells. These cells and the corresponding parental cells were treated with or without EGF (100 ng / ml) for 24 h. a, c, before treatment with or without EGF (100 ng / ml) for 24 h, the indicated cells were stably transfected with a nanoluciferase-expressing vector. These cells were co-cultured with human PBMCs. CARIA assay was performed using the nanoluciferase release method. Data are presented as mean ± SD of seven independent experiments using different human donors. ns, not significant; ***P < 0.001. C1, clone 1; C2, clone 2. b, d, the indicated cells were incubated for 3 h in DMEM medium (10% FBS) supplemented with 25% v / v human serum and 25 pg / ml lepirudin, then co-cultured with human PBMCs. MTS assay was performed. Data are presented as mean ± SD of seven independent experiments using different human donors; ns, not significant; ***P < 0.001. C1, clone 1; C2, clone 2. E, H1395 cells with or without expression of β-catenin shRNA in TBE2 of LINC00973 promoter or H1395 cells with knock-in mutation (AT to GC) were stimulated for 24 h with or without EGF (100 ng / ml). Representative images of live cell microscopy of phagocytosis of pHrodoRed+ tumor cells (t = 4 h) are shown; these images are representative of six donors and six experimental replicates (left panel). Normalized phagocytosis rate of the indicated tumor cells (n = 6 donors) is shown. Data are presented as mean ± SD of six independent experiments using different human donors; ns, not significant; ***P < 0.001 (right panel). F, miR-216b-mimics, miR-150-mimics, miR-216b-inhibitor, miR-150-inhibitor or shRNAs against CD55 and CD59 were expressed in H1395 cells. These cells and the corresponding parental cells were treated with or without EGF (100 ng / ml) for 24 h. Representative images of phagocytosis assay using pHrodoRed+ tumor cells (t = 4 h) are shown; these images are representative of six donors and six experimental replicates (left panel).Standardized phagocytosis rate of indicated tumor cells (n=6 donors). Data are presented as mean ± SD of six independent experiments using different human donors; ns, not significant; **P<0.01 (right panel). G is Hl 395 cells expressing or not expressing β-catenin shRNA or knock-in mutation (AT to GC) in TBE2 of LINC00973 promoter, stimulated or not with EGF (100 ng / ml) for 24 h. H is miR-216b-mimics and miR-150-mimics expressed in Hl 395 cells. These cells and corresponding parental cells were treated or not with EGF (100 ng / ml) for 24 h. g, h are indicated cells were incubated with DMEM medium (10% FBS) supplemented with 25% v / v human serum and 25 μg / ml lepirudin for 3 h, then co-cultured with human PBMCs. Expression of granzyme B and perforin in CD8+ T cells was detected by flow cytometry with indicated antibodies. Data are presented as mean ± SD of seven independent experiments using different human donors; ns, not significant; ***P<0.001. CI, clone 1; C2, clone 2. I Hl 395 cells were constructed expressing or not expressing shRNA against β-catenin or CD55 and CD59 or knock-in mutation (AT to GC) in TBE2 of LINC00973 promoter. Indicated cells were incubated with DMEM medium (10% FBS) supplemented with 25% v / v human serum and 25 μg / ml lepirudin for 3 h, then co-cultured with human PBMCs in medium with or without anti-CD8 monoclonal antibody. MTS assay was performed. Data are presented as mean ± SD of seven independent experiments using different human donors; ns, not significant; ***P<0.001. CI, clone 1.
[0178] Figure 13In particular, a, b are H322M cells expressing or not β-catenin shRNA in TBE2 of LINC00973 promoter or H322M cells with knock-in mutation (AT to GC) stimulated or not with EGF (100 ng / ml) for 24 h. c, d are miR-216b mimic, miR-150 mimic, miR-216b-inhibitor, miR-150-inhibitor or shRNA targeting CD55 and CD59 expressed in H322M cells. These cells and the corresponding parental cells were treated or not with EGF (100 ng / ml) for 24 h. e, f are H1395 cells and EGFR L858R expressing constructs expressing or not β-catenin shRNA in TBE2 of LINC00973 promoter or H1395 cells with knock-in mutation (AT to GC). g, h are H1395 cells and EGFR L858R expressing constructs expressing or not shRNA against CD55 and CD59 in TBE2 of LINC00973 promoter or H1395 cells with knock-in mutation (AT to GC). miR-216b inhibitor and miR-150 inhibitor were expressed in the indicated cells. In a, c, the indicated cells were stably transfected with a nanoluciferase expressing vector before treatment or not with EGF (100 ng / ml) for 24 h. Cells were then co-cultured with human PBMCs. CARIA assay was performed using the nanoluciferase release method. Data are presented as mean ± SD of seven independent experiments using different human donors. ns, not significant; ***P < 0.001. CI, clone 1; C2, clone 2. In b, d, the indicated cells were incubated with DMEM medium (10% FBS) supplemented with 25% v / v human serum and 25 pg / ml lepirudin for 3 h before co-culturing with human PBMCs. MTS assay was performed. Data are presented as mean ± SD of seven independent experiments using different human donors; ns, not significant; ***P < 0.001. CI, clone 1; C2, clone 2. In e, g, the indicated cells were stably transfected with a nanoluciferase expressing vector. Cells were then co-cultured with human PBMCs. CARIA assay was performed using the nanoluciferase release method. Data are presented as mean ± SD of seven independent experiments using different human donors. ns, not significant; ***P < 0.001. CI, clone 1; C2, clone 2. In f, h, the indicated cells were incubated with DMEM medium (10% FBS) supplemented with 25% v / v human serum and 25 pg / ml lepirudin for 3 h before co-culturing with human PBMCs. MTS assay was performed. Data are presented as mean ± SD of seven independent experiments using different human donors. ns, not significant; ***P < 0.001.C1, clone 1; C2, clone 2.
