Exosome detection reagent and detection method

By using antibody-coated magnetic beads and exosome-targeting aptamers combined with G4-structured DNA mimicry enzyme catalysis and rolling circle amplification, the specificity and stability issues of existing exosome detection methods have been resolved, achieving high sensitivity and specificity for exosome detection, suitable for clinical sample analysis.

CN116819077BActive Publication Date: 2026-07-03CHANGCHUN INSTITUTE OF APPLIED CHEMISTRY CHINESE ACADEMY OF SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHANGCHUN INSTITUTE OF APPLIED CHEMISTRY CHINESE ACADEMY OF SCIENCES
Filing Date
2023-06-28
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

Existing exosome detection methods suffer from poor specificity, high cost, poor stability, and susceptibility to signal interference, making them difficult to use effectively in clinical applications.

Method used

Antibody-coated magnetic beads, exosome-targeting aptamers, and G-Padlock were used for rolling circle amplification. Combined with G4-structured DNA mimicry enzyme catalysis and rolling circle amplification, exosomes were detected using chromogenic reagents and fluorescent chromogenic solutions. Antibodies and aptamers targeting exosomes were used to recognize proteins on the surface of exosomes.

Benefits of technology

It achieves highly sensitive and specific detection of exosomes, can distinguish exosomes from different cell sources, meets the needs of clinical sample analysis, and improves the accuracy and sensitivity of detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116819077B_ABST
    Figure CN116819077B_ABST
Patent Text Reader

Abstract

The present application relates to the field of biotechnology, and more particularly to an exosome detection reagent and a detection method. The present application uses an antibody targeting exosomes to capture exosomes, and then uses an aptamer targeting exosomes to recognize exosomes, and amplifies the exosome concentration information through two ways of G4 structure DNA mimic enzyme catalysis and RCA. Finally, the G4-Hemin structure catalyzes the oxidation of TMB to develop color or forms G4-NMM structure to generate fluorescence signal, thereby completing the detection of exosomes. Experiments show that the colorimetric method and the fluorescence method have a detection range of 4×10 3 ~ 4×10 8 particles / mL and 4×10 2 ~ 4×10 6 particles / mL, respectively, and a detection limit of 7990 particles / mL and 33.18 particles / mL, respectively.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more particularly to exosome detection reagents and detection methods. Background Technology

[0002] Exosomes are formed by the fusion of intracellular multivesicular bodies with the plasma membrane and extracellular secretion. They are approximately 30-150 nm in diameter and consist of a lipid bilayer. Exosomes have a typical vesicle structure, enabling the transport of proteins, nucleic acids, enzymes, and other substances from inside and outside the cell. They can be separated from cells or various biological fluids, including blood, saliva, and urine. All cells release exosomes, but cells under stress, such as tumor cells under hypoxia, produce more than normal cells. Studies have found that tumor-secreted exosomes can promote cancer formation by regulating the tumor microenvironment. Exosomes have become an excellent cancer biomarker, reflecting cancer development to some extent. Therefore, based on the important role of exosomes in indicating cancer-related physiological states, they are increasingly being used in cancer diagnosis, treatment, and monitoring (Biosensors and Bioelectronics, 2021, 183, 113176; Methods in Molecular Biology 2022, 2504, 3-20).

[0003] Various methods for exosome detection have been developed, including nanoparticle tracking analysis (NTA), ELISA, Western blotting, and mass spectrometry (Proteomics, 2017, 17, 1600370; Analytical Chemistry, 2019, 91, 13297-13305). While traditional methods such as ELISA and Western blotting can quantify proteins abundant on the exosome surface, their poor specificity, requirement for large sample sizes, high cost, and poor stability limit their clinical application. In contrast, emerging methods such as colorimetry, fluorescence spectroscopy, electrochemical detection, surface-enhanced Raman spectroscopy (SERS), and surface plasmon resonance (SPR) offer high sensitivity but are also susceptible to interference from other signals. (Journal of Biomedical Nanotechnology, 2022, 18, 1084-1096; Nanoscale, 2019, 11, 10106-10113; Frontiers in Bioengineering and Biotechnology, 2022, 9, 808933; ACS Sensors, 2018, 3, 1471-1479) Therefore, these new methods need further optimization to improve their specificity and accuracy, so as to better apply them in clinical practice. Summary of the Invention

[0004] In view of this, the technical problem to be solved by the present invention is to provide exosome detection reagents and detection methods.

[0005] The detection reagent for exosomes includes: antibody-coated magnetic beads, aptamers, G-Padlock, and chromogenic reagent;

[0006] In the antibody-coated magnetic beads, the antibody is an antibody that targets exosomes;

[0007] The aptamer targets proteins on the surface of exosomes and is modified with fluorescent groups;

[0008] The G-Padlock can undergo rolling circle amplification with the aptamer;

[0009] The colorimetric reagent includes ultraviolet colorimetric reagent and / or fluorescent colorimetric solution;

[0010] The ultraviolet developing solution contains Hemin and TMB.

[0011] The fluorescent colorimetric solution contains NMM.

[0012] G-quadruplexes (G4) are higher-order structures formed by the folding of DNA or RNA rich in tandem repeats of guanine (G). Some small molecules with porphyrin structures, such as hemin chloride or N-methylporphyrin dipropionate IX (NMM), stack at the ends of G4 molecules via π-π interactions. The reagent provided in this invention utilizes antibodies targeting exosomes to capture them, then uses aptamers targeting exosomes to recognize them. Exosome concentration information is amplified through two mechanisms: DNA-mimicking enzyme catalysis using the G4 structure and rolling circle amplification (RCA). Finally, the G4-Hemin structure catalyzes the oxidation of TMB for color development or the formation of a G4-NMM structure to generate a fluorescent signal, thereby completing the detection of exosomes.

[0013] In this invention, both the antibody and the aptamer target proteins on the surface of exosomes. Depending on the antibody and aptamer used, the reagents described in this invention can detect all exosomes, and can also distinguish and detect exosomes from different cell sources.

