AP205 or Lus nanoparticle-based pTau antigen compound, vaccine thereof, preparation method and application of AP205 or Lus nanoparticle-based pTau antigen compound and vaccine thereof

Abstract

The invention relates to a pTau antigen compound of an AP205 or Lus protein nanoparticle carrier, a vaccine containing the pTau antigen compound as well as a preparation method and application of the pTau antigen compound. According to the pTau antigen compound disclosed by the invention, pTau antigen epitope peptide is efficiently loaded on a protein nanoparticle carrier by utilizing a specific SpyCatcher-SpyTag biological coupling system and is self-assembled to form a 180 / 60 polymer spherical structure, so that the pTau antigen epitope peptide is displayed on the surface of the spherical structure to form an ordered and repeated antigen array; therefore, an organism can be stimulated to generate specific immune response aiming at pTau protein to the greatest extent, and the immunogenicity is relatively high; the vaccine based on the pTau antigen compound can induce an organism to generate a high-titer pTau antibody, and cannot induce generation of T cell reaction aiming at pTau, so that the vaccine has relatively high safety.

Description

Technical Field

[0001] The present invention relates to the field of biological vaccine technology, and in particular to a pTau antigen complex based on an AP205 or Lus protein nanoparticle carrier, a vaccine containing the same, and a preparation method and use thereof. Background Art

[0002] Alzheimer's disease (AD) is the most common neurodegenerative disease in the elderly. With the increasing aging of my country's population structure, aging-related diseases such as AD have become a major public health and social issue facing the country. Currently, AD drugs commonly used in clinical practice can only alleviate the symptoms to a certain extent, and cannot cure or prevent the progression of AD. Due to the long course of AD and the unclear pathogenesis, it has become one of the biggest black holes in the field of new drug research and development. In the past two decades, the failure rate of AD drug research and development has been as high as 99%. Although in recent years, China Green Valley's carbohydrate anti-AD drug GV-971 received conditional approval from the NMPA in 2019 and Biogen's Aβ antibody new drug Aducanumab received accelerated approval from the FDA in 2021, the efficacy and safety of both have caused great controversy. In January 2023, the FDA approved the Aβ antibody Lecanemab for the treatment of AD, but its market acceptance remains to be seen. Therefore, the pathological complexity and difficulty in curing AD seriously endanger the physical and mental health and quality of life of the elderly. There is an urgent need for new drugs to prevent and treat AD clinically.

[0003] Alzheimer's disease (AD) is a syndrome characterized by cognitive impairment, triggered by multiple central and peripheral factors. Its main features are Aβ deposition, Tau neurofibrillary tangles, and cognitive impairment. Currently, the etiology and pathogenesis of AD remain unclear. Researchers generally believe that the deposition of β-amyloid protein (Aβ) and Tau protein is the primary pathogenic agent of AD.

[0004] Although Aβ deposition plays a key role in the progression of AD, multiple lines of evidence indicate that abnormal aggregation caused by hyperphosphorylation of Tau protein and the resulting formation of NFTs are the real source of cognitive decline and memory loss in patients. Moreover, although targeted Aβ therapy has achieved good results in animal models, it has frequently failed in clinical trials. The main reasons are as follows: (1) Aβ oligomers are the most neurotoxic, but they exist in the Aβ cascade metabolic pathway for a very short time and are difficult to separate and purify, which brings certain difficulties to the analysis of the properties of Aβ oligomers and the synthesis of specific antibodies. (2) Although immunotherapy targeting Aβ has been shown to be able to clear Aβ plaques, it has not been shown to improve synaptic function. (3) Immunotherapy targeting Aβ can cause central nervous system inflammatory reactions and vasogenic edema, so there are a series of safety issues. Based on the above problems, researchers turned their attention to Tau. Active and passive immunization vaccines targeting Tau have entered the clinical stage. Although research on vaccines targeting Tau started relatively late, it has certain efficacy and high safety based on clinical conditions. In addition, more and more studies have shown that the correlation between Tau and AD is better than Aβ. Therefore, immunotherapy targeting Tau has broad prospects.

[0005] Tau protein is the major microtubule-associated protein in neurons. It is located in microtubule-associated neuronal axons, promoting microtubule assembly and stabilizing microtubule structure. It plays a key role in regulating microtubule dynamics, axonal transport, and axonal growth. Genetic evidence suggests that Tau can directly contribute to neurodegeneration and dementia, and its functions are regulated by site-specific phosphorylation. Extensive data confirm that abnormal phosphorylation leads to Tau dysfunction in neurodegenerative diseases such as AD. Hyperphosphorylated Tau loses its interaction with microtubules and forms neurofibrillary tangles (NFTs) that accumulate in neurons. Accumulated experimental results to date indicate that the longest human tau isoform, consisting of 441 amino acids, has a total of 85 phosphorylation sites, including 45 serine residues, 35 threonine residues, and 5 tyrosine residues. Sites with increased phosphorylation levels in the early stages of AD include Thr181, Ser199, Thr205, Thr212, Thr217, Thr231, Ser262, Ser396, and Ser404. Ser199 in tau is abnormally hyperphosphorylated in both the early and late stages of AD, while the phosphorylation level of Thr231 decreases with AD progression. Increased phosphorylation levels of Ser202, Thr205, Ser409, and Ser422 occur in the late stages of NFT. Thr212, Ser214, Thr231, Ser235 and Ser262 are the main sites for Tau to bind to microtubules. Phosphorylated Thr231 is a residue that is abnormally resistant to dephosphorylation, and increased phosphorylation levels can predict the conversion of patients with mild cognitive impairment to AD; phosphorylated Thr181 is a recognized core biomarker for AD in CSF; increased phosphorylation of Tau at Ser396 and Ser404 impairs microtubule assembly by separating normal Tau molecules from microtubules, producing more protofibrillar Tau in vitro; increased phosphorylation of Ser202 and Thr205 reduces Tau microtubule nucleation activity, microtubule depolymerization and instability, and is also related to the subsequent conversion to protofilaments and filaments; phosphorylation of Thr205 can specifically inhibit the toxicity of Aβ and is the only site with a protective effect rather than a toxicity-promoting effect; phosphorylation of Ser199 is a key step in the imbalance of fragile neurons in AD to neurofibrillary degeneration. Yu et al. have shown that phosphorylation at Thr181, Thr205, Thr217, and Ser404 plays a key role in neurite outgrowth during the rat embryonic and early postnatal periods. Therefore, vaccines targeting different phosphorylation sites may have different therapeutic effects and safety issues. Furthermore, Tau aggregates can impede endoplasmic reticulum and mitochondrial function, leading to oxidative stress and amplifying the toxic effects of Tau tangles.

[0006] Current active immunotherapies targeting tau protein include AADvac1 and ACI-35. AADvac1 uses keyhole limpet hemocyanin (KLH) as a carrier and amino acids 294-305 of tau protein as an antigenic epitope to induce the production of the antibody DC8E8, which targets the tau-tau interaction. Its immunogenicity and safety have been demonstrated in clinical trials, but the specific effects of the AADvac1 vaccine on cognitive decline in Alzheimer's patients are currently uncertain. The ACI-35 vaccine contains a synthetic phosphorylated peptide that mimics tau protein phosphorylated at the S396 / S404 sites and has demonstrated immunogenicity and safety in animal models. Furthermore, passive immunotherapy with antibodies targeting pathologically phosphorylated tau protein offers improved specificity and reduced adverse reactions. The monoclonal antibody BIIB092 recognizes the N-terminal sequence of tau protein and has been shown to reduce free tau levels in cerebrospinal fluid. This antibody is currently undergoing Phase II clinical trials. The monoclonal antibody ABBV-8E12 recognizes amino acids 25-30 near the N-terminal sequence of Tau and has been shown to improve insoluble Tau protein and brain neurofibrillary pathology in Tau P301S transgenic mice, with safety demonstrated in clinical trials. The monoclonal antibody RO7105705 targets the N-terminal domain of all six human Tau isoforms and has demonstrated varying degrees of reduction in plasma Tau levels and brain Tau pathology in transgenic mice in preclinical studies. Its safety has also been demonstrated in clinical trials. In summary, while immunotherapies targeting Tau have made some progress, none have been successfully marketed. Therefore, the development of an active vaccine targeting Tau is crucial. Summary of the Invention

[0007] Purpose of the Invention

[0008] In response to the problems or needs in the prior art, the object of the present invention is to provide a pTau antigen complex with high immunogenicity and safety, a vaccine composition based on the pTau antigen complex, and its preparation method and use.

[0009] The present invention utilizes self-assembling protein nanoparticles as vaccine carriers, and displays the pTau antigen on the surface of the self-assembling nanoparticles through a bioconjugation method, thereby inducing a strong immune response and stimulating the body to produce high-titer phosphorylated Tau antibodies. At the same time, no T cell immune response against the full-length Tau protein is generated, which not only ensures the immune effect but also avoids the occurrence of side effects, and is conducive to promoting the research and development of active immunotherapy for AD.

[0010] Solution

[0011] In order to achieve the above object, the present invention provides the following technical solutions:

[0012] In a first aspect, the present invention provides a pTau antigen complex comprising:

[0013] (1) a pTau epitope peptide with a first tag, and

[0014] (2) protein nanoparticles selected from the group consisting of AP205 nanoparticles and Lus nanoparticles; wherein the AP205 nanoparticles comprise a bacteriophage major capsid protein AP205 expressed in fusion with a second tag, and the Lus nanoparticles comprise 2,4-dioxotetrahydropteridine synthase (Lus) expressed in fusion with a second tag;

[0015] Wherein, an isopeptide bond is spontaneously formed between the second tag and the first tag, thereby covalently linking the pTau antigen epitope peptide to the protein nanoparticle.