[0179] Figure 14M0, M1 and M2 macrophages against H1395 and H322M cells (n = 4 donors). Data are presented as mean ± SD of four independent experiments using different human donors. *P < 0.05; ***P < 0.001. b H322M cells with or without expression of β-catenin shRNA or H322M cells with a knock-in mutation (AT to GC) in TBE2 of the LINC00973 promoter were stimulated or not with EGF (100 ng / ml) for 24 h. CI, clone 1; C2, clone 2. Representative images of phagocytosis of pHrodoRed+ tumor cells (t = 4 h) were obtained by live cell microscopy; these images are representative of six donors and six experimental replicates (left panel). Normalized phagocytosis of the indicated tumor cells (n = 6 donors) is shown. Data are presented as mean ± SD of six independent experiments using different human donors. ns, not significant; ***P < 0.001 (right panel). C miR-216b-mimic, miR-150-mimic, miR-216b-inhibitor, miR-150-inhibitor or shRNA expression in H322M cells against CD55 and CD59. Cells and corresponding parental cells were treated with or without EGF (100 ng / ml) for 24 h. Representative images of phagocytosis of pHrodoRed+ tumor cells (t = 4 h) were obtained by live cell microscopy; these images are representative of six donors and six experimental replicates (left panel). Normalized phagocytosis of the indicated tumor cells (n = 6 donors) is shown. Data are presented as mean ± SD of six independent experiments using different human donors. ns, not significant; ***P < 0.001 (right panel). d Gating strategy for in vitro phagocytosis assay. After debris and doublets removal, phagocytosis was assessed as the frequency of ZombieViolet-CD11b+ FITC+ events normalized to all ZombieViolet-CD11b+ events. Numbers indicate the frequency of the previous gate out events. These graphs are representative of at least 12 experimental replicates. e H1395 cells and EGFR L858R expressing constructs were constructed expressing or not β-catenin shRNA or a knock-in mutation (AT to GC) in TBE2 of the LINC00973 promoter. CI, clone 1; C2, clone 2. Representative flow cytometry plots showing phagocytosis of H1395 cells. These graphs are representative of six donors. FITC, Fluorescein Isothiocyanate (left panel). Normalized phagocytosis of the indicated cells (n = 6 donors) is shown. Data are presented as mean ± SD of six independent experiments using different human donors. ns, not significant; **P < 0.01 (right panel).f Hl 395 cells and EGFR L858R expressing constructs were made expressing or not shRNAs against CD55 and CD59 or knock-in mutations (AT to GC) in TBE2 of LINC00973 promoter. miR-216b and miR-150 inhibitors were expressed in the indicated cells. Normalized phagocytosis rate of the indicated cells (n = 6 donors) is shown. Data are represented as mean ± SD of six independent experiments using different human donors. ns, not significant; **P < 0.01. CI, clone 1. g Hl 395 cells and EGFR L858R expressing constructs were made expressing or not shRNAs against β-catenin or knock-in mutations (AT to GC) in TBE2 of LINC00973 promoter. h miR-216b-mimics and miR-150-mimics were expressed in Hl 395 cells and cells expressing EGFR L858R. g, h Hl 395 cells were incubated with DMEM medium (10% FBS) supplemented with 25% v / v human serum and 25 pg / ml lepirudin for 3 h before co-culture with human PBMCs. Expression of granzyme B and perforin in CD8+ T cells was detected by flow cytometry with the indicated antibodies. Data are represented as mean ± SD of seven independent experiments using different human donors. ns, not significant; ***P < 0.001. CI, clone 1; C2, clone 2. i H322M cells were constructed expressing or not shRNAs against β-catenin, CD55 and CD59 or knock-in mutations (AT to GC) in TBE2 of LINC00973 promoter. The indicated cells were incubated with DMEM medium (10% FBS) supplemented with 25% v / v human serum and 25 pg / ml lepirudin for 3 h before co-culture with human PBMCs in medium with or without anti-CD8 monoclonal antibody for 30 h. MTS assay was performed. Data are represented as mean ± SD of seven independent experiments using different human donors. ns, not significant; ***P < 0.001. CI, clone 1.
[0180] Complement activation-regulated immune cell attack (CARIA) assay showed that EGF treatment inhibited complement activation-induced cytotoxicity, reflected by inhibition of nanoluciferase release from tumor cells Figure 12 a) and enhanced tumor cell survival Figure 12 b). This modulation was abrogated by β-catenin depletion or knock-in expression of TBE2 mutants of LINC00973, which greatly enhanced CARIA and tumor cell death Figure 12a-b). Similar enhancement was caused by overexpression of miRNA-150 and miR-216b or depletion of CD55 and CD59; conversely, depletion of miR-216b and miR-150 reduced CARIA and increased cell survival Figure 12 c-d). Remarkably, EGFR / p-catenin transactivation-regulated immune cell responses were summarized by expression of EGFR L858R in these cells Figure 13 e-f). Moreover, EGFR L858R-inhibited CARIA Figure 13 g) and cell death Figure 13 h) were abolished by depletion of CD55 and CD59, while depletion of miR-216b and miR-150 inhibited TBE2 mutant-enhanced CARIA and cell death Figure 13 g-h).
[0181] Complement activation generates C3b that coats the surface of pathogens and interacts with the complement receptor 3 (CR3 or macrophage 1 antigen) of macrophages to promote phagocytosis of pathogens by macrophages. We labeled tumor cell membranes with pHrodoRed succinimidyl ester, which does not emit fluorescence extracellularly in a neutral environment and presents red fluorescence in the acidic phagolysosomes of macrophages. Incubation of labeled tumor cells with non-activated (M0), pro-inflammatory / anti-tumor (M1) or anti-inflammatory / pro-tumor (M2) macrophages indicated that M1 macrophages phagocytosed tumor cells much more actively than M0 and M2 macrophages Figure 14 a). Remarkably, EGF treatment protected H1395 cells from M1 macrophage-mediated phagocytosis Figure 12 e). Deletion of p-catenin, knock-in expression of TBE2 mutants of LINC00973 Figure 12 e), overexpression of miRNA-150 and miR-216b or depletion of CD55 and CD59 Figure 12 f) abolished the EGF-induced inhibition and greatly enhanced macrophage phagocytosis. Conversely, depletion of miR-216b and miR-150 reduced phagocytosis Figure 12 f). Remarkably, phagocytosis of tumor cells expressing EGFR L858R was observed by FACS-based measurement Figure 14 d) observed similar regulation Figure 14 e). Moreover, EGFR L858R-inhibited phagocytosis was abolished by depletion of CD55 and CD59, while depletion of miR-216b and miR-150 inhibited TBE2 mutant-enhanced macrophage phagocytosis Figure 14f). These results indicate that EGFR activation-induced β-catenin transactivation inhibits macrophage phagocytosis through CD55 and CD59 upregulation mediated by miR-216b and miR-150 sequestration by LINC00973.
[0182] EGFR activation inhibition of CD8+ T cell function is attenuated by β-catenin depletion, knock-in expression of TBE2 mutant of LINC00973 Figure 12 g) or overexpression of miR-216b and miRNA-150 Figure 12 h). Notably, β-catenin knockdown, expression of TBE2 mutant of LINC00973 or knockdown of CD55 and CD59 resulted in enhanced tumor cell death, which was greatly reduced by the absence of CD8+ T cells Figure 12 i). In summary, EGFR / β-catenin activation upregulated CD55 and CD59 promote tumor cell immune evasion by inhibiting the complement system and macrophage and CD8+ T cell activities.