[0014] The proteins on the surface of the exosomes include, but are not limited to: heat shock protein 8 (HSPA8), CD63 antigen (CD63), β-actin (ACTB), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), enolase 1α (ENO1), cytosol heat shock protein 90α (HSP90AA1), CD9, CD81, tyrosine 3-monooxygenase / tryptophan 5-monooxygenase activator protein, zeta polypeptide (YWHAZ), and muscle pyruvate kinase (PKM2). Preferably, in the reagents of the present invention, the antibody targets CD63, CD81, or CD9.

[0015] CD63 is a biomarker for exosome detection. Antibodies and aptamers targeting CD63 can effectively detect and identify exosomes, enabling qualitative detection. Combined with standard curve methods or other approaches, effective quantitative detection of exosomes can also be achieved. Based on the detected exosome content, and considering the different concentrations of exosomes from different tissue sources (e.g., exosomes from cancer cells have higher concentrations than those from normal cells), the source of the sample can be determined.

[0016] To distinguish exosomes from different sources or species, the antibody in the reagent targets the CD63 protein, while the aptamer targets a specific marker expressed by the exosome being tested (e.g., a specific marker protein on the surface of tumor cell exosomes). This enables the identification of exosomes from different sources or species.

[0017] In some embodiments, the antibody targets the CD63 protein, and the aptamer also targets the CD63 protein.

[0018] In this invention, the magnetic beads can be replaced by other microsphere carriers, such as polyethylene microspheres, latex microspheres, starch microspheres, gelatin microspheres, etc. In this invention, the antibody can be directly coated onto the magnetic beads, or it can be linked to the magnetic beads via streptavidin-biotin; this invention is not limited in this regard. To improve antibody utilization and simplify the preparation process, this invention uses streptavidin-biotin to link the antibody to the magnetic beads.

[0019] In this invention, both the aptamer and the G-padlock are single-stranded DNA. The 5' end of the G-padlock is phosphorylated, allowing it to loop with its 3' end. The aptamer can partially hybridize with the G-padlock to form a double-stranded structure.

[0020] In this invention, the nucleic acid sequence of the aptamer is: CACCCCACCTCGCTCCCGTGAC ACTAATGCTA (SEQ ID NO:1). Compared with other aptamers, it can better recognize exosomes and achieve better detection results.

[0021] In this invention, the aptamer is terminally modified with a fluorescent group, which is selected from any one of FITC, FAM, Cy3, Cy5, BODIPY, Rhodamine, AFC, AMC, Rox, Sulforhodamine 101, 5-TAMRA, EDANS Texas Red, 5-Tamra, and 5-lodoacetamido fluorescein. In some embodiments, the 3' end of the aptamer is modified with FAM.

[0022] In this invention, the G-padlock containing G4 and aptamer complementary sequences is designed based on the CD63 aptamer sequence (SEQ ID NO:1) and the G4 sequence, and includes fragment 1, An, fragment 2, Am, and fragment 3; wherein the number of n and m is independently selected from any integer from 8 to 12, and preferably, n and m are 10.

[0023] The length of fragment 1 is 10-25 bp, preferably 15 bp; fragment 3 is inversely complementary to the 5' end of the CD63 aptamer.

[0024] Fragment 2 is 15-20 bp in length and contains repeated tandem Cs. In some embodiments, the fragment is CCCAACCCGCCCTACCC.

[0025] Fragment 3 has a length of 10–20 bp, preferably 15 bp. Fragment 3 is inversely complementary to the 3' end of the CD63 aptamer.

[0026] In some specific embodiments, the G-padlock containing the G4 complementary sequence has a nucleic acid sequence as shown in SEQ ID NO:2, and its 5' end is phosphorylated.

[0027] In the reagents described in this invention, the concentration of Hemin in the UV developing solution is 100–500 nM, and the concentration of TMB is 0.5–5 mM.

[0028] In this embodiment of the invention, the ultraviolet colorimetric reagent includes: 300 nM Hemin, 2.5 mM TMB, 1 M H2O2 and buffer, wherein the buffer is HEPES buffer, citrate-phosphate buffer and PBS buffer;

[0029] In some specific embodiments, the HEPES buffer comprises: 25 mM HEPES, 20 mM KCl, 200 mM M Acl, 0.05% w / v Triton, and 1% v / v DMSO; the PBS buffer is a 10 mM PBS (pH 7.4) buffer; and the citrate-phosphate buffer comprises: 0.1 M citrate, 0.2 M Na₂HPO₄, and 20 mM KCl. More specifically, the volume ratio of the HEPES buffer, citrate-phosphate buffer, and PBS buffer is 68:130:2.

[0030] In some embodiments, the concentration of the small molecule compound with a porphyrin structure in the colorimetric reaction solution is 0.05–1 μM, and the buffer solution is TE buffer with a pH of 5.0.

[0031] In some embodiments, the fluorescent colorimetric solution is a TE buffer containing 1–10 μM NMM.

[0032] In some specific embodiments, the fluorescent colorimetric solution is a TE buffer containing 7 μM NMM.

[0033] In some embodiments, the detection reagent further includes a buffer for rolling circle amplification reaction, BSA, dNTPs, and phi29 DNA polymerase.

[0034] Furthermore, the present invention also provides a method for detecting exosomes, which includes detection using the detection reagents as described above.

[0035] Specifically, the method includes:

[0036] The sample was mixed with antibody-coated magnetic beads and incubated.

[0037] The aptamer is complementary to G-Padlock and forms a cyclization reaction, which then proceeds to the RCA reaction.

[0038] The product of the RCA reaction, the product of the incubation, and the colorimetric reagent are mixed to detect the signal.

[0039] The product of the incubation is a magnetic bead that has been separated by magnetic attraction after incubation. In the process of detecting samples containing exosomes, it is a complex of magnetic bead-antibody-exosome.