[0016] Preferably, the pTau antigen epitope peptide comprises at least one polypeptide fragment from a full-length human Tau protein, wherein the polypeptide fragment comprises at least one phosphorylation site. The polypeptide fragment is preferably 7 to 11 amino acids in length, for example, 9 amino acids. The phosphorylation site is preferably located on a serine and / or threonine residue in the polypeptide fragment.

[0017] Preferably, the full-length Tau protein comprises the amino acid sequence shown in SEQ ID NO: 84. In a feasible embodiment, the amino acid sequence of the full-length Tau protein is shown in SEQ ID NO: 84.

[0018] In the present invention, the position of the phosphorylation site is preferably selected from the group consisting of Thr181, Ser262, Ser202, Thr205, Thr217, Thr231, Ser396, Ser404 and Ser199, and more preferably selected from the group consisting of Thr181, Ser262, Ser202, Thr205, Thr217, Thr231, Ser396 and Ser404, wherein the amino acid site corresponds to the full-length Tau protein.

[0019] In a feasible embodiment of the present invention, the pTau antigen epitope peptide comprises two phosphorylation sites. More specifically, the pTau antigen epitope peptide comprises, preferably from N-terminus to C-terminus, the following phosphorylation sites: 181 (P-Thr181) and 262 (P-Ser262); 181 (P-Thr181) and 202 (P-Ser202); 181 (P-Thr181) and 205 (P-Thr205); 181 (P-Thr181) and 217 (P-Thr217); 181 (P-Thr181) and 231 (P-Thr231); 181 (P-Thr181) and 396 (P-Ser396); 181 (P-Thr181) and 404 (P-Ser404); 262 (P -Ser262) and 202 (P-Ser202); 262 (P-Ser262) and 205 (P-Thr205); 262 (P-Ser262) and 217 (P-Thr217); 262 (P-Ser262) and 231 (P-Thr231); 262 (P-Ser262) and 396 (P-Ser396); 262 (P-Ser262) and 404 (P-Ser404); 202 (P-Ser202) and 205 (P-Thr205); 202 (P-Ser202) and 217 (P-Thr217); 202 (P-Ser202) and 231 (P-Thr r231); 202 (P-Ser202) and 396 (P-Ser396); 202 (P-Ser202) and 404 (P-Ser404); 205 (P-Thr205) and 217 (P-Thr217); 205 (P-Thr205) and 231 (P-Thr231); 205 (P-Thr205) and 396 (P-Ser396); 205 (P-Thr205) and 404 (P-Ser404); 217 (P-Thr217) and 231 (P-Thr231); 217 (P-Thr217) and 396 (P-Ser396); 217 (P-Thr21 7) and 404 (P-Ser404); 231 (P-Thr231) and 396 (P-Ser396); 231 (P-Thr231) and 404 (P-Ser404); 396 (P-Ser396) and 404 (P-Ser404); 199 (P-Ser199) and 181 (P-Thr181); 199 (P-Ser199) and 202 (P-Ser202); 199 (P-Ser199) and 205 (P-Thr205); 199 (P-Ser199) and 217 (P-Thr217); 199 (P-Ser199) and 231 (P-Thr231);199 (P-Ser199) and 262 (P-Ser262); 199 (P-Ser199) and 396 (P-Ser396); or 199 (P-Ser199) and 404 (P-Ser404). Preferably, the polypeptide fragment is selected from the group consisting of Tau177-185 (positions 177-185 of the full-length Tau protein), Tau195-203, Tau198-206, Tau201-209, Tau204-209, Tau213-221, Tau227-235, Tau258-266, Tau392-400, and Tau400-408, more preferably selected from the group consisting of Tau177-185, Tau198-206, Tau201-209, Tau204-209, Tau213-221, Tau227-235, Tau258-266, Tau392-400, and Tau400-408.

[0020] In a feasible embodiment, the pTau antigen epitope peptide comprises a plurality of polypeptide fragments from human full-length Tau protein, and different polypeptide fragments are operably connected to each other, for example, by peptide bonds or linkers. Preferably, the linker is a (GSG)n linker, wherein n is an integer of 1-3. Preferably, the pTau antigen epitope peptide comprises, preferably comprising the following polypeptide fragments from N-terminus to C-terminus: Tau177-185 and Tau258-266, Tau177-185 and Tau198-206, Tau177-185 and Tau201-209, Tau177-185 and Tau213-221, Tau177-185 and Tau227-235, Tau177-185 and Tau392-400, Tau177-185 and Tau400-408, Tau19 8-206 and Tau258-266, Tau201-209 and Tau258-266, Tau213-221 and Tau258-266, Tau227-235 and Tau258-266, Tau258-266 and Tau392-400, Tau258-266 and Tau400-408, Tau198-209, Tau198-206 and Tau213-221, Tau198-206 and Tau227-235, Tau198-206 and Tau3 92-400, Tau198-206 and Tau400-408, Tau204-209 and Tau213-221, Tau204-209 and Tau227-235, Tau204-209 and Tau392-400, Tau204-209 and Tau400-408, Tau213-221 and Tau227-235, Tau213-221 and Tau392-400, Tau213-221 and Tau400-408, Tau227-235 and Tau 392-400, Tau227-235 and Tau400-408, Tau392-408, Tau177-185 and Tau195-203, Tau195-206, Tau195-209, Tau195-203 and Tau213-221, Tau195-203 and Tau227-235, Tau195-203 and Tau258-266, Tau195-203 and Tau392-400, or Tau195-203 and Tau400-408.

[0021] In a feasible embodiment of the present invention, the pTau antigen epitope peptide comprises a sequence as shown in any one of SEQ ID NOs: 12-47. The corresponding phosphorylation sites in the sequence are specifically shown in the following table:

[0022]

[0023]

[0024] Note: The above amino acid sites correspond to the full-length Tau protein (SEQ ID NO: 84).

[0025] Preferably, the pTau antigen epitope peptide comprises a sequence as shown in any one of SEQ ID NOs: 12-39.

[0026] Preferably, the pTau antigen epitope peptide is connected to the first tag via a linker, preferably a (GSG)n linker, wherein n is an integer of 1-3, preferably 1.

[0027] In a feasible embodiment, the first tag can be at the amino terminus of the pTau antigen epitope peptide or at the carboxyl terminus of the antigen epitope peptide. Preferably, the pTau antigen epitope peptide is located at the carboxyl terminus of the first tag.

[0028] Preferably, the first tag is a SpyTag tag. In one feasible embodiment, the SpyTag tag comprises the amino acid sequence shown in SEQ ID NO: 3, for example, the amino acid sequence of the SpyTag tag is shown in SEQ ID NO: 3. In one feasible embodiment, the pTau antigen epitope peptide with the first tag comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 48-83.

[0029] Preferably, the phage major capsid protein AP205 or the 2,4-dioxotetrahydropteridine synthase is connected to the second tag via a linker; the linker preferably comprises the amino acid sequence shown in SEQ ID NO: 94.

[0030] Preferably, the phage major capsid protein AP205 or the 2,4-dioxotetrahydropterin synthase is located at the carboxyl end of the second tag.

[0031] Preferably, the second tag is a SpyCatcher tag; further preferably, the SpyCatcher tag is a full-length SpyCatcher tag with an amino acid sequence as shown in SEQ ID NO: 4, or a truncated SpyCatcher tag with an amino acid sequence as shown in SEQ ID NO: 5, preferably a truncated SpyCatcher tag with an amino acid sequence as shown in SEQ ID NO: 5; preferably, the second tag is fused to the amino terminus of the phage major capsid protein AP205 or 2,4-dioxotetrahydropteridine synthase.

[0032] In a feasible embodiment, the bacteriophage major capsid protein AP205 comprises the amino acid sequence shown in SEQ ID NO: 2, for example, the amino acid sequence of the bacteriophage major capsid protein AP205 is shown in SEQ ID NO: 2. The nucleotide sequence encoding it preferably comprises the sequence shown in SEQ ID NO: 7.

[0033] In a feasible embodiment, the 2,4-dioxeteridine synthase is derived from a hyperthermophilic bacterium, and preferably comprises the amino acid sequence shown in SEQ ID NO: 1. In a specific embodiment, the amino acid sequence of the 2,4-dioxeteridine synthase is shown in SEQ ID NO: 1. The nucleotide sequence encoding it preferably comprises the sequence shown in SEQ ID NO: 6.

[0034] Most preferably, the fusion protein of the SpyCatcher and the phage major capsid protein AP205 comprises the amino acid sequence shown in SEQ ID NO: 11, and the fusion protein of the SpyCatcher and the 2,4-dioxotetrahydropteridine synthase comprises the amino acid sequence shown in SEQ ID NO: 10.

[0035] In a feasible embodiment, the pTau antigen epitope peptide connected by the isopeptide bond between the first tag and the second tag self-assembles with the AP205 nanoparticles to form a spherical structure, preferably a 180-mer spherical structure, and the pTau antigen epitope peptide is located on the surface of the spherical structure.