[0183] EGFR / β-catenin transactivation enhanced CD55 and CD59 expression promotes tumor growth by inhibiting mouse complement activation and immune cell activation
[0184] To obtain an immunocompetent syngeneic mouse for animal studies, we identified mouse MLINC00973 (Accession Sequence ID: NC_000082.7; chromosome 16) as the syngeneic of LINC00973 with 75.96% identity. Figure 15MLINC00973 sequence from the National Center for Biotechnology Information database and known regions of the MLINC00973 sequence. The size of the sequence is indicated according to the sequencing results of the PCR products. M, marker; LI, lane 1. b The full sequence of MLINC00973 was obtained using RACE. PCR products obtained using primers were sequenced for the 5' and 3' sequences of MLINC00973. The resulting full-length sequence of MLINC00973 is shown. c is a diagram of LEF / TCF binding elements (TBEs; CTTTG(A / T)(A / T)) in the promoter region of MLINC00973. d is genomic DNA extracted from two individual clones of LA795 cells with knock-in mutations (AT to GC or AA to GG, as indicated) in two TBEs. PCR products were amplified from the indicated DNA fragments and separated on an agarose gel. CI, clone 1; C2, clone 2. Sequences of the parental cell and two individual clones of LA795 cells with knock-in mutations (AT to GC or AA to GG, as indicated) in two TBEs are shown. The arrowed red line indicates the sgRNA targeting sequence. The red line without an arrow indicates the protospacer adjacent motif (PAM). The two TBEs with or without the mutated nucleotides are indicated by a red solid box. Silent mutations of the indicated nucleotides were introduced into the sequence to avoid repeated cleavage by Cas9. e Parental or MLINC00973 TBE4 mutant knock-in expressing LA795 cells were stably transfected with or without EGFRL858R. Relative expression levels of MLINC00973 RNA were measured using quantitative PCR. Data are presented as mean ± SD (n = 6). ns, not significant; ***P < 0.001. CI, clone 1; C2, clone 2. f A diagram showing the binding sites of mmu-miR-216b and mmu-miR-150 on the lncRNA MLINC00973 is shown in g. LA795 cells with or without expression of EGFRL858R were stably transfected with miR-Control, mmu-miR-216b, or mmu-miR-150. Immunoblot analysis was performed with the indicated antibodies. h LA795 cells with or without expression of EGFRL858R were stably transfected with or without mmu-miR-216b / mmu-miR-150 sponge expression in the presence or absence of β-catenin shRNA. Immunoblot analysis was performed with the indicated antibodies. i Parental or MLINC00973 TBE4 mutant knock-in expressing LA795 cells were stably transfected with or without EGFRL858R in the presence or absence of mmu-miR-216b / mmu-miR-150 sponge expression.Immunoblot analysis was performed with the indicated antibodies. CI, clone 1; C2, clone 2.
[0185] Figure 16 In the middle, a-g are LA795 cells expressing GFP (1 x 10 6) were stably transfected in the presence or absence of MLINC00973 knock-in TBE4 mutant (AT to GC) or CD55 and CD59 shRNA expression with or without EGFRL858R. Cells were injected subcutaneously into immunocompetent syngeneic “615” mice. Tumors were excised 23 days post-injection. Tumors were measured (n=6 / group) in a (left panel). Excised tumors were weighed (right panel). Data are represented as mean ± SD (n=6). ns, not significant; ***P<0.001. Cl, clone 1; C2, clone 2. b, Overall survival of mice (n=10 / group) was analyzed by Kaplan-Meier plot. P values were calculated using the log-rank test (two-tailed). Data are represented as mean ± SD (n=10); ns, not significant; ***P<0.001. Cl, clone 1; C2, clone 2. c, Tumors of mice (n=6 / group) were analyzed by IHC and ISH with the indicated antibodies. Representative images are shown. The area in the red box is shown at higher magnification. Significance of expression differences between groups was analyzed by non-parametric test. Data are represented as mean ± SD (n=6). ***P<0.001. Cl, clone 1; C2, clone 2. d, Single-cell suspensions were obtained from tumor pieces of mice (n=8 / group) by digestion with collagenase IV. Tumor pieces were homogenized and filtered through a 70-µm cell strainer. GFP-expressing tumor cells were obtained by flow cytometry. Expression of tumor cell surface C3b and C5b-9 was determined by flow cytometry with the indicated antibodies. Data are represented as mean ± SD (n=8). *P<0.05, **P<0.01, ***P<0.001. Cl, clone 1; C2, clone 2. e, 100 mg of minced tumor tissue from mice was collected and lysed. Tissue was homogenized and adjusted to 10 mg / ml. CARIA assay was performed using the nanoluciferase release method. Data are represented as mean ± SD (n=10). ***P<0.001. Cl, clone 1; C2, clone 2. f, Frequency of phagocytosis events in total TAMs in the indicated tumors. Data are represented as mean ± SD (n=10). **P<0.01; ***P<0.001. Cl, clone 1; C2, clone 2. g, Single-cell suspensions were obtained from tumor pieces of mice by digestion with collagenase D. Tumor pieces were homogenized and filtered through a 100-µm cell strainer. The percentage of granzyme B+ or perforin+ cells among tumor-infiltrating CD8+ T cells was analyzed by flow cytometry. Data are represented as mean ± SD (n=6). *P<0.05, ***P<0.001. Cl, clone 1. h, TUNEL analysis was performed on the indicated tumor samples from mice (n=10 / group). Apoptotic cells were stained in green (left panel) and quantified in the field of microscope (right panel). Data are represented as mean ± SD (n=10).***P < 0.001. CI, clone 1; C2, clone 2. i is LA795 cells stably transfected with EGFRL858R (1 x 106) were injected subcutaneously into mice in the presence or absence of MLINC00973 knock-in TBE4 mutant (AT to GC) or CD55 and CD59 shRNA expression. 6 ) subcutaneously into mice. Tumors (n = 6 / group) were measured (left panel) and excised 17 days after injection. Excised tumors were weighed (right panel). ns, not significant; ***P < 0.001. CI, clone 1. j-l is Hl 395 cells stably transfected with or without EGFRL858R (4 x 106) were injected subcutaneously into mice in the presence or absence of LINC00973 knock-in TBE2 mutant (AT to GC) or CD55 and CD59 shRNA expression. 6 ) into humanized NOG mice with restored human complement system by intraperitoneal injection of human serum (HS). These mice were treated with or without anti-PD-1 or anti-CD55 / CD59 antibodies. j is Tumors (n = 6 / group) were measured (left panel) and excised 26 days after injection. Excised tumors were weighed (right panel). Data are represented as mean ± SD (n = 6). ns, not significant; ***P < 0.05. CI, clone 1. k is Overall survival of mice (n = 10 / group) was analyzed by Kaplan-Meier plot. P values were calculated using the log-rank test (two-tailed). Data are represented as mean ± SD (n = 10). ns, not significant; ***P < 0.001. CI, clone 1. 1 is Single cell suspensions were obtained from tumor pieces of mice by digestion with collagenase D. Tumor pieces were homogenized and filtered through a 100 pm cell strainer. The percentage of granzyme B+or perforin+cells among tumor-infiltrating CD8+T cells was analyzed by flow cytometry. Data are represented as mean ± SD (n = 6). ns, not significant; *P < 0.05, **P < 0.01, ***P < 0.001. CI, clone 1.