[0040] More specifically, the exosome detection method of this invention involves the following steps: First, a biotin-modified CD63 antibody is bound to streptavidin-modified magnetic beads to capture exosomes using the specificity of the CD63 antibody. Then, a lock-type probe containing a G4 complementary sequence is annealed to a CD63 aptamer primer, and an RCA reaction is catalyzed by a specific polymerase to produce an RCA product containing a G4 repeat sequence and a CD63 nucleic acid aptamer. The CD63 aptamer in the RCA product can recognize exosomes, facilitating the formation of a sandwich structure with the magnetic beads and exosomes. Finally, a chromogenic or fluorescent reaction solution is added to the magnetic bead-exosome-RCA system to form a G4-Hemin structure that catalyzes TMB oxidation for color development or to form a G4-NMM structure that generates a fluorescent signal, thereby achieving sensitive detection of exosome concentration through both colorimetric and fluorescent dual-signal output.

[0041] In some embodiments,

[0042] The incubation conditions include 37°C for 1 hour;

[0043] The complementary and cyclization reaction conditions include heating at 95°C for 10 minutes, cooling to room temperature at a rate of 0.1°C / s, incubating at 25°C for 3 hours in a system containing T4 DNA ligase, and then heating at 60°C for 10 minutes.

[0044] The conditions for the RCA reaction include: reaction at 37°C for 1.5 hours;

[0045] After adding the colorimetric reagent, the reaction was carried out at 37°C for 15 minutes.

[0046] The detection signal includes detection fluorescence emission spectrum or ultraviolet-visible absorption spectrum.

[0047] More specifically,

[0048] The specific process of aptamer complementing and cyclically forming with G-Padlock includes:

[0049] G-Padlock and the aptamer were added to T4 DNA ligation buffer, and the volume was adjusted to DEPC water. The mixture was heated at 95°C for 10 minutes, then cooled to room temperature at a rate of 0.1°C / s to complete annealing. During this process, the anti-complementary portions of G-Padlock and the aptamer formed a double-stranded structure.

[0050] Next, T4 DNA ligase was added to the annealed product, and after incubation at 25°C for 3 hours, the ligase was inactivated by heating at 65°C for 10 minutes, resulting in a circular template. During this process, the 3' and 5' ends of the G-Padlock were ligated to form a circular structure.

[0051] The specific process of the RCA reaction includes:

[0052] The circular template, dNTPs, phi29 DNA polymerase reaction buffer, phi29 DNA polymerase, and BSA were mixed and brought to a final volume with DEPC water. The mixture was reacted at 37°C for 1.5 hours, followed by enzyme inactivation at 65°C for 15 minutes. The RCA reaction product was then purified.

[0053] The method described in this invention can be used for clinical sample analysis to differentiate serum from that of healthy individuals and cancer patients. Furthermore, the method can also be used to detect samples not derived from humans or animals, such as plant exosomes and microbial exosomes. Its multi-signal output detection strategy improves the accuracy of exosome sensors and meets the needs of both types of instruments. Therefore, this strategy holds promise for early cancer diagnosis.

[0054] This invention provides reagents and methods for exosome detection. It utilizes antibodies targeting exosomes to capture them, then employs aptamers targeting exosomes to recognize them, and amplifies exosome concentration information via an RCA reaction. Finally, it generates a fluorescence signal through the oxidation of TMB catalyzed by a G4-Hemin structure or the formation of a G4-NMM structure, thereby completing the detection of exosomes. Experiments show that the detection range of exosome concentration using colorimetric and fluorescence methods is 4 × 10⁻⁶, respectively. 3 ~4×10 8 particles / mL and 4×10 2 ~4×10 6 The detection limits were 7990 particles / mL and 33.18 particles / mL, respectively. Attached Figure Description

[0055] Figure 1 Characterization of exosomes and the feasibility of magnetic beads capturing exosomes. (a) TEM image of exosomes, scale bar: 500 nm; (b) NTA characterization of exosomes; (c) Western blot analysis of the expression of several marker proteins in exosomes and PANC-1 cell lysates; (d) hydration particle size analysis of magnetic beads, magnetic bead-CD63 antibody, and magnetic bead-CD63 antibody-exosomes; (e) Zeta potential analysis of magnetic beads, magnetic bead-CD63 antibody, and magnetic bead-CD63 antibody-exosomes.

[0056] Figure 2 Characterization of RCA products. (a) Schematic diagram of RCA reaction process (T4 Ligase); (b) TEM characterization of RCA products, scale bar: 2 μm; (c) Agarose gel (0.8%) electrophoresis image to verify the generation of RCA products; where lane M represents DNA Marker; lane 1: CD63-Primer; lane 2: G4 sequence lock probe (G-Padlock); lane 3: primer and G-padlock paired product; lane 4: RCA product;

[0057] Figure 3 This study demonstrates the feasibility of magnetic beads capturing exosomes. (a) Schematic diagram of the process of magnetic beads capturing exosomes via CD63 antibody and then labeling them with Dio dye; (b) Confocal fluorescence images of the magnetic bead-exosome complex labeled with Dio dye in the presence and absence of exosomes; Scale bar: 5 μm;

[0058] Figure 4 Characterization of magnetic beads capturing exosomes and then binding CD63 aptamer-FAM. (a) Schematic diagram of the process by which magnetic beads capture exosomes via CD63 antibody and then bind to CD63 aptamer-FAM; (b) Confocal fluorescence images of the magnetic bead-exosome-CD63 aptamer-FAM complex in the absence and presence of exosomes, scale bar: 5 μm;

[0059] Figure 5 The feasibility of dual-signal output is demonstrated. (a) UV-Vis absorption spectra of the solution after reaction under different conditions: (1) TMB, (2) H2O2, (3) TMB+H2O2, (4) TMB+H2O2+G4-Hemin, (5) TMB+H2O2+Hemin, (Illustration: Changes in solution color after reaction); (b) Changes in UV absorption peaks before and after the magnetic beads bind to exosomes, (Illustration: Changes in solution color before and after the addition of exosomes); (c) Fluorescence emission spectra before and after the NMM binds to RCA products; (d) Changes in fluorescence intensity of solution before and after NMM binding;

[0060] Figure 6 Experiments show the optimization of reaction conditions. (a) Optimization of pH; (b) Optimization of reaction time; (c) Optimization of Hemin concentration; (d) Optimization of reaction buffer and temperature; (e) Optimization of NMM concentration; (f) Optimization of the volume of RCA product added.

