A recombinant adenovirus vaccine for respiratory syncytial virus infection
By constructing a recombinant adenovirus vaccine, including MHC-II restriction antigen epitope peptide and preF protein, the problem of lack of effective RSV vaccines in the prior art was solved, and efficient CD4+ T cell immune response and prevention of RSV infection were achieved.
Patent Information
- Application Number
- CN202310652514.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-04
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2043-06-04
AI Technical Summary
There is a lack of effective vaccines for preventing respiratory syncytial virus (RSV) infection in the prior art, especially in infants and young children and elderly populations, resulting in serious health threats and economic burdens.
By constructing a recombinant adenovirus vaccine, including MHC-II restriction antigen epitope peptide and pre-fusion F (preF) protein, human rare serotype 26 adenovirus and chimpanzee 63 adenovirus as vectors, the safety and immune response effect of the vaccine are improved.
A higher CD4+ T cell immune response was achieved, providing effective prevention of RSV infection, especially in the elderly and those with immune deficits, significantly reducing the infection rate and the severity of related diseases.
Smart Images

Figure CN116726159B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of bioengineering technology. The present invention discloses a recombinant adenovirus vaccine for respiratory syncytial virus infection, wherein the vaccine comprises an MHC-II restricted antigen epitope peptide and preF. Background Art
[0002] Respiratory syncytial virus (RSV) is a common pathogen that can cause lower respiratory tract infections (LRTIs) in infants, the elderly, and immunocompromised individuals. Studies have found that during peak influenza season, the detection frequency of RSV infection is 55.3%, significantly higher than the 16.3% for influenza virus. RSV infection causes 39% of pneumonia cases, compared to 18% for influenza virus. Furthermore, the clinical course of RSV infection in newborns under three months of age is significantly more severe than that of influenza virus infection. RSV also poses a threat to adults. According to statistics, the annual mortality rate due to RSV infection in adults aged 65 and older in the United States is 7.2 per 100,000, and RSV accounts for 8% of deaths in hospitalized patients with acute lower respiratory tract infections. Consequently, increasing data demonstrates the growing recognition of the serious health threat and heavy global economic burden posed by RSV. However, to date, there is still no approved vaccine that is safe and effective for preventing RSV. Therefore, WHO has listed RSV vaccine as one of the global vaccine priority development plans in the 21st century.
[0003] RSV belongs to the genus Pneumovirus in the family Paramyxoviridae. It is a single-stranded, negative-sense RNA virus whose genome encodes 11 proteins. Fusion glycoprotein F (F protein) is its most important antigenic protein and is highly conserved among different RSV strains. Studies have shown that the F protein has two distinct conformations: post-fusion F (postF) and pre-fusion F (preF). The neutralizing activity of antibodies elicited by the preF protein is 10-100 times greater than that of the postF protein. Therefore, research on the preF protein is currently a focus of RSV vaccine development.
[0004] Compared to other viral vectors, adenovirus vectors offer advantages such as clear genetic information, ease of manipulation, and the ability to insert large fragments of exogenous genes. They can effectively multiply, with high viral titers, making them suitable for gene therapy. They have a broad host range, infecting both dividing and resting cells. They do not integrate into host DNA, causing no mutations. Their relative stability makes them widely used for recombinant viral expression. Currently, the most thoroughly studied and widely used is human adenovirus type 5 (HAV5), as seen in CanSino's recombinant COVID-19 and recombinant Ebola vaccines, as well as Russia's Sputnik V. However, the natural infection rate of HAV5 in the human population is relatively high, and innate immunity limits its further application.
[0005] Therefore, rare human adenovirus serotypes and non-primate adenovirus serotypes have become another breakthrough in vaccine development. Currently, recombinant adenovirus COVID-19 vaccines based on human Ad26 and chimpanzee adenovirus (ChAd) have been launched, and a single injection can achieve a good immune response. This further demonstrates the safety and feasibility of using rare human serotypes and non-human primate adenovirus vectors for vaccine research.
[0006] By constructing vaccines integrating respiratory syncytial virus (RSV) MHC-II-restricted epitope peptides and their prefusion F protein, we can achieve a high CD4+ T cell immune response, broadening research avenues for RSV vaccine development. We selected rare human adenovirus serotype 26 and chimpanzee adenovirus serotype 63 as vectors and modified these two adenoviruses (rAd26 and rChAd63) to construct replication-defective recombinant adenoviruses expressing RSV prefusion F (preF) and MHC II-restricted epitope peptides, further improving safety for the prevention of RSV infection. Summary of the Invention
[0007] The present invention aims to provide a respiratory syncytial virus MHC-II restricted antigen epitope peptide and its use in vaccine preparation. To achieve the above-mentioned invention object, the present invention provides the following technical solutions:
[0008] A recombinant adenovirus vaccine comprises a recombinant adenovirus named rAd26-preF-T-Foldon and / or rChAd63-preF-T-Foldon, wherein rAd26-preF-T-Foldon comprises the recombinant adenovirus vector pAd26-preF-T-Foldon; and rChAd63-preF-T-Foldon comprises the recombinant adenovirus vector pChAd63-preF-T-Foldon, wherein preF-T is a nucleotide sequence encoding the preF protein and respiratory syncytial virus MHC-II restricted antigen epitope peptide T, wherein the respiratory syncytial virus MHC-II restricted antigen epitope peptide T is a composite epitope peptide selected from any one or more combinations of respiratory syncytial virus MHC-II restricted antigen epitope peptides T of SEQ ID NOs. 1 to 24, wherein, when there are multiple groups, each two groups are connected by GPGPG.