[0186] Figure 17 In the mean time, a is analyzed by immunofluorescence with the indicated antibodies. b, c is LA795 cells expressing GFP (1 x 106 6Stable transfection was performed in the presence or absence of MLINC00973 or the knock-in TBE4 mutant (ATtoGC) of CD55 and CD59 shRNA, with or without EGFR L858R. Cells were subcutaneously injected into immunocompetent syngeneic "615" mice. Tumors were excised 23 days post-injection. 100 mg of chopped tumor tissue from mice was collected and lysed. The tissue was homogenized and adjusted to 10 mg / ml. The release of anaphylactic toxins (C3a and C5a) in the tumor microenvironment (TME) was measured by ELISA. Data are expressed as mean ± SD (n = 9). In section b, cytokine protein levels in the TME of tumor lysates were detected by ELISA. Data are expressed as mean ± SD (n = 6). In section c, *P < 0.05, **P < 0.01, ***P < 0.001. C1, clone 1; C2, clone 2. Section d shows the gating strategy of TAM phagocytosis in LA795 cells in vivo. After removing debris and bimodalities, TAM phagocytosis was assessed as the frequency of ZombieViolet-CD11b+F4 / 80+GFP+ events normalized to the total number of ZombieViolet-CD11b+F4 / 80+ events. Numbers represent the frequency of the preceding out-of-gate event. These plots represent eight experimental replicates. e is a representative flow cytometry plot showing TAM phagocytosis in the GFP+ LA795 tumors shown. Numbers represent the frequency of phagocytic events normalized to all TAMs. C1, clone 1; C2, clone 2. f is a representative result of granzyme B and perforin expression in tumor-infiltrating CD8+ T cells. go is GFP-expressing LA795 cells (1×10⁻⁶). 6) in the presence or absence of MLINC00973 or mmu-miR-216b / mmu-miR-150 adsorption. These cells were injected subcutaneously into immunocompetent syngeneic “615” mice. Tumors were excised 23 days post-injection. ns, not significant. *P < 0.05, ***P < 0.01, ***P < 0.001. Cl, clone 1. Tumors were measured (n = 6 / group) (left panel) and excised tumors were weighed (right panel) g. Data are represented as mean ± SD (n = 6). h, Overall survival of mice (n = 10 / group) was analyzed by Kaplan-Meier plot. P values were calculated using the log-rank test (two-tailed). Data are represented as mean ± SD (n = 10). i is IHC and ISH analysis of tumors from mice (n = 6 / group) with the indicated antibodies and probes. Representative images are shown. The area in the red box is shown at higher magnification. Significance of expression differences between groups was analyzed by non-parametric test. Data are represented as mean ± SD (n = 6). j is Single cell suspensions were obtained from tumor pieces of mice (n = 8 / group) by digestion with collagenase IV. Tumor pieces were homogenized and filtered through a 100 pm cell strainer. GFP-expressing tumor cells were obtained by flow cytometry. Expression of C3b and C5b-9 on the surface of tumor cells was determined by flow cytometry with the indicated antibodies. Data are represented as mean ± SD (n = 8). k, 1, m, 100 mg of minced tumor tissue from mice was collected and lysed. Tissue was homogenized and adjusted to 10 mg / ml. Release of anaphylatoxins (C3a and C5a) in the tumor microenvironment (TME) was determined by ELISA. Data are represented as mean ± SD (n = 9) (k). Cell factor protein levels in the TME were probed by ELISA in lysates. Data are represented as mean ± SD (n = 6) (1). CARIA assay was performed using the Nano-Glo® luciferase release method. Data are represented as mean ± SD (n = 10) (m). n is Frequency of phagocytosis events normalized to all TAMs in the indicated tumor. Data are represented as mean ± SD (n = 9). o is TUNEL analysis was performed on the indicated tumor samples from mice (n = 10 / group). Apoptotic cells were stained green (left panel) and quantified in the field of view of the microscope (right panel). Data are represented as mean ± SD (n = 10). p-r are “615” mice (n = 6 / group) were injected via the tail vein with adeno-associated virus 8 (AAV8) expressing either non-targeting shRNA (AAV8-shControl) or complement C3 and C5 shRNAs (AAV8-C3 / C5 shRNA). Data are represented as mean ± SD (n = 6). ***P < 0.001. Four weeks after plasmid injection, mice were euthanized. 100 mg of minced liver tissue from mice was collected. Relative expression levels of C3 and C5 mRNA in liver tissue were measured using quantitative PCR (p).Liver tissue was lysed, homogenized, and adjusted to 10 μg / ml. Mouse complement C3 and C5 protein levels in the lysate were detected by ELISA (q). Peripheral blood was collected from mice, and mouse complement C3 and C5 protein levels were detected by ELISA (r).
[0187] Figure 18 In the table, a and b represent the results of stable transfection of H322M cells (6 × 10⁶ cells) with or without EGFR L858R, with or without the presence or absence of the LINC00973 knock-in TBE2 mutant (AT to GC) or CD55 and CD59 shRNA expression. 6 These cells were subcutaneously injected into humanized NOG mice with restored human complement system via intraperitoneal injection of human serum (HS). These mice were treated with or without anti-PD-1 or anti-CD55 / CD59 antibodies. ns, not significant. **P<0.01, ***P<0.001. C1, clone 1. a: Measurement of tumors (n=6 / group) (left panel) and resection 26 days after injection. Resected tumors were weighed (right panel). Data are expressed as mean ± SD (n=6). b: Analysis of overall survival of mice (n=10 / group) by Kaplan-Meier plot. P-values were calculated using the log-rank test (two-tailed). Data are expressed as mean ± SD (n=10). c: Treatment of designated cells with or without Wnt-7B (200 ng / ml) and with or without XAV939 (10 μM) for 12 h. Relative expression levels of CD55 and CD59 mRNA were measured using quantitative PCR. Data are presented as mean ± SD (n = 4). ns, not significant; ***P < 0.001. d represents the treatment of specified cells with or without Wnt-7B (200 ng / ml) and XAV939 (10 μM) for 24 hours. Immunoblot analysis was performed using the specified antibody. e and f represent the treatment of H1395 cells (4 × 10⁻⁶ cells) with human serum (HS) via intraperitoneal injection. 6 Subcutaneous injection was administered to humanized NOG mice with a restored human complement system. These mice were treated with or untreated with anti-PD-1 antibody and / or XAV939. *P<0.05; ***P<0.001. e: Measurement of tumors (n=6 / group) (left panel) and resection 26 days after injection. Resected tumors were weighed (right panel). Data are expressed as mean ± SD (n=6). ns, not significant. f: Analysis of overall survival of mice (n=10 / group) by Kaplan-Meier plot. P-values were calculated using the log-rank test (two-tailed). Data are expressed as mean ± SD (n=10). ns, not significant. g: MC38 cells expressing APCshRNA (2×10⁻⁶ cells). 6) were stably transfected with or without CD55 and CD59 shRNA. These cells were injected subcutaneously into C57B1 / 6 mice. These mice were treated with anti-PD-1 antibody or not. Tumors were measured (n=6 / group) (left panel) and excised 13 days after injection. Excised tumors were weighed (right panel). Data are expressed as mean ± SD (n=6). ***P<0.001. h H1395 cells (4x10 6 ) were injected subcutaneously into humanized NOG mice with restoration of human complement system by intraperitoneal injection of human serum (HS). These mice were treated with anti-PD-1 antibody or anti-CD55 and anti-CD59 antibodies or not. Tumors were measured (n=6 / group) (left panel) and excised 26 days after injection. Excised tumors were weighed (right panel). Data are expressed as mean ± SD (n=6). **P<0.01; ***P<0.001. i, j, k H1395 cells expressing EGFRL858R (4x10 6 ) were injected subcutaneously into humanized NOG mice with restoration of human complement system by intraperitoneal injection of human serum (HS). These mice received or not gefitinib treatment on day 11. Tumors were excised 26 days after injection. i Tumors were measured (n=6 / group) (left panel). Excised tumors were weighed (right panel). Data are expressed as mean ± SD (n=6). ***P<0.001. j Immunoblot analysis with the indicated antibodies. k Immunohistochemical staining with the indicated antibodies.