[0061] Figure 7Steady-state kinetics and double reciprocal plots of G4-Hemim peroxidase activity are shown. (a) Michaelis-Menten curves of 1M H2O2 with different concentrations of TMB and (b) 1mM TMB with different concentrations of H2O2; double reciprocal plots of TMB (c) and H2O2 (d) versus catalytic reaction rate (v) for the corresponding Michaelis-Menten curves;

[0062] Figure 8 The results of UV absorption signal detection of exosome concentration by G4-Hemin are shown. (a) UV absorption signal varies with different concentrations of exosomes (4×10⁻⁶). 3 4×10 4 4×10 5 4×10 6 and 4×10 8 (a) Bar graph of changes in exosome absorbance at 652 nm as a function of exosome concentration (ΔA); (b) Standard curve of ΔA versus logarithm of different exosome concentrations (lgC) (inset);

[0063] Figure 9 The results of G4-NMM detection of exosome concentration are shown. (a) At an exosome concentration of 4 × 10⁻⁶ 2 4×10 3 4×10 4 4×10 5 and 4×10 6 (a) Bar chart of fluorescence change values ​​at particles / mL (ΔF = F - F0, where F and F0 are the fluorescence values ​​of the solution detected by flow cytometry when exosomes are present or absent, respectively); (b) Changes in ΔF with the logarithm (lgC) of different exosome concentrations and standard curves (inset);

[0064] Figure 10 Different concentrations of exosomes (1:4×10) are shown. 4 2:4×10 6 Results of exosome concentration detection (particles / mL) in PBS and 10% FBS cell culture medium; (a) Comparison of UV absorption detection results; (b) Comparison of fluorescence detection results (ns: no significant difference);

[0065] Figure 11 The results of actual serum sample testing are shown in the figure. (a) Comparison of ultraviolet absorption test results between cancer patients and healthy subjects; (b) Comparison of fluorescence test results between cancer patients and healthy subjects (*P<0.05, ***P<0.001). Detailed Implementation

[0066] This invention provides exosome detection reagents and methods. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.

[0067] This invention relates to terminology:

[0068] G-quadruplex: A G-quadruplex (G4) is a higher-order structure formed by the folding of DNA or RNA rich in tandem repeats of guanine (G).

[0069] Exosomes are small membrane vesicles (30-150 nm) containing complex RNA and proteins. They mainly originate from multivesicles formed by the invagination of lysosomal microparticles within cells. After the outer membrane of the multivesicle fuses with the cell membrane, it is released into the extracellular matrix. Exosomes were first discovered in sheep reticulocytes in 1983. In 1987, Johnstone named exosomes "exosome". Various cell types can secrete exosomes under both normal and pathological conditions.

[0070] Rolling Circulation Amplification (RCA): RCA is an isothermal nucleic acid amplification method that uses circular DNA as a template. Through a short DNA primer that is complementary to a partially circular template, dNTPs are converted into single-stranded DNA under the catalysis of a specific polymerase (Phi29 DNA Polymerase). This single-stranded DNA contains hundreds or thousands of repeating DNA fragments that are complementary to the template sequence.

[0071] The test materials used in this invention are all common commercial products and can be purchased on the market.

[0072] The present invention will be further illustrated below with reference to the embodiments:

[0073] Example 1

[0074] The raw materials involved in this embodiment include:

[0075] The particle size of streptavidin-modified magnetic beads is approximately 1.0–1.2 micrometers.

[0076] The CD63 antibody is from Shanghai Amet Biotechnology Co., Ltd.

[0077] The exosomes are derived from PANC-1 pancreatic cancer cells.

[0078] The primer or aptamer sequences involved are shown in Table 1:

[0079] Table 1. DNA sequences used in the experiment:

[0080]

[0081] 1. Validation of exosome separation by magnetic beads

[0082] (1) Ligation of magnetic beads with CD63 antibody: Take 4 μL of 10 mg / mL streptavidin-modified magnetic beads, wash them 2-3 times with PBST buffer, resuspend them in PBS buffer, then add 0.5 μL of 1 mg / mL biotin-modified CD63 antibody to the solution, put it in a mixer, and react at 25°C for 1 hour to complete the ligation of magnetic beads with CD63 antibody.

[0083] (2) Recognition of CD63 antibody and exosomes: After the magnetic beads were conjugated with CD63 antibody, the reaction solution was washed 2-3 times with PBS, and 100 μL of 4×10⁻⁶ PBS was added. 8 The particles / mL of exosomes were placed in a mixer and reacted at 37°C for 1 hour to complete the recognition of CD63 antibody and exosomes.

[0084] (3) Exosome staining: Add 200 μL of Dio dye to the above solution, wash 4 to 5 times with PBST buffer to remove residual dye, and then resuspend in PBS buffer.

[0085] (4) Confocal imaging: Magnetic bead samples with and without exosomes were prepared separately. The prepared samples were dropped onto a glass slide, and a coverslip was placed on top of it. The samples were then placed into a confocal imaging system for imaging.

[0086] (5) Flow cytometry detection: The prepared sample is placed in a flow cytometer, 30,000 magnetic beads are collected for each sample, the excitation wavelength is set to 488nm, and the fluorescence signal is detected.

[0087] 2. Verification of the binding of exosomes to CD63 aptamers

[0088] (1) Ligation of exosomes and aptamers: After the magnetic bead-CD63 antibody is ligated to the exosomes, the reaction solution is washed 2-3 times with PBS buffer and then CD63 aptamers modified with FAM group are added.

[0089] (2) Confocal imaging: Magnetic bead samples with and without exosomes were prepared separately. The prepared samples were dropped onto a glass slide, a coverslip was placed on it, and the samples were placed into a confocal imaging system for imaging.

[0090] Feasibility verification of the dual-signal detection system

[0091] 3.1 First, perform the RCA reaction, then verify the signal using different systems.