[0009] In one embodiment, the recombinant adenovirus vaccine of the present invention is characterized in that the preF is the sequence of tPA-preF, and the amino acid sequence encoded by it is SEQ ID NO.25; the preF-T is selected from preF-T1, preF-T3, and preF-T4, and the amino acid sequence encoded by it is SEQ ID NO.26 to 28, preferably preF-T1, SEQ ID NO.26.
[0010] In one embodiment, the recombinant adenovirus vaccine of the present invention is characterized in that the amino acid sequence encoded by Foldon is SEQ ID NO. 29; the amino acid sequence encoded by preF-T-Foldon is SEQ ID NO. 30. In one embodiment, the recombinant adenovirus vaccine of the present invention is characterized in that the recombinant adenovirus vector is obtained by integrating the plasmid pcDNA3.1-preF-T-Foldon with a backbone plasmid via homologous recombination, wherein the backbone plasmid is pAd26 and pChAd63.
[0011] In one embodiment, the recombinant adenovirus vaccine of the present invention is characterized in that the nucleotides encoding the respiratory syncytial virus MHC-II restricted antigen epitope peptide and the preF protein are connected by a linker, and the linker is selected from: a rigid linker, a flexible linker, an IRES connecting peptide, a 2A connecting peptide and other forms of linkers, preferably: EAAAK.
[0012] The present invention further provides a polynucleotide sequence, characterized in that it encodes any amino acid sequence of SEQ ID NOs. 1 to 24 and combinations thereof, SEQ ID NOs. 26 to 28, and SEQ ID NOs. 29-30.
[0013] The present invention further provides a plasmid, characterized in that the plasmid is pcDNA3.1-preF-T-Foldon.
[0014] The present invention further provides a recombinant adenoviral vector selected from: pAd26-preF-T-Foldon or pChAd63-preF-T-Foldon.
[0015] The present invention further provides a recombinant adenovirus expression system selected from the group consisting of: a eukaryotic expression system, a yeast expression system, an Escherichia coli expression system, and an insect cell expression system. In the recombinant adenovirus expression system, the cells are HEK293 cells.
[0016] The present invention further provides a respiratory syncytial virus MHC-II restricted antigen epitope peptide T selected from T1, T3, and T4, whose amino acid sequences correspond to:
[0017]
[0018]
[0019] In one embodiment, the method for preparing the recombinant adenovirus vaccine of the present invention comprises:
[0020] (1) Synthesizing a plasmid containing the nucleotide sequence described in pcDNA3.1-preF-T-Foldon;
[0021] (2) integrating the plasmid described in step (1) with the backbone plasmid by homologous recombination to obtain the recombinant adenovirus vector pAd26-preF-T-Foldon or pChAd63-preF-T-Foldon;
[0022] (3) linearizing the recombinant adenovirus vector of step (2) by digesting with Pac I to obtain a linearized plasmid, and transfecting the linearized plasmid into packaging cells such as HEK293 cells;
[0023] (4) culturing the cells described in step (3);
[0024] (5) Harvesting the replication-defective recombinant adenovirus rAd26-preF-T-Foldon or rChAd63-preF-T-Foldon released from the cells in step (4).
[0025] The present invention further includes preparing the above-mentioned recombinant adenovirus rAd26-preF-T-Foldon or rChAd63-preF-T-Foldon into a vaccine preparation, which is an injectable preparation, to which necessary vaccine carriers or vaccine adjuvants can be added as needed.
[0026] The combined epitope peptide complex is called: T, which is connected to the modified preF fusion protein through a linker, called: preF-T. Finally, the Foldon sequence is added to the C-terminus of the combined fragment to form a trimer expression, called: preF-T-Foldon.
[0027] The present invention provides a pcDNA3.1-preF-T-Foldon plasmid containing an optimized nucleotide sequence encoding a respiratory syncytial virus MHC-II restricted antigen epitope peptide and preF protein. The recombinant adenovirus expression vector is obtained by integrating the plasmid pcDNA3.1-preF-T-Foldon with a backbone plasmid via homologous recombination, wherein the backbone plasmids are pAd26 and pChAd63.
[0028] The recombinant adenovirus of the present invention is a replication-deficient recombinant adenovirus, which is prepared from the above-mentioned recombinant adenovirus vector. The replication-deficient recombinant adenovirus is rAd26-preF-T-Folden and rChAd63-preF-T-Folden.
[0029] The present invention provides a vaccine against respiratory syncytial virus, the active ingredient of which is the above-mentioned replication-deficient recombinant adenovirus.
[0030] The present invention provides a nucleotide sequence for expressing a respiratory syncytial virus MHC-II restricted antigen epitope peptide and preF protein, a recombinant adenovirus vector containing the nucleotide sequence, a recombinant adenovirus and a construction method. The resulting replication-deficient recombinant adenovirus can infect eukaryotic cells, thereby achieving the purpose of expressing the respiratory syncytial virus MHC-II restricted antigen epitope peptide and preF protein in eukaryotic cells, laying a good foundation for further research on respiratory syncytial virus vaccines.
[0031] The following is a further explanation and description of the terms appearing in the present invention:
[0032] Adenovirus: A non-enveloped DNA virus with a diameter of 70 to 90 nm and icosahedral symmetry that exists in the eyes, upper respiratory tract, and digestive tract of humans, other mammals, and birds.
[0033] Recombinant adenovirus: A replication-defective adenovirus modified by genetic engineering, an adenovirus that can only replicate in specific cell lines, and an adenovirus that can only infect the human body but not replicate.
[0034] Adenovirus vaccine: A vaccine prepared by cloning exogenous genes into an adenovirus vector and packaging it in a specific cell line with a replication-defective adenovirus.