[0188] RACE analysis( Figure 15 a) revealed the full-length sequence of the MLINC00973 transcript Figure 15 b). The promoter region of MLINC00973 has two TBEs (TBE4 and TBE5) Figure 15 c). AT to GC or AA to GG was knocked into TBEs of LA795 mouse lung adenocarcinoma cells using CRISPR / Cas9 technology Figure 15 d) shows that only TBE4 mutation reduced basal and EGFRL858R-induced MLINC00973 expression Figure 15 e).
[0189] Analysis of the recognition sequence by the miRcode prediction algorithm revealed that MLINC00973 contains two single sequences for mouse mmu-miR-216b and mmu-miR-150, respectively Figure 15 f). As expected, EGFRL858R expression enhanced the protein levels of CD55 and CD59 in LA795 cells, and this enhancement was inhibited by overexpression of mmu-miR-216b and mmu-miR-150, respectively Figure 15g) Notably, EGFRL858R enhanced CD55 and CD59 expression was depleted by β-catenin depletion Figure 15 h) or knock-in expression of TBE4 mutant of MLINC00973 Figure 15 i) abrogation; these suppressive effects were mitigated by stable transfection of vectors expressing oligonucleotides against mmu-miR-216b and mmu-miRNA-150 (mmu-miR-216b / 150-sponge) Figure 16 h, 15i) These results indicate that LA795 mouse lung adenoma cells share the same regulatory mechanism of EGFRL858R-activated upregulation of CD55 and CD59 with human NSCLC cells.
[0190] EGFRL858R expression significantly increased tumor growth Figure 16 a), shortened mouse survival time Figure 16 b), enhanced expression and activity of CD55, CD59, MLINC00973 and active β-catenin Figure 16 c), reduced accumulation of C3b and C5b-9 Figure 17 c, 16d) on tumor cell surface Figure 16 a) and release of anaphylatoxins Figure 16 b), reduced secretion of IFN-γ, TNF-α, IL-6, IL-1β and IL-17 Figure 16 c), suppressed CARIA in tumor tissues Figure 16 f), and decreased expression of granzyme B and perforin in tumor-infiltrating CD8+ T cells Figure 16 a-g), which also increased cell death detected by TUNEL assay Figure 17 h). Notably, the effects caused by TBE4 mutation of MLINC00973 were counteracted by depletion of mmu-miRNA-216b and mmu-miR-150 Figure 17 g-o).
[0191] C3 and C5 are mainly synthesized in the liver and normally circulate in blood as inactive precursors. Intravenous tail vein injection of AAV8 virus expressing C3 shRNA and C5 shRNA (AAV8-C3 / C5 shRNAs) reduced the expression of mRNAs Figure 17 p) and proteins Figure 17 q) of C3 and C5 in mouse liver and reduced the levels of C3 and C5 in mouse peripheral bloodFigure 16 r). Remarkably, depletion of C3 and C5 in mice promoted tumor growth and abrogated tumor suppression induced by expression of TBE4 mutant of MLINC00973 or depletion of CD55 and CD59 Figure 16 i). These results indicate that CD55 and CD59 expression with enhanced transactivation of β-catenin promotes tumor immune evasion and tumor growth by suppressing mouse complement activation and CD8+ T cell activation.
[0192] Given the limited therapeutic efficacy of programmed death 1 (PD-1) antibody treatment on human NSCLC with EGFR activation (66-68), we next examined the effects of combined inhibition of CD55 and CD59 expression with immune checkpoint blockade on tumor growth. We subcutaneously injected H1395 or H322M cells into humanized NOG mice, which restored human immune system and human complement system by transplanting human CD34+ hematopoietic stem cells and intraperitoneal injection of human serum (HS). Treatment with antibodies against CD55 and CD59 caused similar tumor growth suppression Figure 18 j, Figure 16 a), prolonged mouse survival time Figure 18 k, Figure 16 b), and enhanced expression of granzyme B and perforin in tumor-infiltrating CD8+ T cells Figure 16 l), while treatment with anti-PD-1 antibody was limited. Remarkably, combined treatment with antibodies against CD55, CD59 and PD-1 resulted in significantly enhanced synergistic suppression of tumor growth Figure 18 j, Figure 16 a) and significantly prolonged mouse survival time Figure 18 k, Figure 16 b), with greatly increased expression of granzyme B and perforin in tumor-infiltrating CD8+ T cells Figure 18 l).
[0193] Consistently, inhibition of β-catenin with tankyrase inhibitor XAV939 abrogated Wnt-7B-induced mRNA Figure 18 c) and protein Figure 18 d) expression of CD55 and CD59, suppressed tumor growth Figure 18 e) and prolonged mouse survival time Figure 18 f). Moreover, combined treatment with XAV939 and anti-PD-1 antibody resulted in synergistic suppression of tumor growth Figure 18 e) and greatly prolonged mouse survival time Figure 18f) Consistent with these findings, CD55 / CD59 depletion reduced the growth of MC38 mouse colorectal cancer (CRC) cells derived tumors from APC-depleted and showed a synergistic effect on tumor growth inhibition in combination with anti-PD-1 treatment Figure 18 g), these results reveal that targeting complement and immune checkpoints improves anti-tumor effects in EGFR-activated NSCLC and β-catenin-activated CRC. Given that CD55 and CD59 expression can be regulated by EGFR or Wnt, CD55 / CD59 antibody treatment also inhibited the growth of tumors derived from H1395 cells without EGFR L858R expression Figure 18 h) As expected, treatment with the EGFR inhibitor gefitinib slowed tumor growth Figure 19 i) Inhibition of CD55 and CD59 expression Figure 12 j, 18k).
[0194] In summary, these results indicate that alleviating EGFR / Wnt / β-catenin / LINC00973-mediated complement activation inhibition combined with immune checkpoint blockade significantly improved the anti-tumor effects of these treatments in mice.