[0036] In a feasible embodiment, the pTau antigen epitope peptide connected by the isopeptide bond between the first tag and the second tag self-assembles with the Lus nanoparticle to form a spherical structure, preferably a 60-mer spherical structure, and the pTau antigen epitope peptide is located on the surface of the spherical structure.

[0037] Preferably, the molar ratio of the pTau antigen epitope peptide with the first tag to the second tag constituting the protein nanoparticles and the fusion protein of the phage major capsid protein AP205 or 2,4-dioxotetrahydropteridine synthase is (2-10):1, preferably (4-8):1, for example, 5:1.

[0038] Spycatcher-SpyTag is derived from the CnaB2 domain of the FbaB protein of Streptococcus pyogenes (S. pyogenes). This domain is bifurcated: the N-terminal segment is called SpyTag (sequence shown in SEQ ID NO:3), and the remainder is called Spycatcher (sequence shown in SEQ ID NO:4). Spycatcher is a gene-encoded protein consisting of 138 amino acids (15 kDa) and contains the active lysine K31 and the catalytically active glutamic acid E77. SpyTag is a small 13-amino acid peptide containing the active aspartic acid D117. Upon simple mixing of the two under a wide range of conditions (pH, buffer, and temperature), lysine K31 and aspartic acid D117 spontaneously form an irreversible isopeptide bond catalyzed by glutamic acid E77. This reaction is highly efficient and does not require additional chemical or enzymatic crosslinking agents, significantly minimizing protein denaturation during surface loading.

[0039] In a preferred embodiment of the present invention, a truncated Spycatcher (sequence shown in SEQ ID NO: 5) is selected as the second tag to be fused with the phage major capsid protein AP205 or 2,4-dioxotetrahydropteridine synthase. The truncated Spycatcher retains the biologically active portion without affecting the formation of the isopeptide bond and the connection efficiency. The connection system has the advantages of simplicity, stability, and high specificity. It can efficiently couple the pTau small peptide to the surface of protein nanoparticles. After connection, it can still form a stable nanoparticle structure and has high immunogenicity.

[0040] In a second aspect, the present invention provides a method for preparing the pTau antigen complex as described in the first aspect, comprising the following steps:

[0041] (1) preparing a pTau antigen epitope peptide with a first tag;

[0042] (2) preparing a fusion protein of the second tag and the phage major capsid protein AP205 or 2,4-dioxotetrahydropteridine synthase, which self-assembles to form protein nanoparticles;

[0043] (3) mixing the pTau antigen epitope peptide with the first tag obtained in step (1) with the protein nanoparticles obtained in step (2) to perform a coupling reaction to obtain the pTau antigen complex.

[0044] In the above preparation method, preferably, in step (1), the pTau antigen epitope peptide with the first tag is prepared by artificial synthesis;

[0045] Preferably, in step (2), the protein nanoparticles are prepared by a method comprising the following steps:

[0046] 1) Synthesizing a DNA fragment encoding a fusion protein of the second tag and the phage major capsid protein AP205 or 2,4-dioxotetrahydropteridine synthase;

[0047] 2) constructing the DNA fragment into an expression vector to obtain a recombinant expression vector;

[0048] 3) transferring the recombinant expression vector into a protein expression system for expression to obtain a fusion protein of the second tag and the phage major capsid protein AP205 or 2,4-dioxotetrahydropteridine synthase, which self-assembles to form protein nanoparticles;

[0049] Preferably, in step (1), the DNA fragment comprises a nucleotide sequence as shown in SEQ ID NO: 8 or SEQ ID NO: 9.

[0050] Preferably, in step (3), the molar ratio of the pTau antigen epitope peptide with the first tag to the second tag constituting the protein nanoparticle and the fusion protein of the phage major capsid protein AP205 or 2,4-dioxotetrahydropteridine synthase is (2-10):1, preferably (4-8):1, for example 5:1;

[0051] Preferably, in step (3), the coupling reaction is carried out in a Tris buffer system, and preferably, the pH of the Tris buffer system is 7.5 to 8.0.

[0052] Preferably, in step (3), the reaction temperature of the coupling reaction is 4-6°C, preferably 4°C; and the reaction time is 12-16h, preferably 14h.

[0053] Preferably, in step (3), the concentration of the fusion protein is 1-2 mg / mL.

[0054] Preferably, in step (3), the expression system is a eukaryotic expression system or a prokaryotic expression system. The eukaryotic expression system is, for example, yeast (Saccharomyces cerevisiae) or the prokaryotic expression system is, for example, Escherichia coli.

[0055] Preferably, step (3) further comprises the step of removing unsuccessfully linked protein nanoparticle carriers and / or pTau antigen epitope peptides by centrifugation, dialysis and / or ultrafiltration.

[0056] In a third aspect, the present invention provides a vaccine composition comprising the pTau antigen complex as described in the first aspect above;

[0057] Preferably, the vaccine composition further comprises a pharmaceutically acceptable adjuvant; further preferably, the pharmaceutically acceptable adjuvant is selected from MF59 and CpG, preferably a combination of MF59 and CpG.

[0058] In a fourth aspect, the present invention provides use of the pTau antigen complex as described in the first aspect or the vaccine composition as described in the third aspect in the preparation of a medicament for preventing and / or treating a neurodegenerative disorder in a subject;

[0059] Preferably, the neurodegenerative disorder is selected from the group consisting of Alzheimer's disease, Down syndrome, prion protein cerebral amyloid angiopathy and traumatic brain injury, amyotrophic lateral sclerosis / Parkinson's disease-dementia syndrome, preferably Alzheimer's disease;

[0060] Preferably, the subject is a mammal, preferably a human.

[0061] In a fifth aspect, the present invention provides use of the pTau antigen complex as described in the first aspect or the vaccine composition as described in the third aspect in the preparation of a drug for maintaining or improving, preferably restoring, and more preferably completely restoring cognitive memory in a subject;

[0062] Preferably, the subject is a mammal, preferably a human.

[0063] In a sixth aspect, the present invention provides a method for preventing and / or treating a neurodegenerative disorder, the method comprising: administering to a subject a preventively and / or therapeutically effective amount of the pTau antigen complex as described in the first aspect or the vaccine composition as described in the third aspect;

[0064] Preferably, the subject is a mammal, preferably a human.

[0065] In a twelfth aspect, the present invention provides a method for maintaining or improving, preferably restoring, and more preferably completely restoring cognitive memory in a subject, the method comprising: administering to the subject an effective amount of the pTau antigen complex as described in the first aspect or the vaccine composition as described in the third aspect;

[0066] Preferably, the subject is a mammal, preferably a human.

[0067] In a feasible embodiment of the above aspects, the pTau antigen complex as described in the first aspect or the vaccine composition as described in the third aspect is administered to the subject subcutaneously or intramuscularly (preferably intramuscularly).

[0068] Beneficial effects

[0069] The pTau antigen complex based on a protein nanoparticle carrier of the present invention utilizes a specific SpyCatcher-SpyTag biocoupling system to efficiently load the pTau antigen epitope peptide onto the protein nanoparticle carrier. The protein nanoparticles loaded with the pTau antigen epitope peptide can still self-assemble into a 180 / 60-mer spherical structure, so that the pTau antigen epitope peptide is displayed on the surface of the spherical structure, forming an ordered and repetitive antigen array, thereby stimulating the body to produce a specific immune response against the pTau protein to the greatest extent and having high immunogenicity. The inventors also conducted animal immunization experiments on vaccines containing the pTau antigen complex. The results showed that the vaccine can induce the body to produce high-titer pTau antibodies, alleviate cognitive impairment in animals, and does not induce T cell responses against pTau, thus having high safety.

[0070] In summary, the vaccine based on the pTau antigen complex of the present invention is an ideal vaccine with high immunogenicity and high safety, and has been confirmed by animal experiments to have good therapeutic effects on neurological disorders, and therefore has good clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] One or more embodiments are exemplarily illustrated by the accompanying figures, and these exemplary illustrations do not limit the embodiments. The word "exemplary" is used herein to mean "serving as an example, example, or illustration." Any embodiment described herein as "exemplary" is not necessarily to be construed as superior or preferred over other embodiments.

[0072] Figure 1A Schematic diagram of the SpyCatcher-LuS-pET26b recombinant plasmid obtained by fusion expression of SpyCatcher to the amino terminus of LuS protein and ligation into the pET26b vector; Figure 1B Schematic diagram of the SpyCatcher-AP205-pET26b recombinant plasmid obtained by fusion expression of SpyCatcher to the amino terminus of AP205 protein and ligation into the pET30a vector.

[0073] FIG2A shows the electron microscopic characterization of the SpyCatcher-LuS recombinant protein of the present invention; FIG2B shows the electron microscopic characterization of the SpyCatcher-AP205 recombinant protein of the present invention.

[0074] FIG3A to FIG3R show electron microscopic characterizations of the LuS-Spy-pTau (L1-L18) protein particles of the present invention.

[0075] FIG4A to FIG4R show electron microscopic characterizations of the LuS-Spy-pTau (L19-L36) protein particles of the present invention.

[0076] FIG5A to FIG5R show electron microscopic characterizations of the AP205-Spy-pTau (A1-A18) protein particles of the present invention.

[0077] FIG6A to FIG6R show electron microscopic characterizations of the AP205-Spy-pTau (A19-A36) protein particles of the present invention.