[0092] (1) Preparation of circular template: 1 μM of a lock-in probe (G-Padlock) containing the G4 complementary sequence and 1 μM of CD63 aptamer primer were added to 10×T4 DNA ligation buffer and mixed thoroughly. Then, the volume was brought to 20 μL with DEPC water. The mixture was placed in a PCR instrument and heated at 95 °C for 10 minutes, then cooled to room temperature at a rate of 0.1 °C / s to complete annealing. Next, 0.5 μL of T4 DNA ligase was added to the annealed product and incubated at 25 °C for 3 hours. After that, the mixture was heated to 65 °C and held for 10 minutes to inactivate the T4 DNA ligase. The circular template was finally obtained.

[0093] (2) RCA reaction procedure: Take a certain amount of circular template (final concentration: 1 μM), dNTPs (final concentration: 1 mM), 2 μL of 10×phi29 DNA polymerase reaction buffer, 0.5 μL of phi29 DNA polymerase, and 2 μL of BSA at a concentration of 2 mg / mL. Make up the total volume of the solution to 20 μL with DEPC water. Place the mixture in a PCR instrument and maintain it at 37°C for 1.5 hours. Then heat the reaction system to 65°C and maintain it for 15 minutes to inactivate the phi29 DNA polymerase. After the reaction is complete, centrifuge the obtained RCA product at 13,000 rpm and wash 6 times. Finally, dissolve the purified product in 20 μL of DEPC water. It can be used directly or stored at -20°C for future use.

[0094] 3.2 Signal Verification

[0095] (1) Determination of the catalytic activity of the G4-Hemin complex mimicking enzyme: 150 nM cDNA (mimicking DNA of RCA product), 300 nM Hemin (final concentration, diluted with HEPES buffer), and 2 μL 10×PBS buffer were added to the chromogenic working solution, which consisted of 130 μL CP buffer (containing 0.1 M citric acid, 0.2 M Na2HPO4 and 20 mM KCl, with 2.5 mM TMB and 1 M H2O2 in it), for a final total volume of 200 μL. The mixture was incubated at 37 °C for 15 minutes, and then the UV-Vis absorption spectra of TMB, H2O2, TMB+H2O2, TMB+H2O2+G4-Hemin, and TMB+H2O2+Hemin solutions were measured respectively.

[0096] (2) Fluorescence assay of the G4-NMM complex: First, 150 nM cDNA, 7 μM NMM, and 73 μL of LTE buffer were mixed in a final volume of 80 μL. Next, the mixture was incubated at 37 °C for 15 minutes. Finally, the fluorescence emission spectra of the G4 solution, NMM solution, and G4-NMM complex solution were measured separately.

[0097] 4. Optimize experimental conditions

[0098] To improve the detection performance of the sensing platform, a series of optimizations were performed on the pH (2.6–7.0), time (5–55 minutes), Hemin concentration (0.05–1 μM), buffer conditions (Tris or TE buffer), and NMM concentration (0.2–10 μM) and RCA volume (1–10 μL) in the colorimetric reaction.

[0099] Steady-state kinetic analysis of peroxidase-like activity of 5G4-Hemin

[0100] Kinetic analysis was performed using the following systems: G4-Hemin (300 nM Hemin, 3 μL RCA product, 2 μL 10×PBS), 2.5 mM TMB with different concentrations of H2O2 (0.2–3 M), or a fixed concentration of H2O2 (1 M) with different concentrations of TMB (0.02–1.8 mM), in 200 μL citrate-disodium hydrogen phosphate buffer at pH 5.0. All reaction kinetics were monitored at 652 nm using a UV-Vis spectrophotometer. Kinetic parameters were calculated according to the Michaelis-Menten equation: v = V max [S] / (K m +[S]), where v is the reaction rate; [S] is the substrate concentration; V max For the maximum reaction rate, K m This is the Michaelis constant. Calculate the catalytic constant (k). cat ): k cat =V max / [E] ([E] is the enzyme concentration), in k cat / K m The catalytic efficiency of the G4-Hemin mimic enzyme was calculated and compared with that of natural horseradish peroxidase (HRP).

[0101] 6. Exosome Concentration Detection

[0102] After capturing exosomes and washing them three times with PBS buffer, RCA products containing Hemin or NMM were added, and the mixture was incubated at 37°C for 15 minutes. Subsequently, the mixture was washed three times with PBS, and the magnetic bead / exosome / G4-Hemin complex was placed in CP buffer containing 2.5 mM TMB and 1 M H2O2 and incubated at 37°C for 15 minutes. The results were obtained by measuring the UV-Vis absorption spectrum of the reaction system. For the magnetic bead / exosome / G4-NMM complex, the mixture was washed three times with TE buffer, and the fluorescence emission spectrum was measured. For high-throughput assays of exosome concentration, the above detection systems were placed in a microplate reader, and the absorbance at 652 nm and the fluorescence at 615 nm were measured in the presence of different concentrations of exosomes.

[0103] 7. Detection of exosome concentration in actual samples

[0104] (1) Evaluation of specificity in complex biological samples: Two groups of samples were prepared. The first group consisted of exosomes added to cell culture medium containing 10% (v / v) FBS. The second group consisted of exosomes diluted in PBS buffer. The two groups of samples were tested according to the above steps, including contacting the sample with antibody-coated magnetic beads, then recognizing the exosomes with aptamers to form a magnetic bead-antibody-exosome-aptamer complex, then initiating the RCA reaction with G-Padlock, and finally developing the color with UV chromogenic reagent and / or fluorescent chromogenic solution.

[0105] (2) Use this method to distinguish between cancer patients and healthy people: Prepare plasma from 5 groups of healthy people and 5 groups of cancer patients and perform the above steps (replacing different concentrations of exosomes with plasma) for comparison.