[0195] EGFR / β-catenin transactivation, LINC00973 expression, and CD55 and CD59 levels were positively correlated with each other in human NSCLC specimens and with the clinical invasiveness of the disease
[0196] To determine the clinical relevance of EGFR / β-catenin transactivation-regulated LINC00973, CD55, and CD59 expression, we analyzed protein and LINC00973 levels in 200 human NSCLC specimens using IHC and locked nucleic acid (LNA) probes. Figure 20 In summary, a-f 200 human NSCLC specimens were analyzed by IHC assays using the indicated antibodies and in situ hybridization (ISH) assays using the indicated locked nucleic acid (LNA) probes. a shows representative images, which are expanded data Figure 8Magnified areas in the images of a. b is a Kaplan-Meier plot of overall survival time of 200 NSCLC patients grouped according to high (staining score 5-8) and low (staining score 1-4) expression levels of the indicated proteins or LINC00973. P values were calculated using the log-rank test (two-tailed). c shows representative images. d is a correlation analysis using the two-tailed Pearson correlation test (n=200). Note that the scores of certain samples overlap. The intensity of the blue color represents the number of human NSCLC samples (darker blue represents a higher number of human NSCLC samples). e shows representative images. f is a Kaplan-Meier plot of overall survival time of 200 NSCLC patients grouped according to high (staining score 5-8) and low (staining score 1-4) deposition levels of C4d, C3b and C5b-9. P values were calculated using the log-rank test (two-tailed). g is a waterfall plot of the best percentage change from baseline in the sum of the longest diameters of target lesions according to RECIST version 1.1 (n=24 patients). Dotted lines represent 20% increase from baseline (cut-off for PD) and 30% decrease (cut-off for PR according to RECIST vl.1 criteria). PD, progressive disease; SD, stable disease; PR, partial response. h-k are 24 tumor specimens from NSCLC patients who received sintilimab treatment prior to surgery analyzed by IHC with the indicated antibodies. PD, progressive disease; SD, stable disease; PR, partial response. h shows representative images. i is a correlation analysis using the two-tailed Pearson correlation test (n=24). Note that the scores of certain samples overlap. The intensity of the red color represents the number of human NSCLC specimens (darker blue represents a higher number of human NSCLC specimens). j is the association between sintilimab treatment response and C3b, C4d and C5b-9 expression levels. PD, progressive disease; SD, stable disease; PR, partial response; IHC, immunohistochemistry. *P<0.05, **P<0.01. k is a Kaplan-Meier plot of progression-free survival (PFS) time of 24 NSCLC patients grouped according to high (staining score 5-8) and low (staining score 1-4) deposition levels of C3b, C4d and C5b-9. P values were calculated using the log-rank test (two-tailed). 1 is a mechanism of EGFR activation-induced and beta-catenin transactivation-dependent complement inhibition, immune cell function inhibition and subsequent tumor growth promotion. CR3 complement receptor 3; EGFR, epidermal growth factor (EGF) receptor.
[0197] Figure 19In particular, a, b, c are 200 human NSCLC specimens with adjacent normal tissue were analyzed by IHC with the indicated antibodies and by in situ hybridization (ISH) assay of LINC00973 levels with locked nucleic acid (LNA) probes. a is a representative image is shown. The area in the indicated red box is magnified and shown at Figure 20 a. b is a correlation analysis using a two-tailed Pearson correlation test (n=200). Note that the scores of some samples overlap. The intensity of the red color represents the number of human NSCLC samples (darker red or blue represents a higher number of human NSCLC samples). c shows representative images of the indicated proteins (left panel) and LINC00973 (right panel) expression. U6 expression was used as a control. The area in the red box is shown at higher magnification. The expression levels of the indicated proteins and LINC00973 were scored and compared between tumor tissue and paired adjacent normal tissue by non-parametric test (right panel). ***P<0.001. d is univariate and multivariate overall survival analysis of the correlation of the indicated protein and LINC00973 expression levels in non-small cell lung cancer patients. HR, hazard ratio; 95% CI, 95% confidence interval.
[0198] The results show that EGFR phosphorylation levels and the expression of nuclear active β-catenin, LINC00973, CD55 and CD59 are positively correlated with each other and negatively correlated with the tumor infiltration of M1 macrophages (CD80, CD86 and CD64 expression) and CD8+ T cells (CD8 expression) in human NSCLC specimens Figure 20 a, Figure 19 a-b) and significantly higher than the corresponding levels in paired adjacent normal tissue samples Figure 20 c). Moreover, the expression levels of active β-catenin, LINC00973, CD55 and CD59 are negatively correlated with the survival time of patients Figure 19 b). According to the Cox multivariate model, after adjusting for patient age and tumor lymph node metastasis (TNM) stage, all these levels are independent predictors of survival in NSCLC patients, which are relevant clinical covariates Figure 19 d).
[0199] In addition, the expression levels of miR-216b and miR-150 determined by in situ hybridization (ISH) analysis indicate that the expression levels of miR-216b and miR-150 in human lung cancer tissues are negatively correlated with the expression levels of LINC00973, CD55 and CD59 Figure 19 c-d). The analysis of 200 human NSCLC specimens by immunohistochemistry Figure 19 e) shows that the expression levels of C3b, C4d and C5b-9 are correlated with good prognosis of patientsFigure 19 f).
[0200] Notably, in our sintilimab treatment cohort, most evaluable patients experienced a reduction in target lesions (75%). Figure 19 g); IHC analysis of 24 resected NSCLC specimens showed that high expression of C3b, C4d, and C5b-9 was negatively correlated with the expression levels of CD55 and CD59. Figure 21 h, 19i) and were positively correlated with good response to sintilimab treatment. Figure 21 j), and prolong progression-free survival (PFS) in NSCLC patients (j). Figure 21 These results support the key role of EGFR-induced and β-catenin transactivation-mediated LINC00973, CD55, and CD59 expression in the clinical aggressiveness of human NSCLC and resistance to immune checkpoint blockade therapy.
[0201] EGFR activation may upregulate Lnc1574203 expression via β-catenin transcription.
[0202] Figure 21 In the figure, a and b represent the qPCR results under the indicated conditions. C represents the ChIP qPCR results performed with β-catenin antibody under the indicated conditions. As can be seen from the figure, EGF treatment of human lung adenocarcinoma cells H1395, H322M, and human lung squamous cell carcinoma cells H226 gradually increased the expression level of Lnc1574203 in the cells over time. Figure 22 a), while knocking down β-catenin blocked this upregulation effect ( Figure 22 b). Chromatin immunoprecipitation (ChIP) experiments revealed that β-catenin, after EGF treatment, bound to the promoter of Lnc1574203, but not to the promoter of CD73. Figure 22 c). These results suggest that EGFR signaling may upregulate Lnc1574203 expression via β-catenin transcription.
[0203] Knockdown of β-catenin inhibited the upregulation of CD73 expression by EGFR activation.
[0204] Figure 23 In the figure, a shows the qPCR results under the indicated conditions. b shows the Western blotting results under the indicated conditions. As can be seen from the figure, knocking down β-catenin inhibited the effect of EGF treatment on CD73 mRNA (…). Figure 24 a) and protein ( Figures 21-24 b) upregulation effect.