[0078] Figures 7A to 7K The figure shows the ELISPOT results for different phosphorylation sites (pTau181 / pTau199 / pTau202 / pTau205 / pTau217 / pTau231 / pTau262 / pTau396 / pTau404) and the full-length Tau protein after immunization of Tau P301S mice with LuS-Spy-pTau / AP205-Spy-pTau vaccine.

[0079] Figures 8A to 8H The figure shows the results of a water maze test (latency) to evaluate the cognitive ability of each group of mice after immunization of Tau P301S mice with the LuS-Spy-pTau / AP205-Spy-pTau vaccine.

[0080] Figures 9A to 9B The figure shows the results of a water maze test (number of platform crossings) to evaluate the cognitive ability of each group of mice after immunization of Tau P301S mice with the LuS-Spy-pTau / AP205-Spy-pTau vaccine.

[0081] FIG. 10A to FIG. 10B The figure shows the results of a nesting experiment to evaluate the cognitive ability of each group of mice after immunization of Tau P301S mice with the LuS-Spy-pTau / AP205-Spy-pTau vaccine. DETAILED DESCRIPTION

[0082] Unless expressly stated otherwise, throughout the specification and claims, the term "comprise" or variations such as "include" or "comprising", etc., will be understood to include the stated elements or components but not to exclude other elements or other components.

[0083] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art.

[0084] Unless otherwise specifically defined elsewhere herein, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0085] The preferred embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that the following examples are provided only for the purpose of illustrating the present invention and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0086] Example 1 Preparation of pTau polypeptide antigen epitope

[0087] In this example, based on the human full-length Tau protein (SEQ ID NO: 84), the inventors designed the following 36 pTau polypeptide antigen epitopes comprising two polypeptide fragments selected from the human full-length Tau protein. For specific sequence information, see Table 1 below.

[0088] Table 1 Sequence information of 28 pTau peptide antigen epitopes

[0089]

[0090]

[0091] The amino termini of the 36 pTau polypeptide antigen fragments described above were linked to the carboxyl termini of SpyTag (amino acid sequence shown in SEQ ID NO: 3) using GSG as a linker, and synthesized by GLbiochem (Shanghai) Ltd. to obtain SpyTag-pTau. Specific sequence information is shown in Table 2 below.

[0092] Table 2 Sequence information of 36 SpyTag-pTau peptide epitopes

[0093]

[0094]

[0095] Example 2 Expression vector construction

[0096] Construction of recombinant nanoparticle vector plasmid

[0097] NdeI and BamHI were selected as restriction sites for fusion expression, and the nucleotide sequence of SpyCatcher was fused to the nucleotide sequence of LuS / AP205 (fused at the amino terminus of LuS / AP205, and 6 histidine tags were added to the amino terminus of SpyCatcher). A nucleotide sequence encoding (GSGGSGGSG, SEQ ID NO: 94) was used as a linker between the nucleotide sequence of LuS / AP205 and the nucleotide sequence of SpyCatcher, and a nucleotide sequence encoding (GSG) was used as a linker between the nucleotide sequence of SpyCatcher and its amino-terminal histidine tag. The above-mentioned SpyCatcher-LuS synthetic sequence was connected to the commercial vector pET-26b(+) vector, and the above-mentioned SpyCatcher-AP205 synthetic sequence was connected to the commercial vector pET-30a vector to obtain a recombinant plasmid (see Figure 1A 、 Figure 1B The amino acid sequences of SpyCatcher-LuS and SpyCatcher-AP205 are shown in SEQ ID NO: 10 and SEQ ID NO: 11, respectively, in the sequence listing.

[0098] The nucleotide sequence encoding the SpyCatcher-LuS of the present invention is shown in SEQ ID NO: 8, and the nucleotide sequence encoding the SpyCatcher-AP205 of the present invention is shown in SEQ ID NO: 9.

[0099] Example 3 Preparation and identification of recombinant nanoparticle vaccines

[0100] 1. Expression, purification and identification of recombinant nanoparticle vaccine protein vectors

[0101] Expression of fusion proteins

[0102] Step 1: Take 1 μL of the recombinant nanoparticle vaccine vector solution obtained in Example 2 above (containing 100 ng of recombinant expression plasmid) and add it to 50 μL of Escherichia coli BL21 (DE3) competent cells (purchased from TransGen), ice bath for 30 minutes, then heat shock in a 42°C water bath for 45 seconds, and then ice bath for 2 minutes.

[0103] Step 2: Add 500 μL of LB medium to the mixture obtained in step 1 and culture at 220 rpm / min and 37°C for 1 h.

[0104] Step 3: The mixture obtained in step 2 is evenly spread on LB solid culture medium containing kanamycin resistance and cultured at 37°C for 24 hours to obtain a strain that stably expresses the recombinant protein.

[0105] Step 4: Pick a growing colony and inoculate it into 20 mL of LB medium, culture it at 37°C, 220 rpm, and when the OD value of the culture mixture reaches 0.6-0.8, induce it with isopropylthiogalactoside (IPTG, final concentration 0.5 mM / L) and incubate it at 16°C, 220 rpm overnight.

[0106] Step 5: After induction, centrifuge the bacterial solution at 4000 rpm for 30 min, discard the supernatant, resuspend the bacterial pellet with PBS, and centrifuge again at 6000 rpm for 15 min. Discard the supernatant to obtain the bacterial pellet containing the target protein.

[0107] Step 6: Add 20 mL of protein buffer (pH 8.0, containing 50 mM Tris, 300 mM KCl) to the resulting bacterial pellet and resuspend. Disrupt the cells by sonication on ice for 30 minutes. Centrifuge the mixture at 16,000 rpm and 4°C for 30 minutes, and collect the supernatant. Pass the supernatant through a 0.45 μm filter to obtain a crude protein extract.

[0108] Purification of fusion proteins

[0109] The crude protein extract was purified using a His-Trap HP affinity chromatography column (purchased from GE). The supernatant was filtered through a 0.45 μm membrane and then affinity chromatographed on a His-Trap HP column using an SDL protein chromatography system. Gradient elution was performed using an imidazole solution (imidazole concentration gradually increased from 50 mM / L to 500 mM / L), and the eluates were collected for SDS-PAGE electrophoresis. The protein collection liquid with higher purity was concentrated using an ultrafiltration tube (4000 rpm, 4°C, 18 min), and then the 60-mer form and the 180-mer form of the recombinant protein in Example 3 were further separated and purified using Superdex200 molecular sieve (purchased from GE). The operation steps were as follows: the column was rinsed with ultrapure water for 2 column volumes at a flow rate of 1 mL / min, and then the column was equilibrated with a volume of approximately 50 mL of PBS buffer at pH 7.0±0.2. Then, 2 mL of the protein extract was loaded through an injection loop and flushed with PBS buffer at a flow rate of 1 mL / min to harvest the peak protein to obtain a 60-mer form of SpyCatcher-LuS recombinant protein and a 180-mer form of SpyCatcher-AP205 recombinant protein.

[0110] The protein concentration was measured using a NANO instrument, and the protein samples were sterilized by passing through a 0.22 μm filter membrane and stored frozen at −20°C.

[0111] 2) Identification of monomer and polymer size of recombinant nanoparticle protein

[0112] The size of the protein monomers of the SpyCatcher-LuS and SpyCatcher-AP205 protein particles of the present invention was identified by reducing polyacrylamide gel electrophoresis (SDS-PAGE). The size of the aggregates formed by the SpyCatcher-LuS protein and the SpyCatcher-AP205 protein was identified by native polyacrylamide gel electrophoresis (Native-PAGE). According to SDS-PAGE, the size of the SpyCatcher-LuS monomer was approximately 28 kD, and the size of the SpyCatcher-AP205 monomer was approximately 25 kD, which was consistent with expectations. According to the Native-PAGE results, the sizes of the SpyCatcher-LuS and SpyCatcher-AP205 aggregates were both above 250 kD, indicating that both formed aggregates. Combined with the particle size and electron microscopy results below, it can be seen that both formed the expected multimeric forms.

[0113] 3) Particle size and morphology detection of recombinant nanoparticle protein

[0114] Particle size was measured using a nanoparticle sizer (purchased from Malvern) according to the manufacturer's instructions. The analysis results showed that the LuS nanoparticles and AP205 nanoparticles of the present invention contained particles with an average diameter of approximately 20±0.5 nm. As shown in Figures 2A and 2B, electron microscopy results showed that the LuS recombinant protein and AP205 recombinant protein were uniform spherical particles, and the proteins were in a multimeric form. Therefore, the above-mentioned LuS recombinant protein and AP205 recombinant protein were able to self-assemble in vitro, forming 60-mer LuS recombinant nanoparticles and 180-mer AP205 recombinant nanoparticles, respectively. The particle sizes of the SpyCatcher-LuS / SpyCatcher-AP205 recombinant protein particles are shown in Table 3.

[0115] 2. Coupling, purification, and identification of pTau peptide antigen (SpyTag-pTau)

[0116] 1) Coupling

[0117] The purified recombinant nanoparticle protein was quantified by BCA assay and the pH was adjusted to 7.5. 1 mg of pTau polypeptide antigens with the sequences shown in SEQ ID NOs: 48-83 were dissolved in 1 mL of PBS buffer, i.e., the SpyTag-pTau polypeptide antigens b1-b36 prepared in Example 1. The prepared pTau polypeptide antigens b1-b36 were added to the system at a ratio of SpyCatcher-LuS / SpyCatcher-AP205 molar amount: pTau polypeptide antigen molar amount = 1:5, and gently mixed. The reaction system was slowly shaken at 2-8°C overnight. The mixture was dialyzed using a cellulose dialysis bag (300 kD) from Shanghai Yuanye Biotechnology Co., Ltd. at a dialysis volume ratio of 1000:1 at 4°C overnight. The system was then replaced with PBS solution (pH 7.5-8.0), and unbound polypeptides were removed to obtain the conjugated nanoparticle vaccine.