[0106] 8 Results and Analysis

[0107] 8.1 Exosome characterization and verification of exosome capture by magnetic beads

[0108] This invention amplifies the detection signal based on the RCA reaction and employs a design strategy of G4-Hemin mimicking enzyme-catalyzed TMB color development and G4-NMM fluorescence to achieve the detection of exosome concentration. First, we prepare the RCA reaction product by binding a primer containing the CD63 aptamer sequence to a G-Padlock probe containing the G4 complementary sequence, thus initiating the RCA process. This generates more RCA products containing the G4 repeat sequence for subsequent binding with Hemin or NMM. To construct an efficient exosome biosensor detection system, we combine streptavidin-modified magnetic beads with biotin-modified CD63 antibodies. Subsequently, different concentrations of exosomes are added. The CD63 antibody recognizes the exosome surface antigen, enabling the magnetic beads to capture the exosomes. Next, the CD63 aptamer is used to recognize and ligate the exosomes, followed by Hemin-catalyzed TMB color development or the addition of NMM dye. The UV absorbance or fluorescence signal intensity of the exosome concentration is measured, and the two are positively correlated.

[0109] To study the size, morphology, and relative purity of exosomes, we isolated exosomes from the supernatant of pancreatic cancer cells (PANC-1) using ultracentrifugation. The morphology, size, and concentration of the exosomes were characterized using transmission electron microscopy (TEM) and nanoparticle tracking (NTA). The morphology of the exosomes is shown in the figure below. Figure 1 As shown in Figure a, exosomes have a typical double-membrane structure; Figure 1 Figure b shows that the average diameter of the exosomes was 113.7 ± 40.8 nm, and their concentration was approximately 8.15 × 10⁻⁶. 8 In addition, we used Western blotting to semi-quantitatively detect five exosome marker proteins (Alix, Flotillin, CD63, CD9, and Calnexin) in PANC-1 cell lysates and exosomes. Figure 1 The results showed that Alix and Flotillin proteins were expressed in both the exosome extract and the cell lysate, proving that the exosomes originated from PANC-1 cells. Further analysis revealed that CD63 and CD9 proteins were only present in the exosome extract, while Calnexin protein was only present in the cell lysate, indicating that our extracted exosomes were of high purity and free of cellular components. Therefore, we conclude that the exosomes we collected are suitable for subsequent sensor construction.

[0110] To assess the connectivity between magnetic beads and exosomes, we employed a comprehensive method combining water content, particle size distribution (DLS), and zeta potential. Figure 1As shown in Figure d, we measured the hydration kinetics size of the magnetic beads, which was 1431 ± 16 nm. When the magnetic beads were conjugated with the CD63 antibody, their hydrated particle size increased to 1856 ± 12 nm. Furthermore, when CD63 successfully captured exosomes, the hydrated particle size increased to 2065 ± 45 nm. Figure 1 Figure e shows the comparison of zeta potentials between magnetic beads, magnetic bead-CD63 antibody, and magnetic bead-CD63 antibody-exosomes. Significant differences were found: streptavidin-modified magnetic beads carried a negative charge (-8.76 ± 0.43 mV), while the CD63 antibody was negatively charged in PBS buffer (pH 7.4). Therefore, the potential decreased to -11.17 ± 0.32 mV after the antibody bound to the magnetic beads. Exosomes themselves also carried a negative charge; therefore, the potential further decreased to -15.6 ± 0.26 mV after exosomes bound to the magnetic bead-CD63 antibody. These results indicate that magnetic beads can capture exosomes by binding to CD63 antibodies, providing feasibility for subsequent experiments.

[0111] 8.2 Characterization of RCA products

[0112] In this invention, the RCA product is a key biometric element in the dual-signal sensor, and therefore plays an important role in the entire sensor system. Figure 2 Figure a illustrates the RCA reaction process: First, CD63-Primer is ligated with G-Padlock, followed by amplification catalyzed by polymerase, ultimately generating an RCA product containing numerous G4 and CD63 aptamer repeat sequences. TEM characterization confirmed this process. Figure 2 Figure b shows that the RCA reaction product has a spherical morphology with a multi-layered, flower-like structure at the edges, and a size of approximately 4 μm. To further verify the formation of the RCA product, we used agarose gel electrophoresis (0.8%). This technique can verify whether the primer and G-padlock generate large molecular weight DNA products via the RCA amplification pathway. Figure 2 Figure c shows the verification results. The primer and G-Padlock were placed in lanes 1 and 2 respectively. After they joined, the resulting bands are shown in lane 3. The migration rates of these bands were lower than those in lanes 1 and 2, indicating that the primer and G-Padlock formed a double-stranded structure through complementary base pairing. Based on this, an RCA reaction was further performed. At this point, a band with a molecular weight exceeding 10 kb appeared in lane 4, demonstrating the generation of a high-molecular-weight RCA product.

[0113] To verify the binding of exosomes to the CD63 aptamer, we synthesized a CD63 aptamer modified with a FAM fluorescent group (CD63 aptamer-FAM), and the ligation process is as follows: Figure 4 As shown in Figure a, firstly, streptavidin-modified magnetic beads were bound to avidin-modified CD63 antibody, and the magnetic beads were purified by external magnetic adsorption to remove the antibody. Then, prepared exosomes were added, and the antibody further captured the exosomes. Uncaptured exosomes were then removed by external magnetic adsorption to purify the magnetic beads. Next, samples containing CD63 aptamer-FAM were incubated at 37°C for 1 hour and imaged using confocal microscopy. We prepared two groups of samples: one with exosomes and one without. The results showed that in the absence of exosomes, CD63 aptamer-FAM had nowhere to adsorb, and therefore no visible fluorescent signal was observed on the surface of the purified magnetic beads. However, in the presence of exosomes, CD63 aptamer-FAM could specifically recognize and bind to the CD63 protein on the exosomes. Due to the presence of the FAM fluorescent group, a green fluorescent signal emitted from the surface of the magnetic beads could be clearly observed, indicating that the exosomes successfully bound to CD63 aptamer-FAM.