[0035] rAd26: recombinant human adenovirus type 26
[0036] preF: Here specifically refers to the respiratory syncytial virus prefusion glycoprotein;
[0037] T: T cell epitope peptide combination or complex;
[0038] Foldon: domain structure of the T4 bacteriophage fibritin protein
[0039] rChAd63: recombinant chimpanzee adenovirus type 63
[0040] pAd26: human adenovirus type 26 backbone plasmid
[0041] pChAd63: Chimpanzee adenovirus type 63 backbone plasmid
[0042] RSV MHC-II restricted epitope peptide: RSV type II major histocompatibility complex epitope peptide;
[0043] Signal peptide: a short peptide chain that directs the transfer of newly synthesized proteins to the secretory pathway;
[0044] tPA: tissue plasminogen activator signal peptide
[0045] pcDNA3.1: plasmid pcDNA3.1
[0046] linker: connecting group;
[0047] Rigid linker: A linker with a relatively rigid structure that can effectively separate protein domains;
[0048] Flexible linker: a linker that does not affect the interaction or distance between protein domains;
[0049] IRES: internal ribosome entry site;
[0050] 2A: A short peptide with an average length of 18-22 amino acids, present in many viruses;
[0051] Plasmid: Any extrachromosomal genetic determinant;
[0052] Vector: refers to a self-replicating DNA molecule that transfers DNA fragments (target genes) to recipient cells in genetic engineering recombinant DNA technology;
[0053] Expression cassette: A set of DNA sequences consisting of a promoter, target gene, and reporter gene that can be expressed in specific tissues and easily detected;
[0054] Eukaryotic expression system: It is a type of expression system that uses DNA recombination technology to efficiently express genes encoding protective antigens of pathogenic microorganisms in yeast, insect cells, eukaryotic cells (such as CHO, 293 cells, etc.);
[0055] Yeast expression system: It is an expression system that uses DNA recombination technology to efficiently express genes encoding protective antigens of pathogenic microorganisms in yeast;
[0056] E. coli expression system: an expression system that uses DNA recombination technology to efficiently express genes encoding protective antigens of pathogenic microorganisms in E. coli;
[0057] Insect cell expression system: an expression system that uses DNA recombination technology to efficiently express genes encoding protective antigens of pathogenic microorganisms in insect cells;
[0058] HEK293 cells: human embryonic kidney cells 293;
[0059] Backbone plasmid: a plasmid containing important information such as promoter, terminator, resistance gene, etc.
[0060] Packaging cells: cell lines used for virus amplification or replication;
[0061] Defective recombinant adenovirus: an adenovirus that replicates only in specific cell lines;
[0062] Antigen combination: a combination of two or more antigens;
[0063] Epitope complex: a combination of multiple epitope peptides;
[0064] Sequence 1: Respiratory syncytial virus NS1 protein MHC-II restricted antigen epitope peptide
[0065] Sequence 2: Respiratory syncytial virus NS1 protein MHC-II restricted antigen epitope peptide
[0066] Sequence 3: Respiratory syncytial virus NS2 protein MHC-II restricted antigen epitope peptide
[0067] Sequence 4: Respiratory syncytial virus NS2 protein MHC-II restricted antigen epitope peptide
[0068] Sequence 5: Respiratory syncytial virus N protein MHC-II restricted antigen epitope peptide
[0069] Sequence 6: Respiratory syncytial virus N protein MHC-II restricted antigen epitope peptide
[0070] Sequence 7: Respiratory syncytial virus P protein MHC-II restricted antigen epitope peptide
[0071] Sequence 8: Respiratory syncytial virus P protein MHC-II restricted antigen epitope peptide
[0072] Sequence 9: Respiratory syncytial virus P protein MHC-II restricted antigen epitope peptide
[0073] Sequence 10: Respiratory syncytial virus M protein MHC-II restricted antigen epitope peptide
[0074] Sequence 11: Respiratory syncytial virus M protein MHC-II restricted antigen epitope peptide
[0075] Sequence 12: Respiratory syncytial virus SH protein MHC-II restricted antigen epitope peptide
[0076] Sequence 13: Respiratory syncytial virus SH protein MHC-II restricted antigen epitope peptide Sequence 14: Respiratory syncytial disease G virus NS1 protein MHC-II restricted antigen epitope peptide Sequence 15: Respiratory syncytial disease G virus NS1 protein MHC-II restricted antigen epitope peptide Sequence 16: Respiratory syncytial disease G virus NS1 protein MHC-II restricted antigen epitope peptide
[0077] Sequence 17: Respiratory syncytial virus F protein MHC-II restricted antigen epitope peptide
[0078] Sequence 18: Respiratory syncytial virus F protein MHC-II restricted antigen epitope peptide
[0079] Sequence 19: Respiratory syncytial virus F protein MHC-II restricted antigen epitope peptide Sequence 20: Respiratory syncytial virus M2-1 protein MHC-II restricted antigen epitope peptide Sequence 21: Respiratory syncytial virus M2-2 protein MHC-II restricted antigen epitope peptide Sequence 22: Respiratory syncytial virus M2-2 protein MHC-II restricted antigen epitope peptide
[0080] Sequence 23: Respiratory syncytial virus L protein MHC-II restricted antigen epitope peptide
[0081] Sequence 24: Respiratory syncytial virus L protein MHC-II restricted antigen epitope peptide sequence 25: Optimized respiratory syncytial virus prefusion protein (preF) amino acid sequence (preF) Sequence 26: Respiratory syncytial virus preF protein and respiratory syncytial virus F protein, G protein, and N protein selected 8 MHC-II restricted antigen epitope peptides tandem combination amino acid sequence (preF-T1)
[0082] Sequence 27: Amino acid sequence composed of a tandem combination of respiratory syncytial virus preF protein and 15 MHC-II restricted epitope peptides selected from respiratory syncytial virus F protein, G protein, N protein, P protein, M protein, and L protein (preF-T3)
[0083] Sequence 28: Amino acid sequence (preF-T4) composed of 15 MHC-II restricted epitope peptides selected from respiratory syncytial virus preF protein and respiratory syncytial virus F protein, G protein, N protein, NS1 protein, NS2 protein, M2-1 protein, and M2-2 protein.