[0118] 2) Identify the monomer and polymer sizes of the coupled protein

[0119] The sizes of the LuS-Spy-pTau and AP205-Spy-pTau coupled protein monomers of the present invention were identified by reducing polyacrylamide gel electrophoresis (SDS-PAGE). The sizes of the aggregates formed by the LuS-Spy-pTau and AP205-Spy-pTau coupled proteins were identified by native polyacrylamide gel electrophoresis (Native-PAGE). According to SDS-PAGE, the size of the SpyCatcher-LuS monomer was approximately 28 kD, and the size of the SpyCatcher-AP205 monomer was approximately 25 kD. After coupling with the pTau peptide, the positions of the LuS-Spy-pTau and AP205-Spy-pTau coupled protein bands were shifted upward, and the size of the coupled proteins was in line with expectations. According to the Native-PAGE results, the sizes of LuS-Spy-pTau and AP205-Spy-pTau coupled protein aggregates are both above 250 kD, proving that they have formed aggregates. Combined with the particle size and electron microscopy results below, it can be seen that they have formed the expected multimeric forms.

[0120] 3) Particle size and morphology detection of coupled proteins

[0121] Particle size was measured using a nanoparticle sizer (purchased from Malvern) according to the manufacturer's instructions. Analysis results showed that the recombinant protein particles formed after the pTau peptide antigen was conjugated with SpyCatcher-LuS / SpyCatcher-AP205 had an average diameter of approximately 20-22 nm. Electron microscopy results showed that the recombinant protein formed after the pTau peptide antigen was conjugated with SpyCatcher-LuS / SpyCatcher-AP205 had a uniform 60-mer / 180-mer spherical structure, as shown in Figures 2 to 6. The protein size and particle size of 72 conjugated nanoparticle vaccines are shown in Table 3.

[0122] Table 3 Monomer protein size and particle size of 72 different forms of recombinant proteins of the present invention

[0123]

[0124]

[0125]

[0126]

[0127] Example 4 Immunogenicity and Safety Study of Recombinant Nanoparticle Vaccine

[0128] Set up the following experimental and control groups:

[0129] Experimental groups: C57BL / 6 mice, 8 mice per group. Each vaccine group immunized female and male mice via intramuscular injection. Each injection dose was 25 μg per mouse of the 36 recombinant LuS proteins and 36 recombinant AP205 proteins prepared in the above examples. The adjuvant was MF59 (60 μL / mouse) plus CpG (10 μg / mouse). MF59 was homemade. Specifically, the MF59 adjuvant was prepared by dispersing Yamane 85 in a buffer containing squalene and Tween 80, stirring at high speed until emulsified. The emulsion was then repeatedly homogenized using a microfluidizer (AMH-3) to form o / w emulsion microparticles (160 nm), which were then sterilized by filtration. CpG was purchased from Takara and has the following nucleotide sequence: TGTCGTCGTCGTTTGTCGTTTGTCGTT (SEQ ID NO: 95).

[0130] Control group: C57BL / 6 mice, 8 mice / group, injected intramuscularly with 100 μL of PBS.

[0131] The immunization schedule is one immunization every two weeks for a total of four times. The specific immunization schedule is shown in Table 4.

[0132] (1) The concentration of pTau antibodies in the serum after immunization with the recombinant nanoparticle protein was determined by ELISA. The results are shown in Table 4. A polypeptide phosphorylated at amino acid position 181 of the full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO: 85) was used as a coating antigen for detecting the titer of antiserum against the phosphorylated T181 site; a polypeptide phosphorylated at amino acid position 262 of the full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO: 86) was used as a coating antigen for detecting the titer of antiserum against the phosphorylated S262 site; a polypeptide phosphorylated at amino acid position 202 of the full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO: 87) was used as a coating antigen for detecting the titer of antiserum against the phosphorylated S202 site; a polypeptide phosphorylated at amino acid position 205 of the full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO: 88) was used as a coating antigen for detecting the titer of antiserum against the phosphorylated T205 site; a polypeptide phosphorylated at amino acid position 217 of the full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO: NO:89) was used as the coating antigen for detecting the titer of antiserum against phosphorylated T217; a polypeptide phosphorylated at amino acid position 231 of full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO:90) was used as the coating antigen for detecting the titer of antiserum against phosphorylated T231; a polypeptide phosphorylated at amino acid position 396 of full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO:91) was used as the coating antigen for detecting the titer of antiserum against phosphorylated S396; a polypeptide phosphorylated at amino acid position 404 of full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO:92) was used as the coating antigen for detecting the titer of antiserum against phosphorylated S404; and a polypeptide phosphorylated at amino acid position 199 of full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO:93) was used as the coating antigen for detecting the titer of antiserum against phosphorylated S199.

[0133] The specific steps of the ELISA experiment are as follows:

[0134] 1) The day before each immunization, blood was collected from the mouse cheek. The blood sample was placed at 37°C for 2 hours, then at 4°C for 1 hour, and centrifuged at 3500 rpm for 40 minutes. The upper serum was collected and frozen for later use.

[0135] 2) Using pTau peptides with different single phosphorylation sites as antigens, prepare a 1 mg / mL solution in sterile PBS. Adjust the concentration to 1 μg / μL using antigen coating solution. Coat the plate at 100 μL / well at 4°C overnight. Discard the plate, wash each well three times with 200 μL of PBST (pH 7.4, 0.01 mol / L PBS containing 0.05% Tween-20), then add blocking solution (pH 7.4, 0.01 mol / L PBS, 20% newborn calf serum) and block at 37°C for 1 hour. Discard the plate and wash three times with PBST.

[0136] 3) Add 100 μL / well of serially diluted antiserum (1:200, 1:800, 1:3200, 1:12800, 1:51200) to the wells and incubate at 37°C for 2 h. After washing three times with PBST, add 100 μL / well of 0.3 μg / mL HRP (horseradish peroxidase) goat anti-mouse secondary antibody (purchased from Beijing Dingguo Changsheng Biotechnology Co., Ltd.) and incubate at 37°C for 1 h. After washing three times with PBST, add 100 μL / well of the substrate tetramethylbenzidine (TMB) (purchased from Tiangen Biochemical Technology Co., Ltd.) and develop in the dark for 20 min. The reaction was terminated by adding 50 μL of 2 M sulfuric acid to each well, and the absorbance was measured at 450 nm using a microplate reader (purchased from Bio-rad).

[0137] The antibody levels against different antigens in the fourth immunization sera of vaccines L1-L36 and A1-A36 (see Table 3 for numbers) are shown in Table 5 .

[0138] The results showed that the vaccines L1-L7, L29, A1-A7, and A29 could successfully produce antibodies against the pT181 site after immunizing mice; L1, L8-L13, L34, A1, A8-A13, and A34 could successfully produce antibodies against the pS262 site after immunizing mice; L2, L14-18, L30, A2, A14-A18, and A30 could successfully produce antibodies against the pS202 site after immunizing mice; L3, After immunizing mice with L9, L14, L19-L22, L31, A3, A9, A14, A19-A22, and A31, antibodies against the pT205 site were successfully produced; after immunizing mice with L4, L10, L15, L19, L23-L25, L32, A4, A10, A15, A19, A23-A25, and A32, antibodies against the pT217 site were successfully produced; after immunizing mice with L5, L11, L16, and L20 , L23, L26-L27, L33, A5, A11, A16, A20, A23, A26-A27, A33 can successfully produce antibodies against the pT231 site after immunizing mice; L6, L12, L17, L21, L24, L26, L28, L35, A6, A12, A17, A21, A24, A26, A28, A35 can successfully produce antibodies against the pS396 site after immunizing mice ; L7, L13, L18, L22, L25, L27, L28, L36, A7, A13, A18, A22, A25, A27, A28, and A36 can successfully produce antibodies against the pS404 site after immunizing mice; however, the antibody levels against the pS199 site produced by L29-L36 and A29-A36 after immunizing mice are very low, which is significantly different from the antibody levels produced by other vaccines against their respective sites.

[0139] In summary, of the 72 pTau candidate vaccine compositions designed in this invention, 56 produced antibodies targeting the corresponding phosphorylation sites after immunization in animals, demonstrating immunogenicity. Furthermore, the antibody levels produced by different vaccines containing the same phosphorylation site were not significantly different. Sixteen vaccines (containing the pS199 site) produced very low levels of antibodies targeting the pS199 site after immunization in animals. The PBS control group showed no immunogenicity against any of the phosphorylation sites. The antibody concentrations produced by the pTau vaccine-immunized group were significantly different from those in the PBS control group.

[0140] Because the level of antibodies produced against the pS199 site in the vaccine composition was extremely low, its therapeutic effect was considered limited and it was not used in subsequent studies in transgenic mice.