[0114] (2) Feasibility verification of dual signal output:

[0115] Figure 5 In Figure 'a', the UV-Vis absorption spectra of TMB solution under different reaction conditions are shown. Compared with G4-Hemin, the control group solution (containing only Hemin without the G4 sequence) showed a lower absorption peak signal at 652 nm UV wavelength, indicating that Hemin alone has low peroxidase activity and cannot effectively catalyze the oxidation of TMB. The special DNA structure formed by the G4 sequence can provide an active site for Hemin, as well as provide axial coordination and a hydrophobic environment. Therefore, after Hemin binds to the G4 sequence, the activity of the peroxidase mimic is greatly enhanced. We compared and analyzed the UV detection signals with and without exosomes. The results showed ( Figure 5 In step b), in the presence of exosomes, the magnetic beads can bind to the exosomes and further bind to the RCA product containing the G4 sequence, ultimately forming G4-Hemin with peroxidase activity. After the addition of Hemin, G4-Hemin catalyzes the color development of TMB, leading to an increase in the absorption peak. Conversely, if exosomes are absent, the magnetic beads cannot bind to G4-Hemin, resulting in ineffective catalysis of TMB color development and a lower absorption peak. This result demonstrates that we have successfully established the UV signal detection component in the reaction system.

[0116] Furthermore, we used fluorescence spectroscopy to investigate the changes in fluorescence activity when NMM binds to the G4 sequence. The results showed that when NMM exists alone in aqueous solution, it tends to aggregate into low-fluorescence micelles with very weak fluorescence intensity. However, when NMM is inserted into the G4 sequence, the hydrophobic environment of the solution changes due to π-π stacking interactions, resulting in a significant enhancement of the fluorescence signal observed at 615 nm. Figure 5 The corresponding results are shown in Figure c. Subsequently, we investigated the differences in fluorescence detection signals in the system with and without exosomes. The results show ( Figure 5 In step d), the fluorescence signal was significantly enhanced after the addition of exosomes. This is because a large number of RCA products containing G4 repeat sequences are linked to exosome surface proteins via CD63 aptamers, thus stably binding to the magnetic bead surface. Subsequent addition of NMM dye forms a G4-NMM complex, which fully utilizes its optical properties to enhance the fluorescence signal around the magnetic beads. Conversely, in the absence of exosomes, the magnetic beads cannot bind to G4-NMM, and therefore no enhanced fluorescence signal is obtained. These experiments demonstrate the successful establishment of our fluorescence signal-based detection method.

[0117] 8.3 Optimize experimental conditions

[0118] To optimize this method for exosome detection, we conducted a series of experiments to determine the optimal conditions for UV signal detection (pH, time, Hemin concentration, buffer conditions) and fluorescence signal detection (NMM concentration and RCA volume). We recorded the changes in the UV absorption signal at 652 nm under different experimental conditions and used the ratio of the 652 nm absorbance of G4-Hemin (DNAzyme) to that of the Hemin solution (i.e., DNAzyme / Hemin) to evaluate the influence of experimental conditions on the experiment. First, we selected pH values ​​of 2.6, 3.4, 4.4, 4.6, 5.0, 6.0, and 7.0 for the experiments. Figure 6 According to result a, pH 5.0 is the optimal pH for the catalytic reaction. To optimize the experimental conditions, we measured the UV absorbance every 5 minutes within a time range of 5–55 minutes. The results showed that the colorimetric reaction was time-dependent, and the absorbance peaked at 30 minutes. Figure 6 As shown in Figure b. Therefore, we determined 30 minutes as the optimal reaction time and applied it in subsequent colorimetric reactions. After investigation, we determined the optimal concentration of Hemin. From... Figure 6As shown in Figure c, within the concentration range of 0.05–1 μM, the peroxidase-mimicking activity of G4-Hemin was strongest at a Hemin concentration of 0.3 μM. Therefore, we selected 0.3 μM Hemin as the concentration used in subsequent studies. To improve the binding efficiency of RCA to Hemin, we investigated the effects of buffer conditions (Tris and TE buffer solutions) and reaction temperatures (25℃ and 37℃) on the system. The results showed that G4-Hemin enzyme activity was stronger in TE buffer solution and at 37℃. Therefore, we selected TE buffer solution and 37℃ as the optimal buffer and temperature conditions. Finally, we optimized the NMM concentration and the volume of RCA product added. Fluorescence intensity was highest at an NMM concentration of 7 μM (… Figure 6 The volume of the e) and RCA products was 3 μL. Figure 6 The result is highest when f), therefore, we determine these two conditions as the optimal detection conditions.

[0119] 8.4 Steady-state kinetic analysis of G4-Hemin mimic enzyme

[0120] To further evaluate the performance of the G4-Hemin mimic peroxidase, we tested the reaction kinetics catalyzed by the G4-Hemin mimic enzyme by varying the concentrations of TMB and H2O2. Figure 7 As shown in a and 7b, the catalytic rate of G4-Hemin increases with increasing TMB and H2O2 concentrations, eventually reaching a horizontal level. Therefore, the kinetic curves of the G4-Hemin mimic enzyme corresponding to the substrate conform to the typical Michaelis-Menten model. The Michaelis-Menten equation is known to be ν = V. max ·[S] / (K m +[S]), applying the Michaelis-Menten model, taking the reciprocals of the reaction rate and substrate concentration respectively, and performing linear fitting, resulting in their respective double reciprocal (Lineweaver-Burk) plots. Figure 7 From c and d), the maximum reaction rate (V) for TMB and H2O2 can be calculated. max The value is 0.55 × 10 -8 Ms -1 and 0.60×10 -8 Ms -1 The corresponding Michaelis constant (K) m The K0 values ​​were 0.293 mM and 446.8 mM, respectively (Table 2). The K0 values ​​of G4-Hemin with H2O2 as a substrate were... mThe Km value was significantly higher than that of horseradish peroxidase (HRP) (3.70 mM, Nature Nanotechnology, 2007, 2, 577-583). This result indicates that a higher H2O2 concentration is required in this system to achieve the maximum reaction rate of the G4-Hemin mimic enzyme. Furthermore, the Km value of G4-Hemin using TMB as a substrate is significantly higher than that of horseradish peroxidase (HRP). m K value lower than HRP m The value (0.434 mM, Nature Nanotechnology, 2007, 2, 577-583) indicates that G4-Hemin has a higher affinity for TMB than HRP.