[0205] Inhibition of Lnc1574203 blocks the upregulation of CD73 expression by EGFR activation
[0206] Figure 19 qPCR results for the indicated conditions are shown. As can be seen from the graph, knockdown of Lnc1574203 inhibits the upregulation of CD73 expression by EGF treatment.
[0207] Inhibition of Dicer blocks the downregulation of CD73 expression by Lnc1574203 knockdown
[0208] Figure 25 Western blotting results for the indicated conditions are shown. As can be seen from the graph, inhibition of Dicer by siRNA technology blocks the downregulation of CD73 expression by Lnc1574203 knockdown.
[0209] In summary, from the above, Figure 26 it can be seen that in non-small cell lung cancer cells, the EGFR signaling pathway can transcribe a new lncRNA Lnc1574203 by activating β-catenin, and the upregulated Lnc1574203 can weaken the mRNA degradation effect of miR-590-3p on CD73 by adsorbing miRNA (possibly miR-590-3p), thereby enhancing the expression of CD73.
[0210] Based on the above experiments according to the present application, immune checkpoint blockade with PD-1 antibodies has a moderate effect on the treatment of human NSCLC, and patients with EGFR mutations or activation show resistance to these therapies. Given the complexity of the immune system, it is crucial to understand the interactions between cancer cells and all components of the immune response, including the complement system, in the tumor microenvironment. mCRPs play an important role in the immune response to tumors; overexpression of mCRPs, including CD55 and CD59, has been reported in many primary cancers and is associated with poor prognosis in cancer patients (14, 15). However, how these proteins are modulated by oncogenic signals to regulate complement activation to escape tumor immunity is still unclear. We have shown here that EGF or Wnt treatment or EGFRL858R expression, which often occurs in lung cancer, increases the expression of CD55 and CD59, which is caused by up-regulating LINC00973 adsorbing miR-216b and miR-150, respectively. EGFR activation induces transactivation of the β-catenin / TCF / LEF complex bound to TBE2 in the LINC00973 promoter region, leading to enhanced LINC00973 transcription. Depletion of β-catenin or CD55 / CD59 or mutation of TBE2 in human NSCLC cells enhances complement activation, which is reflected in the deposition of C3b and C5b-9 on the tumor cell surface; anaphylatoxin release; increased expression of cytokines IFN-γ, TNF-α, IL-6, IL-1β, and IL-17, which can be due to C5a-mediated activation of antigen-presenting cells and TH1 / TH17 differentiation; CARIA and phagocytosis by macrophages. Activation of complement and subsequent CD8+ T cell activation leads to tumor growth inhibition. Notably, the activation of complement by anti-CD55 / CD59 antibody treatment or the application of anti-PD-1 antibodies combined with EGFR / β-catenin-upregulated CD55 / CD59 triggered a synergistic tumor inhibition effect, revealing an attractive therapeutic strategy combining anti-CD55 / CD59 antibodies and immune checkpoint inhibitors for the treatment of EGFR-activated NSCLC.
[0211] The potential anti-tumor and pro-tumor effects of the complement system under certain conditions have been reported (Combined blockade of PD-1 / PD-L1 and C5a can reduce tumor growth and metastasis, which is also observed in C3-deficient mice and is associated with an increase in the number of CD4+ and CD8+ T cells. mCRP expression in tumor cells or other cells in the tumor microenvironment, such as T cells and macrophages, can trigger a unique complement response to target cells, thereby affecting tumor growth. Overexpression of mCRPs in tumor cells appears to play an important role in tumor immune evasion and has been shown to interfere with anti-tumor therapy. Due to the nature of different oncogenic signals, the effects of the complement system on cancer can be different, which differentially regulate tumor cells and other cells in the tumor microenvironment with various types of genetic backgrounds.
[0212] The present application elucidates a previously unknown mechanism, i.e. oncogenic EGFR or Wnt signaling mediated upregulation of CD55 and CD59 by LINC00973 inhibits the complement system. This is the first report demonstrating that oncogenic signaling inhibits cytotoxic CD8+ T cells in a complement inhibition-dependent manner, revealing a novel intrinsic relationship between complement and CD8+ T cells regulation. Importantly, we also provide the first preclinical evidence that combined blockade of mCRP function and PD-1 / PD-L1 checkpoint can promote the activation of complement and CD8+ T cells can be a rational strategy for human NSCLC treatment. The clinical significance of this regulation is demonstrated by the positive correlation between EGFR activation and the expression levels of active beta-catenin, LINC00973, CD55 and CD59 in human NSCLC specimens, which is associated with the clinical invasiveness of the tumor. These findings reveal the unknown mechanism of oncogenic signal-dependent inhibition of the complement system and subsequent CD8+ T cells so far Figure 27 l) activated by tumor cells, and highlights the importance of EGFR / Wnt / beta-catenin transactivation-mediated upregulation of CD55 and CD59 for tumor immune evasion.
[0213] We further discovered and confirmed that the activation of the EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissues inhibits complement activation, and in turn inhibits the anti-tumor immune response, by analyzing the activation of the EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in lung adenocarcinoma, lung squamous carcinoma, cholangiocarcinoma, hepatocarcinoma, pancreatic carcinoma and gastric adenocarcinoma through the public database Gene Expression Profiling Interactive Analysis (GEPIA).
[0214] Figure 28The expression of LINC00973 and C5 in lung adenocarcinoma and normal tissues is shown. The expression of LINC00973, CD55, CD59 and C5 in pancreatic adenocarcinoma (PAAD) (179 cases) and normal tissues (171 cases) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database, and it was found that the expression of LINC00973, CD55 and CD59 in tumor tissues was higher than that in normal tissues, and the expression of C5 in tumor tissues was lower than that in normal tissues. This result further confirmed that the activation of EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissues inhibited complement activation, and then inhibited anti-tumor immune response.
[0215] Figure 29 The correlation analysis of the expression of CD55 and CD59 in lung adenocarcinoma is shown. The expression of CD55 and CD59 in lung adenocarcinoma (LUAD) (483 cases) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database, and it was found that the expression of CD55 and CD59 was positively correlated. This result further confirmed that the activation of EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissues inhibited complement activation, and then inhibited anti-tumor immune response.
[0216] Figure 30 The survival analysis of the expression of LINC00973 in lung adenocarcinoma patients is shown. The expression of LINC00973 in lung adenocarcinoma (LUAD) (518 cases) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database, and it was found that the expression of LINC00973 in tumor tissues was related to poor prognosis. This result further confirmed that the activation of EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissues inhibited complement activation, and then inhibited anti-tumor immune response.
[0217] Figure 31Expression of C3 and C5 in lung squamous carcinoma and normal tissue. The expression of C3 and C5 in lung squamous carcinoma (LUSC) (486 cases) and normal tissue (338 cases) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database. It was found that the expression of C3 and C5 in tumor tissue was lower than that in normal tissue. This result further confirmed that the activation of EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissue inhibited complement activation, and further inhibited anti-tumor immune response.
[0218] Figure 32 Correlation analysis of expression of CD55 and CD59 in lung squamous carcinoma. The expression of CD55 and CD59 in lung squamous carcinoma (LUSC) (486 cases) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database. It was found that the expression of CD55 and CD59 was positively correlated. This result further confirmed that the activation of EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissue inhibited complement activation, and further inhibited anti-tumor immune response.