[0084] Sequence 29: Amino acid sequence of the Foldon domain of the T4 bacteriophage fibritin protein Sequence 30: Amino acid sequence formed by the tandem combination of the amino acid sequences of eight MHC-II restricted antigen epitope peptides selected from the respiratory syncytial virus preF protein and the F, G, and N proteins of the respiratory syncytial virus, and Foldon (preF-T1-Foldon)
[0085] Sequence 31: Optimized respiratory syncytial virus prefusion protein (preF) nucleotide sequence (preF) Sequence 32: The translated amino acid sequence of the RSV preF protein and eight MHC-II restricted epitope peptides selected from RSV F, G, and N proteins (preF-T1)
[0086] Sequence 33: The translated nucleotide sequence of the amino acid sequence of the RSV preF protein and 15 MHC-II restricted epitope peptides selected from RSV F, G, N, P, M, and L proteins (preF-T3)
[0087] Sequence 34: The nucleotide sequence of the amino acid sequence of the RSV preF protein and 15 MHC-II restricted epitope peptides selected from RSV F, G, N, NS1, NS2, M2-1, and M2-2 proteins (preF-T4).
[0088] Sequence 35: The nucleotide sequence of the amino acid sequence of the preF protein of respiratory syncytial virus and the amino acid sequence of eight MHC-II restricted epitope peptides selected from the F, G, and N proteins of respiratory syncytial virus, and Foldon (preF-T1-Foldon) BRIEF DESCRIPTION OF THE DRAWINGS
[0089] Figure 1Schematic diagram of the respiratory syncytial virus antigen expression cassette of the present invention;
[0090] Figure 2 This is a diagram showing the identification of the recombinant adenovirus vector plasmid pAd26-preF-T-Foldon of the present invention after single digestion with the restriction endonuclease KpnI; and a diagram showing the identification of pChAd63-preF-T-Foldon after single digestion with the restriction endonuclease EcoRV.
[0091] Figure 3 Figure 2 shows the results of cytopathic effect formed by recombinant adenovirus rescue;
[0092] Figure 4 This is a graph showing the results of serum neutralizing antibodies after animals were immunized with the recombinant adenovirus in Example 6;
[0093] Figure 5 This is a diagram showing the cellular immune effect of animals immunized with the recombinant adenovirus in Example 6; DETAILED DESCRIPTION
[0094] The present invention provides the respiratory syncytial virus MHC-II restricted antigen epitope peptide amino acid sequence as shown in any one of SEQ ID NO.1 to 24; the modified preF amino acid sequence is shown in SEQ ID NO.25; the MHC-II restricted antigen epitope complex and preF are connected through a linker, and a Foldon sequence is added to the C-terminus of the combined fragment. The amino acid sequence of the antigen composition is shown in SEQ ID NO.30.
[0095] In the present invention, the amino acid sequence of the respiratory syncytial virus MHC-II restricted antigen epitope peptide and preF antigen composition (preF-T-Foldon) is obtained by artificial synthesis. The present invention has no special limitation on the method of artificial synthesis, and conventional methods in the art can be used.
[0096] The present invention also provides two replication-deficient recombinant adenoviral vectors, wherein the replication-deficient recombinant adenoviral vectors are pAd26 and pChAd63. The preF-T-Foldon plasmid described in the above scheme is integrated into the recombinant adenoviral vector by homologous recombination.
[0097] The present invention also provides a method for preparing the above-mentioned replication-defective adenovirus vector and constructing the above-mentioned recombinant adenovirus, the method comprising the following steps:
[0098] (1) constructing a pcDNA3.1-preF-T-Foldon vector containing the coding amino acid sequence;
[0099] (2) integrating the vector described in step (1) with the backbone plasmid by homologous recombination to obtain a recombinant adenovirus vector;
[0100] (3) linearizing the recombinant adenovirus vector of step (2) by Pac I digestion to obtain a linearized plasmid, and transfecting the linearized plasmid into packaging cells for culture;
[0101] (4) culturing the packaging cells described in step (3);
[0102] (5) Harvesting the replication-defective recombinant adenovirus released from the cells in step (4).
[0103] The packaging cells in step (3) are HEK293 cells.
[0104] The present invention provides a respiratory syncytial virus vaccine comprising the replication-deficient recombinant adenovirus described in the above scheme.
[0105] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0106] Example 1. Prediction of MHC-II restricted antigen epitopes of respiratory syncytial virus
[0107] 1.1 The amino acid sequences of 11 respiratory syncytial virus proteins (NS1, NS2, N, P, M, SH, G, F, M2-1, M2-2, and L) were retrieved from the NCBI website. MHC-II-restricted epitopes were predicted for these 11 proteins using the MHC-II Binding Tool (http: / / tools.iedb.org / mhcii / ). The prediction method used was the consensus method recommended by the IEDB Recommended Program, which uses the best possible prediction for a given MHC molecule. For each protein, the top-ranked short peptides for the MHC-II-restricted epitopes were selected for antigen combination. The specific sequences of the MHC-II-restricted epitopes identified are shown in Tables 1 to 11.