[0141] Table 4 Immunization schedule

[0142]

[0143]

[0144]

[0145] Table 5 Antibody levels of vaccines targeting different phosphorylation sites (WT mice)

[0146]

[0147]

[0148]

[0149] Immunizations were performed four times on days 1, 15, 29, and 43, and mice were sacrificed two weeks after the fourth immunization. ELISPOT assays were used to examine the humoral and cellular immune responses induced by the recombinant LuS and AP205 protein vaccines, respectively.

[0150] The ELISPOT assay is used to detect the level of IFN-γ produced by mice after immunization against a specific antigen, and to evaluate the level of T cell immune response generated by this antigen. The specific experimental steps are as follows:

[0151] A monoclonal antibody against the cytokine IFN-γ (from an ELISPOT kit, purchased from BD Biosciences) was coated in a 96-well plate at a concentration of 5 μg / mL. 50 μL of the antibody was added to each well and the plate was covered and incubated overnight at 4°C. The plate was discarded, and the plate was washed once with complete medium containing 10% fetal bovine serum. 200 μL of the complete medium was added to each well and the plate was blocked at 37°C for 1 hour before the medium was discarded. Two weeks after the fourth immunization, mice were sacrificed by cervical dislocation, and spleen cells were harvested to prepare a 1×10 7100 μL / well of cell suspension was added to a coated 96-well plate. 100 μL of 1 μg / mL specific antigen pTau was added to each well and incubated in a 37°C, 5% CO2 incubator for 24 hours to stimulate and activate the cells. After 24 hours, the plate was washed twice with sterile water and washed six times with sterile PBST (pH 7.4, 0.01 mol / L PBS, containing 0.05% Tween-20) buffer to remove the cells. 50 μL of IFN-γ antibody (from an ELISPOT kit, purchased from BD Biosciences, antibody concentration: 2 μg / mL) was added to each well and incubated at room temperature for 2 hours. Wash the 96-well plate, add 50 μL of horseradish peroxide-labeled biotin secondary antibody (from the ELISPOT kit, purchased from BD) to each well, incubate at room temperature for 2 h, wash 4 times with PBST, wash twice with PBS, add 50 μL of ELISPOT colorimetric solution (AEC substrate) to each well, react at room temperature in the dark for 5-60 min, discard the staining solution, wash with distilled water, dry overnight, and then count the number of activated cells in the sample using a microscope.

[0152] The ELISPOT assay results, shown in Figure 7, show that pTau peptides with different phosphorylation sites stimulated splenocytes from mice immunized with the two recombinant LuS and AP205 proteins to produce very few IFN-γ-positive spots. This indicates that the two recombinant LuS and AP205 proteins did not stimulate T cell responses at any immunization dose, demonstrating the safety of the vaccine.

[0153] Example 5 Behavioral study of immunogenicity and cognitive function improvement of recombinant nanoparticle vaccine in Tau P301S mice

[0154] TauP301S transgenic mice were purchased from Changzhou Cavens Laboratory Animal Co., Ltd. (Changzhou, China). Immunizations were performed four times starting at 6 months of age. Because vaccines targeting the pS199 locus have low immunogenicity, they were not used in therapeutic studies with transgenic mice.

[0155] Set up the following experimental and control groups:

[0156] Experimental groups: Tau P301S mice, 12 mice per group. Each vaccine group immunized male and female mice intramuscularly with 28 recombinant LuS proteins (excluding those harboring the pS199 site) and 28 recombinant AP205 proteins (25 μg / mouse). The adjuvant consisted of MF59 (60 μL / mouse) and CpG (10 μg / mouse). MF59 was homemade. Specifically, the MF59 adjuvant was prepared by dispersing Yamane 85 in a buffer containing squalene and Tween 80, stirring at high speed until emulsified. The emulsion was then repeatedly homogenized using an AMH-3 microfluidizer to form o / w emulsion microparticles (160 nm), which were then sterilized by filtration. CpG was purchased from Takara and has the following nucleotide sequence: TGTCGTCGTCGTTTGTCGTTTGTCGTT (SEQ ID NO: 95).

[0157] Control group: Tau P301S mice, 12 mice / group, intramuscularly injected with 100 μL PBS.

[0158] The immunization schedule is one immunization every two weeks for a total of four times. The specific immunization schedule is shown in Table 4.

[0159] (1) Immunogenicity testing:

[0160] The concentrations of pTau antibodies in serum after immunization with 28 recombinant LuS nanoparticle proteins and 28 recombinant AP205 nanoparticle proteins were determined by ELISA. The results are shown in Table 4. A polypeptide phosphorylated at amino acid position 181 of full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO: 85) was used as a coating antigen for detecting the titer of antiserum against phosphorylated T181 site; a polypeptide phosphorylated at amino acid position 262 of full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO: 86) was used as a coating antigen for detecting the titer of antiserum against phosphorylated S262 site; a polypeptide phosphorylated at amino acid position 202 of full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO: 87) was used as a coating antigen for detecting the titer of antiserum against phosphorylated S202 site; a polypeptide phosphorylated at amino acid position 205 of full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO: 88) was used as a coating antigen for detecting the titer of antiserum against phosphorylated T205 site; a polypeptide phosphorylated at amino acid position 217 of full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO: NO:89) was used as the coating antigen for detecting the titer of antiserum against the phosphorylated T217 site; a polypeptide phosphorylated at amino acid position 231 relative to the full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO:90) was used as the coating antigen for detecting the titer of antiserum against the phosphorylated T231 site; a polypeptide phosphorylated at amino acid position 396 relative to the full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO:91) was used as the coating antigen for detecting the titer of antiserum against the phosphorylated S396 site; a polypeptide phosphorylated at amino acid position 404 relative to the full-length Tau protein coupled to BSA (sequence shown in SEQ ID NO:92) was used as the coating antigen for detecting the titer of antiserum against the phosphorylated S404 site.

[0161] The specific steps of the ELISA experiment are as follows:

[0162] 1) The day before each immunization, blood was collected from the mouse cheek. The blood sample was placed at 37°C for 2 hours, then at 4°C for 1 hour, and centrifuged at 3500 rpm for 40 minutes. The upper serum was collected and frozen for later use.

[0163] 2) Using pTau peptides with different single phosphorylation sites as antigens, prepare a 1 mg / mL solution in sterile PBS. Adjust the concentration to 1 μg / μL with antigen coating buffer and coat the plate at 100 μL / well at 4°C overnight. Discard the plate, wash each well three times with 200 μL of PBST (pH 7.4, 0.01 mol / L PBS, containing 0.05% Tween-20), then add blocking buffer (pH 7.4, 0.01 mol / L PBS, 20% newborn calf serum) and block at 37°C for 1 hour. Discard the plate and wash three times with PBST.

[0164] 3) 100 μL of serially diluted antiserum (1:200, 1:800, 1:3200, 1:12800, 1:51200) was added to the wells and incubated at 37°C for 2 h. The wells were washed three times with PBST, and 100 μL / well of 0.3 μg / mL HRP (horseradish peroxidase) goat anti-mouse secondary antibody (purchased from Beijing Dingguo Changsheng Biotechnology Co., Ltd.) was added and incubated at 37°C for 1 h. The wells were washed three times with PBST, and 100 μL / well of the substrate tetramethylbenzidine (TMB) (purchased from Tiangen Biochemical Technology Co., Ltd.) was added. The wells were developed in the dark for 20 min. The reaction was terminated by adding 50 μL of 2 M sulfuric acid to each well, and the absorbance was measured at 450 nm using a microplate reader (purchased from Bio-rad).

[0165] The antibody levels against different antigens in the fourth immunization sera of vaccines L1-L28 and A1-A28 (see Table 3 for numbers) are shown in Table 6 .

[0166] The results showed that the vaccines L1-L7 and A1-A7 could successfully produce high-level antibodies against the pT181 site in mice; the vaccines L1, L8-L13, A1, A8-A13 could successfully produce high-level antibodies against the pS262 site in mice; the vaccines L2, L14-18, A2, A14-A18 could successfully produce high-level antibodies against the pS202 site in mice; the vaccines L3, L9, L14, L19-L22, A3, A9, A14, A19-A22 could successfully produce high-level antibodies against the pT205 site in mice; the vaccines L4, L10, L15, L19, L23-L25, A4, A10, A15, A19, A23-A25 could successfully produce high-level antibodies against the pS262 site in mice; the vaccines L3, L9, L14, L19-L22, A3, A9, A14, A19-A22 could successfully produce high-level antibodies against the pS262 site in mice; the vaccines L4, L10, L15, L19, L23-L25, A4, A10, A15, A19, A23-A25 could successfully produce high-level antibodies against the pS262 site in mice High-level antibodies against the pT217 site; high-level antibodies against the pT231 site can be successfully produced after mice are immunized with L5, L11, L16, L20, L23, L26-L27, A5, A11, A16, A20, A23, A26-A27; high-level antibodies against the pS396 site can be successfully produced after mice are immunized with L6, L12, L17, L21, L24, L26, L28, A6, A12, A17, A21, A24, A26, A28; high-level antibodies against the pS404 site can be successfully produced after mice are immunized with L7, L13, L18, L22, L25, L27, L28, A7, A13, A18, A22, A25, A27, A28.

[0167] In summary, all 56 pTau vaccine candidates designed in this invention produced antibodies targeting the corresponding phosphorylation sites after immunization in animals, demonstrating immunogenicity. Furthermore, the antibody levels produced by different vaccines containing the same phosphorylation site were similar and non-significant. The PBS control group showed no immunogenicity against any of the phosphorylation sites. The antibody concentrations produced by the pTau vaccine-immunized groups were significantly different from those in the PBS control group.