[0219] Figure 33 Survival analysis of expression of CD59 in lung adenocarcinoma patients. The expression of CD59 in lung squamous carcinoma (LUSC) (290 cases) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database. It was found that the expression of CD59 in tumor tissue was associated with poor prognosis. This result further confirmed that the activation of EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissue inhibited complement activation, and further inhibited anti-tumor immune response.
[0220] Figure 34Expression of CD55, CD59, C3 and C5 in cholangiocarcinoma and normal tissues. The expression of CD55, CD59, C3 and C5 in cholangiocarcinoma (CHOL) (36 cases) and normal tissues (9 cases) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database. It was found that the expression of CD55 and CD59 in tumor tissues was higher than that in normal tissues, and the expression of C3 and C5 in tumor tissues was lower than that in normal tissues. This result further confirmed that the activation of EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissues inhibited complement activation, and further inhibited anti-tumor immune response.
[0221] Figure 35 Correlation analysis of the expression of CD55 and CD59 in cholangiocarcinoma. The expression of CD55 and CD59 in cholangiocarcinoma (CHOL) (36 cases) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database. It was found that the expression of CD55 and CD59 was positively correlated. This result further confirmed that the activation of EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissues inhibited complement activation, and further inhibited anti-tumor immune response.
[0222] Figure 36 Expression of CD55, CD59 and C5 in liver cancer and normal tissues. The expression of CD55, CD59 and C5 in liver cancer (LIHC) (369 cases) and normal tissues (160 cases) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database. It was found that the expression of CD55 and CD59 in tumor tissues was higher than that in normal tissues, and the expression of C5 in tumor tissues was lower than that in normal tissues. This result further confirmed that the activation of EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissues inhibited complement activation, and further inhibited anti-tumor immune response.
[0223] Figure 37The correlation analysis of the expression of CD55 and CD59 in liver cancer is shown. The expression of CD55 and CD59 in liver cancer (LIHC) (369 cases) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database, and it was found that the expression of CD55 and CD59 was positively correlated. This result further confirmed that the activation of the EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissues inhibited complement activation, and further inhibited the anti-tumor immune response.
[0224] Figure 38 The survival analysis of the expression of C3 in liver cancer patients is shown. The expression of C3 in liver cancer (LIHC) (292 cases) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database, and it was found that the expression of C3 in tumor tissues was associated with good prognosis. This result further confirmed that the activation of the EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissues inhibited complement activation, and further inhibited the anti-tumor immune response.
[0225] Figure 39 The expression of LINC00973, CD55, CD59 and C5 in pancreatic cancer and normal tissues is shown. The expression of LINC00973, CD55, CD59 and C5 in pancreatic cancer (PAAD) (179 cases) and normal tissues (171 cases) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database, and it was found that the expression of LINC00973, CD55 and CD59 in tumor tissues was higher than that in normal tissues, and the expression of C5 in tumor tissues was lower than that in normal tissues. This result further confirmed that the activation of the EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissues inhibited complement activation, and further inhibited the anti-tumor immune response.
[0226] Figure 40Correlation analysis of expression of CD55, CD59 and LINC00973 in pancreatic cancer is shown. The expression of CD55, CD59 and LINC00973 in pancreatic adenocarcinoma (PAAD) (179 cases) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database, and it was found that the expression of CD55 and CD59 was positively correlated, and the expression of LINC00973 and CD59 was positively correlated. This result further confirmed that the activation of the EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissues inhibited complement activation, and further inhibited the anti-tumor immune response.
[0227] Figure 41 Survival analysis of expression of LINC00973 and CD59 in pancreatic cancer patients is shown. The expression of LINC00973 and CD59 in pancreatic adenocarcinoma (PAAD) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database, and it was found that the expression of LINC00973 and CD59 in tumor tissues was associated with poor prognosis. This result further confirmed that the activation of the EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissues inhibited complement activation, and further inhibited the anti-tumor immune response.
[0228] The expression of CD55 and C5 in gastric adenocarcinoma and normal tissues is shown. The expression of CD55 and C5 in gastric adenocarcinoma (STAD) (408 cases) and normal tissues (211 cases) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database, and it was found that the expression of CD55 in tumor tissues was higher than that in normal tissues, and the expression of C5 in tumor tissues was lower than that in normal tissues. This result further confirmed that the activation of the EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissues inhibited complement activation, and further inhibited the anti-tumor immune response.
[0229] Correlation analysis of expression of CD55 and CD59 in gastric adenocarcinoma was shown. The expression of CD55 and CD59 in gastric adenocarcinoma (STAD) (408 cases) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database, and it was found that the expression of CD55 and CD59 was positively correlated. This result further confirmed that the activation of EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissue inhibited complement activation, and further inhibited anti-tumor immune response.
[0230] Survival analysis of expression of CD59 in gastric adenocarcinoma patients was shown. The expression of LINC00973 and CD59 in gastric adenocarcinoma (STAD) (462 cases) was analyzed by Gene Expression Profiling Interactive Analysis (GEPIA) database, and it was found that the expression of CD59 in tumor tissue was associated with poor prognosis. This result further confirmed that the activation of EGFR / beta-catenin / LINC00973 / CD55 / 59 signaling pathway in tumor tissue inhibited complement activation, and further inhibited anti-tumor immune response.
[0231] The above disclosed preferred embodiments of the present application are only used to help explain the present application. The preferred embodiments do not describe all the details, nor limit the present application to the specific embodiments described. Obviously, many modifications and variations can be made according to the content of the present application. The present application selects and specifically describes these embodiments in order to better explain the principles and practical applications of the present application, so that those skilled in the art can well understand and utilize the present application. The present application is limited only by the claims and their full scope and equivalents.
Claims
1. Use of a pharmaceutical composition for the manufacture of a product for the treatment of cancer, characterized in that, The pharmaceutical composition consists of an anti-CD55 antibody, an anti-CD59 antibody, and an anti-PD-1 antibody.
2. Use according to claim 1, characterized in that, The cancer is EGFR-activated non-small cell lung cancer.
3. Use of a composition consisting of an anti-CD55 antibody and an anti-CD59 antibody in the manufacture of a product for improving the response of a cancer patient to treatment with an anti-PD-1 antibody.
4. Use according to claim 3, characterized in that, The cancer patient is an EGFR-activated non-small cell lung cancer patient.
Citation Information
Patent Citations
Novel EGFR (epidermal growth factor receptor) inhibitor and preparation method thereof
CN105399734A
Reagent and kit for detecting cancerogenic protein epidermal growth factor receptor (EGFR)
CN106884018A
Monoclonal antibody neo-201 for the treatment of human carcinomas
CN111670199A
Novel Anti-PD-1 checkpoint inhibitor antibodies that block binding of PD-l1 to PD-1
US20180051085A1
Molecular biomarkers for predicting outcome in lung cancer
WO2013190089A1