[0108] Table 1 MHC-II restricted epitope peptides of respiratory syncytial virus NS1 protein
[0109]
[0110]
[0111] Table 2 MHC-II restricted epitope peptides of respiratory syncytial virus NS2 protein
[0112]
[0113] Table 3 Respiratory syncytial virus N protein MHC-II restricted antigen epitope peptides
[0114]
[0115]
[0116] Table 4 Respiratory syncytial virus P protein MHC-II restricted antigen epitope peptides
[0117]
[0118] Table 5 Respiratory syncytial virus M protein MHC-II restricted antigen epitope peptides
[0119]
[0120]
[0121] Table 6 Respiratory syncytial virus SH protein MHC-II restricted antigen epitope peptides
[0122]
[0123] Table 7 MHC-II restricted epitope peptides of NS1 protein of respiratory syncytial disease G virus
[0124]
[0125] Table 8 Respiratory syncytial virus F protein MHC-II restricted antigen epitope peptides
[0126]
[0127]
[0128] Table 9 Respiratory syncytial virus M2-1 protein MHC-II restricted antigen epitope peptides
[0129]
[0130] Table 10 Respiratory syncytial virus M2-2 protein MHC-II restricted antigen epitope peptides
[0131]
[0132] Table 1 1 Respiratory syncytial virus L protein MHC-II restricted antigen epitope peptides
[0133]
[0134]
[0135] Example 2: Optimization of preF protein and construction of antigen composition
[0136] 2.1 The original signal peptide (1aa-30aa) of the preF protein was changed to the tissue plasminogen activator signal peptide tPA to further improve the expression level of the preF protein. At the same time, the transmembrane region and intracellular region (starting from amino acid position 547) of the preF protein were removed. The amino acid sequence information of the optimized preF protein is shown in SEQ ID NO.25, and its nucleotide sequence is shown in SEQ ID NO.31, of which 1bp-66bp are the tissue plasminogen activator signal peptide tPA, and 67bp-1512bp are the extracellular region of the preF protein.
[0137] 2.2 The MHC-II restricted antigen epitope peptides obtained by screening were connected with GPGPG to form an antigen epitope complex. The antigen epitope complex is based on the epitope peptides screened by the F protein, G protein and N protein of respiratory syncytial virus, and the epitope peptides screened by other proteins of respiratory syncytial virus are connected in series to form a new antigen complex T. The antigen epitope complex T is connected to the modified preF through a rigid linker (EAAAK) and named preF-T. Table 12 shows four antigen complexes in which MHC-II restricted antigen epitopes are randomly combined and connected to preF. The antigen complexes are scored for antigenicity using VaxiJen software. A score higher than 0.4 indicates that the composition is antigenic.
[0138] Table 12 Antigenicity scoring results of preF-T
[0139]
[0140]
[0141] It can be seen from the above table that at least preF-T1, preF-T3, and preF-T4 are immunogenic and can be used as vaccines.
[0142] The amino acid sequence of preF-T1 is a tandem combination of the optimized respiratory syncytial virus F protein and eight MHC-II restricted antigen epitope peptides selected from the respiratory syncytial virus F protein, G protein and N protein. The amino acid sequence information is shown in SEQ ID NO.26. The nucleotide sequence information of preF-T1 is shown in SEQ ID NO.32, wherein 1bp-66bp is the tissue plasminogen activator signal peptide tPA; 67bp-1512bp is the extracellular region of the preF protein; 1513bp-1527bp is the nucleotide sequence of the rigid linker (EAAAK); 1528bp-1572bp is the nucleotide sequence of the F protein MHC-II restricted antigen epitope peptide SEQ ID NO.17; 1573bp-1587bp is the nucleotide sequence of the linker (GPGPG); 1588bp-1632bp is the nucleotide sequence of the F protein MHC-II restricted antigen epitope peptide SEQ ID NO.18; 1633bp-1647bp is the nucleotide sequence of the linker (GPGPG); 1648bp-1692bp is the nucleotide sequence of the F protein MHC-II restricted antigen epitope peptide SEQ ID NO.19; 1693bp-1707bp is the nucleotide sequence of linker (GPGPG); 1708bp-1722bp is the nucleotide sequence of G protein MHC-II restricted antigen epitope peptide SEQ ID NO.14; 1723bp-1767bp is the nucleotide sequence of linker (GPGPG); 1768bp-1782bp is the nucleotide sequence of G protein MHC-II restricted antigen epitope peptide SEQ ID NO.15; 1783bp-1827bp is the nucleotide sequence of linker (GPGPG); 1828bp-1872bp is the nucleotide sequence of G protein MHC-II restricted antigen epitope peptide SEQ ID NO.16; 1873bp-1887bp is the nucleotide sequence of linker (GPGPG); 1888bp-1932bp is the nucleotide sequence of N protein MHC-II restricted antigen epitope peptide SEQ ID 1933bp-1947bp is the nucleotide sequence of linker (GPGPG); 1948bp-1992bp is the nucleotide sequence of N protein MHC-II restricted antigen epitope peptide SEQ ID NO.6.