[0168] Table 6 Antibody levels of vaccines against different phosphorylation sites (Tau P301S mice)

[0169]

[0170]

[0171] ⑵Behavioral testing:

[0172] Behavioral testing was performed on TauP301S mice at 12 months of age.

[0173] ① Water maze experiment:

[0174] The vaccine's ability to improve learning and memory, as well as hippocampal function, was behaviorally assessed using a water maze test. Twelve-month-old Tau P301S mice were tested in the water maze test, and the latency and number of platform crossings during the probe test were analyzed across five consecutive days of training.

[0175] Specific steps of the water maze experiment:

[0176] a. Instrument and experimental conditions settings:

[0177] The water maze mainly consists of a circular pool and a movable and liftable platform. A camera connected to a computer is set above the pool to record the swimming route and swimming time of the mice. During the experiment, clean water is pre-filled into the pool with a depth of 15 cm. Since the transgenic mice are of the C57BL / 6 strain with black fur, white titanium dioxide powder is added to the pool to make the water opaque white. The surface of the platform is also white, hidden 1-2 cm below the water surface so that the mice cannot see the platform. Three markers of different shapes are evenly pasted on the wall of the pool for the experimental animals to remember and judge the direction. The water temperature is controlled at 22+0.5℃, and the position of the platform and the marker remains unchanged during the experiment. Keep quiet during the experiment, try not to change the experimenter, and try to avoid special smells and light. The schematic diagram of the water maze experimental equipment is as follows Figure 7A Figure 7B shown.

[0178] b. Training period experimental steps:

[0179] 18 weeks after immunization, each group of immunized mice was subjected to a water maze test. The experiment first trained the mice to find a hidden platform in the water and recorded the learning process of the mice. During training, the mice were placed in the pool facing the pool wall, and the time (latency) required for the mice to reach the underwater hidden platform from the entry point, as well as the swimming distance and speed during this period, were recorded by a camera and a computer. Each experiment was limited to 60 seconds. If the mouse did not find the platform within 60 seconds, the mouse was guided to stand on the platform and stay on the platform for 60 seconds, so that the animal could remember the position of the platform through spatial memory, and the latency was recorded as 60 seconds. Each animal was trained 4 times a day, once in each quadrant, and the training lasted for a total of 6 days. After the training, the latency and other data of each group of animals were analyzed and compared to study their spatial memory and learning ability.

[0180] c. Experimental steps during the testing period:

[0181] After the 6-day training period, on the 7th day, the underwater platform was removed and mice were placed in the pool in four quadrants. The number of times the mice crossed the platform and the time the mice stayed in the platform quadrant were recorded to examine the mice's memory of the platform.

[0182] d. Experimental results:

[0183] The results of the latency period are shown in Figure 8: The mice in the PBS group were unable to find the platform through training, and the latency period was relatively long, at about 50 seconds. However, the mice immunized with the vaccines L1-L28 and A1-A28 were able to find the hidden platform in the pool through training, with a shorter latency period of about 30 seconds, which was significantly different from that of PBS. This shows that immunization with the vaccines L1-L28 and A1-A28 can improve the learning ability of mice. The results of the number of times the platform was crossed are shown in Figure 9: When tested on the seventh day, the mice in the PBS group could not find the location where the platform had been well. The mice in the vaccine treatment group were able to accurately remember the location of the platform, frequently crossed the platform, and stayed in the platform quadrant for a longer time, which was significantly different from that of PBS.

[0184] Water maze results indicate that immunotherapy with the L1-L28 and A1-A28 vaccines in AD model mice can enhance learning ability, improve spatial memory, and slow the progression of AD. Furthermore, there were no significant differences in the effects of the various vaccine groups on enhancing learning and spatial memory.

[0185] ②Nesting experiment:

[0186] a. Instrument and experimental conditions settings:

[0187] The nesting experiment is an indicator for evaluating mouse cognitive behavior. Before the experiment begins, each mouse is placed in a new sterilized cage with wood shavings bedding (approximately 1.5 cm thick). Two clean cotton pieces are placed side by side in the middle of the cage's long side (close to the cage wall, not directly under the water bottle). The cotton pieces are 5 cm square and weigh a total of 1.2 ± 0.2 g.

[0188] b. Experimental steps:

[0189] The nesting experiment room should maintain a constant temperature and a quiet environment, avoiding sudden noises. Mice were placed in the cage, the cage lid was closed, the lights were turned off, and a timer was set. The experiment typically began between 4:00 PM and 6:00 PM, and all mice were housed within 1 hour to minimize experimental error. Nesting was scored at the 16th and 24th hours. Scoring criteria: 1: The cotton remained square with no obvious signs of tearing; 2: The cotton was torn into large pieces and scattered throughout the cage or piled under the mouse, with the nest shallow and flat; 3: The cotton was shredded and mixed with wood shavings to form a nest, but with noticeable gaps, or the nest was lower than the mouse's head when inside; 4: The nest was perfect: The cotton was completely shredded and mixed with wood shavings to form a nest, with no gaps, and the nest was higher than the mouse's head when inside. Three or more trained experimenters performed double-blind scoring for each mouse, and the average of each experimenter's scores was used to determine the nesting score for that mouse. Corncob litter can also be used in nesting experiments, and the amount of cotton needs to be increased to 1.8g during the experiment.

[0190] c. Experimental results:

[0191] As shown in Figure 10, mice immunized with the L1-L28 and A1-A28 vaccines scored significantly higher in the nesting test than mice in the PBS group. This suggests that immunotherapy with the L1-L28 and A1-A28 vaccines can restore cognitive and behavioral abilities in TauP301S mice and slow the progression of AD symptoms, whereas the PBS group did not exhibit this effect. Furthermore, the cognitive and behavioral restoration abilities of TauP301S mice were comparable across the vaccines, with no significant differences observed.

[0192] It should be understood that the specific embodiments described herein are intended only to illustrate the present invention and are not intended to limit the present invention. The scope of protection of the present invention shall be determined by the scope of the claims. Persons skilled in the art will appreciate that improvements and modifications may be made without departing from the spirit and scope of the present invention, and such improvements and modifications shall also be considered within the scope of protection of the present invention.

[0193] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A pTau antigen complex comprising: (1) a pTau epitope peptide with a first tag, and (2) Protein nanoparticles selected from the group consisting of AP205 nanoparticles and Lus nanoparticles; wherein, The AP205 nanoparticles contain the bacteriophage major capsid protein AP205 expressed in fusion with a second tag, and the Lus nanoparticles contain 2,4-dioxotetrahydropteridine synthase (Lus) expressed in fusion with a second tag; Wherein, an isopeptide bond is spontaneously formed between the second tag and the first tag, thereby covalently linking the pTau antigen epitope peptide to the protein nanoparticle.

2. The pTau antigen complex according to claim 1, characterized in that The pTau antigen epitope peptide comprises at least one polypeptide fragment from a human full-length Tau protein, wherein the polypeptide fragment comprises at least one phosphorylation site; preferably: The length of the polypeptide fragment is 7 to 11 amino acids, for example, 9 amino acids; and / or, The phosphorylation sites are located on serine and / or threonine in the polypeptide fragment.

3. The pTau antigen complex according to claim 2, characterized in that The full-length Tau protein comprises the amino acid sequence shown in SEQ ID NO: 84; Preferably, the phosphorylation site is located at a position selected from the group consisting of Thr181, Ser262, Ser202, Thr205, Thr217, Thr231, Ser396, Ser404 and Ser199, preferably selected from the group consisting of Thr181, Ser262, Ser202, Thr205, Thr217, Thr231, Ser396 and Ser404, wherein the amino acid position corresponds to the full-length Tau protein; More preferably, the pTau antigen epitope peptide comprises two phosphorylation sites; Further preferably, the pTau antigen epitope peptide comprises, preferably from N-terminus to C-terminus, the following phosphorylation sites: 181 (P-Thr181) and 262 (P-Ser262); 181 (P-Thr181) and 202 (P-Ser202); 181 (P-Thr181) and 205 (P-Thr205); 181 (P-Thr181) and 217 (P-Thr217); 181 (P-Thr181) and 231 (P-Thr231); 181 (P-Thr181) and 396 (P-Ser396); 181 (P-Thr181) and 404 (P-Ser404); 262 (P-Ser26 2) and 202 (P-Ser202); 262 (P-Ser262) and 205 (P-Thr205); 262 (P-Ser262) and 217 (P-Thr217); 262 (P-Ser262) and 231 (P-Thr231); 262 (P-Ser262) and 396 (P-Ser396); 262 (P-Ser262) and 404 (P-Ser404); 202 (P-Ser202) and 205 (P-Thr205); 202 (P-Ser202) and 217 (P-Thr217); 202 (P-Ser202) and 231 (P-Thr231); 202 (P-Ser Ser202) and 396 (P-Ser396); 202 (P-Ser202) and 404 (P-Ser404); 205 (P-Thr205) and 217 (P-Thr217); 205 (P-Thr205) and 231 (P-Thr231); 205 (P-Thr205) and 396 (P-Ser396); 205 (P-Thr205) and 404 (P-Ser404); 217 (P-Thr217) and 231 (P-Thr231); 217 (P-Thr217) and 396 (P-Ser396); 217 (P-Thr217) and 404 (P-Ser404); 231 (P-Thr231) and 396 (P-Ser396); 231 (P-Thr231) and 404 (P-Ser404); 396 (P-Ser396) and 404 (P-Ser404); 199 (P-Ser199) and 181 (P-Thr181); 199 (P-Ser199) and 202 (P-Ser202); 199 (P-Ser199) and 205 (P-Thr205); 199 (P-Ser199) and 217 (P-Thr217); 199 (P-Ser199) and 231 (P-Thr231); 199 (P-Ser199) and 262 (P-Ser262);199 (P-Ser199) and 396 (P-Ser396); or 199 (P-Ser199) and 404 (P-Ser404); Still further preferably, the polypeptide fragment is selected from the group consisting of Tau177-185 (positions 177-185 of the full-length Tau protein), Tau195-203, Tau198-206, Tau201-209, Tau204-209, Tau213-221, Tau227-235, Tau258-266, Tau392-400 and Tau400-408, preferably selected from the group consisting of Tau177-185, Tau198-206, Tau201-209, Tau204-209, Tau213-221, Tau227-235, Tau258-266, Tau392-400 and Tau400-408.