[0143] The amino acid sequence of preF-T3 is a tandem combination of the optimized respiratory syncytial virus F protein and 15 MHC-II restricted antigen epitope peptides selected from the respiratory syncytial virus F protein, G protein, N protein, P protein, M protein and L protein. The amino acid sequence information is shown in SEQ ID NO.27. The nucleotide sequence information of preF-T3 is shown in SEQ ID NO.33, wherein 1bp-66bp is the tissue plasminogen activator signal peptide tPA; 67bp-1512bp is the extracellular region of the preF protein; 1513bp-1527bp is the nucleotide sequence of the rigid linker (EAAAK); 1528bp-1572bp is the nucleotide sequence of the F protein MHC-II restricted antigen epitope peptide SEQ ID NO.17; 1573bp-1587bp is the nucleotide sequence of the linker (GPGPG); 1588bp-1632bp is the nucleotide sequence of the F protein MHC-II restricted antigen epitope peptide SEQ ID NO.18; 1633bp-1647bp is the nucleotide sequence of the linker (GPGPG); 1648bp-1692bp is the nucleotide sequence of the F protein MHC-II restricted antigen epitope peptide SEQ ID NO. 1728bp-1782bp is the nucleotide sequence of G protein MHC-II restricted antigen epitope peptide SEQ ID NO.15; 1783bp-1827bp is the nucleotide sequence of linker (GPGPG); 1828bp-1872bp is the nucleotide sequence of G protein MHC-II restricted antigen epitope peptide SEQ ID NO.16; 1873bp-1887bp is the nucleotide sequence of linker (GPGPG); 1888bp-1932bp is the nucleotide sequence of N protein MHC-II restricted antigen epitope peptide SEQ ID NO. 5; 1933bp-1947bp is the nucleotide sequence of the linker (GPGPG); 1948bp-1992bp is the nucleotide sequence of the N protein MHC-II restricted antigen epitope peptide SEQ ID NO.6; 1993bp-2007bp is the nucleotide sequence of the linker (GPGPG); 2008bp-2052bp is the P protein MHC-II restricted antigen epitope peptide SEQ ID NO.7; 2053bp-2067bp is the nucleotide sequence of linker (GPGPG); 2068bp-2112bp is the nucleotide sequence of P protein MHC-II restricted antigen epitope peptide SEQ ID NO.8; 2113bp-2127bp is the nucleotide sequence of linker (GPGPG); 2128bp-2172bp is the nucleotide sequence of P protein MHC-II restricted antigen epitope peptide SEQ ID NO.9; 2173bp-2187bp is the nucleotide sequence of linker (GPGPG); 2188bp-2232bp is the nucleotide sequence of M protein MHC-II restricted antigen epitope peptide SEQ ID NO.10; 2234bp-2247bp is the nucleotide sequence of linker (GPGPG); 2248bp-2292bp is the nucleotide sequence of M protein MHC-II restricted antigen epitope peptide SEQ ID The nucleotide sequence of NO.11 is shown; 2293bp-2307bp is the nucleotide sequence of the linker (GPGPG); 2308bp-2352bp is the nucleotide sequence of the L protein MHC-II restricted antigen epitope peptide SEQ ID NO.23; 2353bp-2367bp is the nucleotide sequence of the linker (GPGPG); 2368bp-2412bp is the nucleotide sequence of the L protein MHC-II restricted antigen epitope peptide SEQ ID NO.24.
[0144] The amino acid sequence of preF-T4 is a tandem combination of the optimized respiratory syncytial virus F protein and 15 MHC-II restricted antigen epitope peptides selected from the respiratory syncytial virus F protein, G protein, N protein, NS1 protein, NS2 protein, M2-1 protein and M2-2 protein. The amino acid sequence information is shown in SEQ ID NO.28. The nucleotide sequence information of preF-T4 is shown in SEQ ID NO.34, wherein 1bp-66bp is the tissue plasminogen activator signal peptide tPA; 67bp-1512bp is the extracellular region of the preF protein; 1513bp-1527bp is the nucleotide sequence of the rigid linker (EAAAK); 1528bp-1572bp is the nucleotide sequence of the F protein MHC-II restricted antigen epitope peptide SEQ ID NO.17; 1573bp-1587bp is the nucleotide sequence of the linker (GPGPG); 1588bp-1632bp is the nucleotide sequence of the F protein MHC-II restricted antigen epitope peptide SEQ ID NO.18; 1633bp-1647bp is the nucleotide sequence of the linker (GPGPG); 1648bp-1692bp is the nucleotide sequence of the F protein MHC-II restricted antigen epitope peptide SEQ ID NO.19; 1693bp-1707bp is the nucleotide sequence of linker (GPGPG); 1708bp-1722bp is the nucleotide sequence of G protein MHC-II restricted antigen epitope peptide SEQ ID NO.14; 1723bp-1767bp is the nucleotide sequence of linker (GPGPG); 1768bp-1782bp is the nucleotide sequence of G protein MHC-II restricted antigen epitope peptide SEQ ID NO.15; 1783bp-1827bp is the nucleotide sequence of linker (GPGPG); 1828bp-1872bp is the nucleotide sequence of G protein MHC-II restricted antigen epitope peptide SEQ ID NO.16; 1873bp-1887bp is the nucleotide sequence of linker (GPGPG); 1888bp-1932bp is the nucleotide sequence of N protein MHC-II restricted antigen epitope peptide SEQ 1933bp-1947bp is the nucleotide sequence of the linker (GPGPG); 1948bp-1992bp is the nucleotide sequence of the N protein MHC-II restricted antigen epitope peptide SEQ ID NO.6; 1993bp-2007bp is the nucleotide sequence of the linker (GPGPG); 2008bp-2052bp is the nucleotide sequence of the NS1 protein MHC-II restricted antigen epitope peptide SEQ ID NO.1; 2053bp-2067bp is the nucleotide sequence of linker (GPGPG); 2068bp-2112bp is the nucleotide sequence of NS1 protein MHC-II restricted antigen epitope peptide SEQ ID NO.2; 2113bp-2127bp is the nucleotide sequence of linker (GPGPG); 2128bp-2172bp is the nucleotide sequence of NS2 protein MHC-II restricted antigen epitope peptide SEQ ID NO.3; 2173bp-2187bp is the nucleotide sequence of linker (GPGPG); 2188bp-2232bp is the nucleotide sequence of NS2 protein MHC-II restricted antigen epitope peptide SEQ ID NO.4; 2234bp-2247bp is the nucleotide sequence of linker (GPGPG); 2248bp-2292bp is the nucleotide sequence of M2-1 protein MHC-II restricted antigen epitope peptide SEQ ID 2293bp-2307bp is the nucleotide sequence of the linker (GPGPG); 2308bp-2352bp is the nucleotide sequence of the M2-2 protein MHC-II restricted antigen epitope peptide SEQ ID NO.21; 2353bp-2367bp is the nucleotide sequence of the linker (GPGPG); 2368bp-2412bp is the nucleotide sequence of the M2-2 protein MHC-II restricted antigen epitope peptide SEQ ID NO.22.
[0145] Thus, the present invention ultimately selected the most preferred vaccine, using the preF-T1 antigen combination as the candidate antigen complex, whose amino acid sequence is SEQ ID NO. 26. Subsequently, the Foldon sequence of SEQ ID NO. 29 was added to the C-terminus of the preF-T1 combination fragment to form the complete antigen combination SEQ ID NO. 30. The nucleotide sequence information of preF-T1-Foldon is shown in SEQ ID NO.35, wherein 1bp-66bp is the tissue plasminogen activator signal peptide tPA; 67bp-1512bp is the extracellular region of the preF protein; 1513bp-1527bp is the nucleotide sequence of the rigid linker (EAAAK); 1528bp-1572bp is the nucleotide sequence of the F protein MHC-II restricted antigen epitope peptide SEQ ID NO.17; 1573bp-1587bp is the nucleotide sequence of the linker (GPGPG); 1588bp-1632bp is the nucleotide sequence of the F protein MHC-II restricted antigen epitope peptide SEQ ID NO.18; 1633bp-1647bp is the nucleotide sequence of the linker (GPGPG); 1648bp-1692bp is the nucleotide sequence of the F protein MHC-II restricted antigen epitope peptide SEQ ID NO.19; 1693bp-1707bp is the nucleotide sequence of linker (GPGPG); 1708bp-1722bp is the nucleotide sequence of G protein MHC-II restricted antigen epitope peptide SEQ ID NO.14; 1723bp-1767bp is the nucleotide sequence of linker (GPGPG); 1768bp-1782bp is the nucleotide sequence of G protein MHC-II restricted antigen epitope peptide SEQ ID NO.15; 1783bp-1827bp is the nucleotide sequence of linker (GPGPG); 1828bp-1872bp is the nucleotide sequence of G protein MHC-II restricted antigen epitope peptide SEQ ID NO.16; 1873bp-1887bp is the nucleotide sequence of linker (GPGPG); 1888bp-1932bp is the nucleotide sequence of N protein MHC-II restricted antigen epitope peptide SEQ The nucleotide sequence of SEQ ID NO.5 is as follows; 1933bp-1947bp is the nucleotide sequence of linker (GPGPG); 1948bp-1992bp is the nucleotide sequence of N protein MHC-II restricted antigen epitope peptide SEQ ID NO.6; 1993bp-2079bp is the nucleotide sequence of Foldon amino acid sequence SEQ ID NO.29 that stabilizes the trimer conformation.
[0146] Example 3, vaccine design
[0147] The adenoviral vectors used in the examples of the present invention are modified human adenovirus type 26 and chimpanzee adenovirus type 63, both of which are rare serotypes. Compared to their wild-type counterparts, these modified adenoviruses lack part of the E1 gene and the entire E3 gene, which are essential for viral replication. The resulting recombinant adenoviruses can replicate only in a cell line expressing the E1 gene (HEK293 cells). After infecting animals or humans, the recombinant adenoviruses can express the inserted foreign gene but cannot replicate, thus achieving replication-defective properties and demonstrating safety.
[0148] The recombinant adenovirus constructed by the present invention contains a respiratory syncytial virus MHC-II restricted antigen epitope peptide and a modified preF protein (antigen composition) expression cassette. The expressed sequence is located between the cytomegalovirus (CMV) promoter and the SV40 polyadenylation tail termination sequence. A Kozak sequence that is beneficial to efficient gene expression is added before the amino acid sequence of the antigen composition. Figure 1 As shown, the Kozak sequence is GCCACC.
[0149] The replication-defective recombinant adenoviral vectors pAd26 and pChAd63 and pcDNA3.1-preF-T-Foldon were synthesized by Beijing Liuhe BGI Genomics Co., Ltd.
[0150] Example 4: Construction of recombinant adenovirus vector
[0151] Construction of recombinant adenoviral vector plasmids pAd26-preF-T-Foldon and pChAd63-preF-T-Foldon
[0152] (1) Using plasmid pcDNA3.1-preF-T-Foldon as a template, PCR was performed to obtain CMV-preF-T-Foldon-SV40 fragment 1 that could be recombined with the pAd26 backbone plasmid and CMV-preF-T-Foldon-SV40 fragment 2 that could be recombined with the pChAd63 backbone plasmid. The PCR primers were as follows: F-26S-G: TGGTACCGTCGACGCGGCCGCTCGAGCCTAAGCT R-26S-G: ATCAGTT ATCTAGATCC GGTGGATCGG ATATCTTAT F-63S-G: ACTCTTGAGTGCCAGCGAGTAGAGTTTACTGTAAT R-63S-G: CTGGAGCCGAACTCCGTCCCGTTGCGTTAAGATAC
[0153] (2) The pAd26 backbone plasmid was digested with restriction endonuclease Xba I and the pChAd63 backbone plasmid was digested with restriction endonuclease Hpa I. The vectors were obtained by ethanol precipitation and homologously recombined with the purified CMV-preF-T-Foldon-SV40 fragment 1 and CMV-preF-T-Foldon-SV40 fragment 2 using the Seamless Cloning Kit. The recombinant products were transformed into DH10B competent cells, clones were screened on ampicillin-resistant plates, clones were picked and identified by bacterial liquid PCR, and plasmids were extracted from positive clones. The pAd26-preF-T-Foldon plasmid was identified by single enzyme digestion with Kpn I. Figure 2 As shown; pChAd63-preF-T-Foldon was identified by EcoR V single enzyme digestion, as shown Figure 2 As shown, the correct plasmids were sent for sequencing identification, and the correct plasmids were the recombinant adenovirus vector plasmids pAd26-preF-T-Foldon and pChAd63-preF-T-Foldon.