4. The pTau antigen complex according to claim 3, characterized in that The pTau antigen epitope peptide comprises a plurality of polypeptide fragments from a full-length human Tau protein, wherein different polypeptide fragments are operably connected to each other, for example, directly via a peptide bond or via a linker; Preferably, the linker is a (GSG)n linker, wherein n is an integer from 1 to 3; Preferably, the pTau antigen epitope peptide comprises, preferably comprises the following polypeptide fragments from N-terminus to C-terminus: Tau177-185 and Tau258-266, Tau177-185 and Tau198-206, Tau177-185 and Tau201-209, Tau177-185 and Tau213-221, Tau177-185 and Tau227-235, Tau177-185 and Tau392-400, Tau177-185 and Tau400-408, Tau198-206 and Tau258-266, Tau201-209 and Tau258-266, Tau213-221 and Tau258-266, Tau227-235 and Tau258-266, Tau258-266 and Tau392-400, Tau258-266 and Tau400-408, Tau198-206 and Tau204-209, Tau198-206 and Tau213-221, Tau198-206 and Tau227-235, Tau198-206 and Tau392-400, Tau198-206 and Tau4 00-408, Tau204-209 and Tau213-221, Tau204-209 and Tau227-235, Tau204-209 and Tau392-400, Tau204-209 and Tau400-408, Tau213-221 and Tau227-235, Tau213-221 and Tau392-400, Tau213-221 and Tau400-408, Tau227-235 and Tau392-400, Tau227-235 and Tau400-408, Tau392-400 00 and Tau400-408, Tau177-185 and Tau195-203, Tau195-203 and Tau198-206, Tau195-203 and Tau204-209, Tau195-203 and Tau213-221, Tau195-203 and Tau227-235, Tau195-203 and Tau258-266, Tau195-203 and Tau392-400, or Tau195-203 and Tau400-408; more preferably, the pTau antigen epitope peptide comprises a sequence as shown in any one of SEQ ID NOs: 12-47, Further preferably, the pTau antigen epitope peptide comprises a sequence as shown in any one of SEQ ID NOs: 12-39.

5. The pTau antigen complex according to any one of claims 1 to 4, characterized in that The pTau antigen epitope peptide and the first tag are connected via a linker; the linker is preferably a (GSG)n linker, wherein n is an integer of 1-3, preferably 1; and / or, the pTau antigen epitope peptide is located at the carboxyl end of the first tag; Preferably, the first tag is a SpyTag tag; the SpyTag tag preferably has an amino acid sequence as shown in SEQ ID NO: 3; More preferably, the pTau antigen epitope peptide with the first tag comprises an amino acid sequence selected from the following: SEQ ID NO: 48-83.

6. The pTau antigen complex according to any one of claims 1 to 5, characterized in that The phage major capsid protein AP205 or the 2,4-dioxotetrahydropteridine synthase is connected to the second tag via a linker; the linker preferably comprises the amino acid sequence shown in SEQ ID NO: 94; and / or, the bacteriophage major capsid protein AP205 or the 2,4-dioxotetrahydropteridine synthase is located at the carboxyl end of the second tag; Preferably, the second tag is a SpyCatcher tag; the SpyCatcher tag preferably comprises an amino acid sequence as shown in SEQ ID NO: 4 or 5; and / or, the phage major capsid protein AP205 comprises the amino acid sequence shown in SEQ ID NO: 2; and / or, the 2,4-dioxotetrahydropteridine synthase is derived from a hyperthermophilic bacterium, preferably a 2,4-dioxotetrahydropteridine synthase comprising the amino acid sequence shown in SEQ ID NO: 1; More preferably, the fusion protein of the SpyCatcher and the phage major capsid protein AP205 (i.e., AP205-SpyCatcher) comprises the amino acid sequence shown in SEQ ID NO: 11, and / or the fusion protein of the SpyCatcher and the 2,4-dioxotetrahydropteridine synthase (i.e., Lus-SpyCatcher) comprises the amino acid sequence shown in SEQ ID NO:

10.

7. The pTau antigen complex according to any one of claims 1 to 6, characterized in that The pTau antigen epitope peptide connected by the isopeptide bond between the first tag and the second tag self-assembles with the AP205 nanoparticles to form a spherical structure, preferably a 180-mer spherical structure, and the pTau antigen epitope peptide is located on the surface of the spherical structure; and / or, the pTau antigen epitope peptide connected by the isopeptide bond between the first tag and the second tag self-assembles with the Lus nanoparticle to form a spherical structure, preferably a 60-mer spherical structure, and the pTau antigen epitope peptide is located on the surface of the spherical structure; Preferably, the molar ratio of the pTau antigen epitope peptide with the first tag to the second tag constituting the protein nanoparticle and the fusion protein of the phage major capsid protein AP205 or 2,4-dioxotetrahydropteridine synthase is (2-10):1, preferably (4-8):1, for example 5:

1.

8. The method for preparing the pTau antigen complex according to any one of claims 1 to 7, comprising the following steps: (1) preparing a pTau antigen epitope peptide with a first tag; (2) preparing a fusion protein of the second tag and the phage major capsid protein AP205 or 2,4-dioxotetrahydropteridine synthase, which self-assembles to form protein nanoparticles; (3) mixing the pTau antigen epitope peptide with the first tag obtained in step (1) with the protein nanoparticles obtained in step (2) to perform a coupling reaction to obtain the pTau antigen complex.

9. The preparation method according to claim 8, characterized in that In step (1), the pTau antigen epitope peptide with the first tag is prepared by artificial synthesis; And / or, in step (2), the protein nanoparticles are prepared by a method comprising the following steps: 1) Synthesizing a DNA fragment encoding a fusion protein of the second tag and the phage major capsid protein AP205 or 2,4-dioxotetrahydropteridine synthase; 2) constructing the DNA fragment into an expression vector to obtain a recombinant expression vector; 3) transferring the recombinant expression vector into a protein expression system for expression to obtain a fusion protein of the second tag and the phage major capsid protein AP205 or 2,4-dioxotetrahydropteridine synthase, which self-assembles to form protein nanoparticles; Preferably: In step (1), the DNA fragment comprises the nucleotide sequence shown in SEQ ID NO: 8 (encoding Lus-SpyCatcher) or SEQ ID NO: 9 (encoding AP205-SpyCatcher); In step (2), the expression vector is a pET-30a vector or a pET-26b vector; In step (3), the molar ratio of the pTau antigen epitope peptide with the first tag to the second tag constituting the protein nanoparticle and the fusion protein of the phage major capsid protein AP205 or 2,4-dioxotetrahydropteridine synthase is (2-10):1, preferably (4-8):1, for example 5:1; and / or, in step (3), the concentration of the fusion protein is 1 to 2 mg / mL; And / or, in step (3), the coupling reaction is carried out in a Tris buffer system, preferably, the pH of the Tris buffer system is 7.5-8.0; and / or, the reaction temperature of the coupling reaction is 4-6°C, preferably 4°C, and the reaction time is 12-16 hours, preferably 14 hours; More preferably, step (3) further comprises the step of removing unsuccessfully linked protein nanoparticle carriers and / or pTau antigen epitope peptides by centrifugation, dialysis and / or ultrafiltration.

10. A vaccine composition comprising the pTau antigen complex according to any one of claims 1 to 7; Preferably, the vaccine composition further comprises a pharmaceutically acceptable adjuvant; further preferably, the pharmaceutically acceptable adjuvant is selected from the group consisting of MF59 and CpG, preferably a combination of MF59 and CpG.

11. Use of the pTau antigen complex according to any one of claims 1 to 7 or the vaccine composition according to claim 10 in the preparation of a medicament for preventing and / or treating a neurodegenerative disorder in a subject; Preferably, the neurodegenerative disorder is selected from the group consisting of Alzheimer's disease, Down syndrome, prion protein cerebral amyloid angiopathy, traumatic brain injury, and amyotrophic lateral sclerosis / Parkinson's disease-dementia syndrome; preferably Alzheimer's disease; Preferably, the subject is a mammal, preferably a human.

12. Use of the pTau antigen complex according to any one of claims 1 to 7 or the vaccine composition according to claim 10 in the preparation of a medicament for maintaining or improving, preferably restoring, more preferably completely restoring cognitive memory in a subject; Preferably, the subject is a mammal, preferably a human.

Images