[0154] Example 5: Packaging and identification of recombinant adenovirus
[0155] 5.1 Recombinant Adenovirus Packaging
[0156] (1) The recombinant adenovirus vector plasmids pAd26-preF-T-Foldon and pChAd63-preF-T-Foldon were digested with restriction endonuclease Pac I, and the linearized plasmids were recovered by ethanol precipitation;
[0157] (2) HEK293 cells were plated in six-well plates and transfected when the cell abundance reached 70%;
[0158] (3) Plasmid preparation: 4 μg of linearized plasmid and 10 μl of Lipofectamine 2000 liposomes were mixed with 250 μl of serum-free DMEM medium, and the mixture was allowed to stand at room temperature for 5 min. The two mixtures were then mixed together and allowed to stand at room temperature for 20 min.
[0159] (4) The mixture was added to a six-well plate in which HEK293 cells were cultured, and the culture medium was replaced with DMEM medium containing 2% calf serum and cultured at 37°C for 5 h;
[0160] (5) Observe the cell status and cell toxin release every 24 hours. The toxin release phenomenon is that the cells become larger and rounder, such as Figure 3 As shown (Figure a is a blank cell, Figure b is a cell pathological change picture), when most of the cells are pathological, the poison is collected.
[0161] (6) The virus-producing cells were repeatedly frozen and thawed three times in a -80°C refrigerator and a 37°C water bath to release the recombinant adenovirus from the cells. The cells were centrifuged at 4000 rpm for 10 min and the supernatant was collected, which was the first generation virus seed (P1) and used as the virus seed for subsequent expansion culture.
[0162] The packaged recombinant adenoviruses are rAd26-preF-T-Foldon and rChAd63-preF-T-Foldon. Example 6: Animal Immunization Experiment with Recombinant Adenovirus
[0163] 6.1 Animal immunization
[0164] Eight-week-old female BALB / c mice of similar weight were randomly divided into three groups of five each. Group 1 received a primary immunization with rAd26-preF-T-Foldon followed by a booster immunization with rChAd63-preF-T-Foldon; Group 2 received a primary immunization with rAd26-preF followed by a booster immunization with rChAd63-preF; and Group 3 received saline. Treatments: Primary immunization was administered intranasally on day 0, followed by a booster immunization 21 days after immunization. Serum and spleen cells were collected 35 days after immunization for serum antibody neutralization and cellular immune responses, respectively.
[0165] 6.1 Serum Neutralizing Antibody Detection
[0166] The serum of the immunized mice was neutralized with respiratory syncytial virus (RSV). Figure 4 As shown in Figure 3, BALB / c mice immunized with the recombinant adenovirus rAd26-preF-T-Foldon for the first immunization and rChAd63-preF-T-Foldon for the second immunization, and with the rAd26-preF for the first immunization and rChAd63-preF for the second immunization produced high neutralizing antibody titers in their sera.
[0167] 6.2 Cellular Immune Effect Detection
[0168] Splenocytes were collected from immunized mice and the T cell immune response induced by intranasal immunization was detected using ELISPOT assay. Short peptides of F protein, G protein, and N protein synthesized and screened by Nanjing GenScript Biotechnology Co., Ltd. were used in the ELISPOT assay to detect the number of IFN-γ secreting cells in mouse splenocytes. The results are shown in Figure 5 , the recombinant adenovirus rAd26-preF-T-Foldon primary immunization, rChAd63-preF-T-Foldon booster immunization group and the rAd26-preF primary immunization and rChAd63-preF booster immunization group, after immunization, BALB / c mice all produced a high cellular immune effect.
[0169] The above is only a preferred embodiment of the present invention, but it is not limited to the applications listed in the embodiment. It should be pointed out that for technicians familiar with this technical field, optimization and improvement can be easily achieved, which should be within the scope of protection of the present invention. The present invention is not limited to specific details.
Claims
1. A recombinant adenovirus vaccine, comprising recombinant adenoviruses named rAd26-preF-T-Foldon and rChAd63-preF-T-Foldon, wherein, rAd26-preF-T-Foldon contains the recombinant adenovirus vector pAd26-preF-T-Foldon; rChAd63-preF-T-Foldon contains the recombinant adenovirus vector pChAd63-preF-T-Foldon, wherein the amino acid sequence of the preF-T-Foldon is as shown in SEQ ID NO.
30.
2. A polynucleotide, characterized in that: It encodes the preF-T-Foldon described in claim 1.
3. A recombinant adenovirus vector, which includes pAd26-preF-T-Foldon and pChAd63-preF-T-Foldon, and contains the polynucleotide described in claim 2.
4. A recombinant adenovirus expression system containing the recombinant adenovirus vector described in claim 3, which is selected from: eukaryotic expression system and Escherichia coli expression system.
5. The recombinant adenovirus expression system described in claim 4, wherein the eukaryotic expression system is HEK293 cells.
Citation Information
Patent Citations
Combined vaccine for respiratory syncytial virus infection
CN112220921A
Preparation method of vaccine for respiratory syncytial virus infection
CN115161344A