[0121] Table 2 Comparison of kinetic parameters between G4-Hemin and HRP:

[0122]

[0123] Note: Catalyst is the catalyst, Substrate is the reaction substrate, K m V is the Michaelis constant. max This represents the maximum reaction rate.

[0124] 8.5 Exosome Concentration Detection

[0125] Under optimized experimental conditions, we used G4-Hemin and G4-NMM as probes for dual-output signal detection and analysis of exosomes. The results showed that the UV absorbance of the solution gradually increased with increasing exosome concentration (see...). Figure 8 (a) In Figure 8 In sample b, we found that the exosome concentration was 4 × 10⁻⁶. 3 ~4×10 8 Within the particle / mL range, absorbance changes were linearly correlated with exosome concentration. The regression equation was ΔA = 0.0086 * lgC - 0.011 (ΔA = A - A0, where A and A0 are the UV absorbance values ​​at 652 nm with and without exosomes, respectively; lgC represents the logarithm of exosome concentration), and the corresponding detection limit was 7.99 × 10⁻⁶. 3 particles / mL (blank + 3SD, SD: standard deviation, R) 2 =0.997).

[0126] Figure 9 The results of fluorescence signal analysis of exosomes using G4-NMM are presented. Figure 9 As shown in Figure a, the fluorescence value gradually increases with increasing exosome concentration. Figure 9 In b, the concentration range is 4×10 2 ~4×10 6The fluorescence value per particle / mL was linearly correlated with the exosome concentration, and the regression equation was ΔF = 17.307 * lgC – 17.489 (ΔF = F - F0, where F and F0 are the average fluorescence values ​​obtained by flow cytometry with or without exosomes, respectively; lgC represents the logarithm of the exosome concentration, R...). 2 =0.965), and the detection limit was 33.18 particles / mL. These experimental results demonstrate that our method has high sensitivity for detecting exosome concentrations.

[0127] 8.6 Detection of exosome concentration in serum samples

[0128] To evaluate the practicality of this experimental method, we added exosomes to cell culture medium containing 10% (v / v) fetal bovine serum (FBS) to detect exosome concentrations and compared the results with those obtained in PBS buffer. We measured the changes in UV absorbance and fluorescence intensity corresponding to different concentrations of exosomes. Figure 10 Experimental results show that colorimetric analysis ( Figure 10 a) and fluorescence method ( Figure 10 (b) There was no significant difference between the exosome concentrations measured in PBS buffer and 10% FBS cell culture medium and those measured by the standard NTA method (P>0.05, no significance, ns), indicating that this detection method can obtain reliable results in complex biological samples. Next, we applied the dual-signal detection system of this invention to determine the exosome concentration in actual clinical biological samples. We performed direct detection of exosomes on serum samples from five healthy individuals and five pancreatic cancer patients. The results showed that the UV absorption signal intensity and fluorescence intensity of exosomes in the plasma of cancer patients were higher than those in the healthy group (…). Figure 11 The results (a and b) are consistent with previously published findings (FutureOncology 2021, 17, 907-919). This indicates that cancer cells have a high exosome secretion rate during cancer development and metastasis. Analysis showed that our dual-signal detection sensor successfully distinguished between cancer patients and healthy individuals in actual serum samples, demonstrating good stability. Therefore, this sensor has broad application prospects in future clinical testing.

[0129] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Reagents for detecting exosomes, including: Antibody-coated magnetic beads, aptamers, G-Padlock, and chromogenic reagent; In the antibody-coated magnetic beads, the antibody is an antibody that targets exosomes; The aptamer targets proteins on the surface of exosomes and is modified with fluorescent groups; The G-Padlock is capable of undergoing rolling circle amplification with the aptamer, and the nucleic acid sequence of the G-padlock is shown in SEQ ID NO:2; The colorimetric reagent includes ultraviolet colorimetric solution and / or fluorescent colorimetric solution; The ultraviolet developing solution contains Hemin and TMB. The fluorescent colorimetric solution contains NMM.

2. The detection reagent according to claim 1, characterized in that, In the antibody-coated magnetic beads, the antibody is a CD63 antibody, and the antibody is connected to the magnetic beads via streptavidin-biotin.

3. The detection reagent according to claim 1, characterized in that, The aptamer is a CD63-targeting aptamer, and its nucleic acid sequence is shown in SEQ ID NO:1; the fluorescent group is FAM.

4. The detection reagent according to claim 1, characterized in that, The concentration of Hemin in the ultraviolet colorimetric solution is 100~500 nM, and the concentration of TMB is 0.5~5 mM; The concentration of NMM in the fluorescent colorimetric solution is 1~10μM.

5. The detection reagent according to claim 4, characterized in that, The UV developing solution comprises: 300 nM Hemin, 2.5 mM TMB, 1 M H2O2 and a buffer solution, wherein the buffer solution is HEPES buffer, citrate-phosphate buffer and PBS buffer. The fluorescent colorimetric solution is a TE buffer containing 7 μM NMM.

6. The detection reagent according to any one of claims 1 to 5 further comprises a buffer for rolling circle amplification reaction, BSA, dNTPs, and phi29 DNA polymerase.

7. A method for detecting exosomes, characterized in that, This includes detection using the detection reagent described in any one of claims 1 to 6.

8. The detection method according to claim 7, characterized in that, The sample was mixed with antibody-coated magnetic beads and incubated. The aptamer is complementary to G-Padlock and forms a cyclization reaction, which then proceeds to the RCA reaction. The product of the RCA reaction, the product of the incubation, and the colorimetric reagent are mixed to detect the signal.

9. The detection method according to claim 8, characterized in that, The incubation conditions include 37°C for 1 hour; The complementary and cyclization reaction conditions include heating at 95°C for 10 minutes, cooling to room temperature at a rate of 0.1°C / s, incubating at 25°C for 3 hours in a system containing T4 DNA ligase, and then heating at 60°C for 10 minutes. The conditions for the RCA reaction include: reaction at 37°C for 1.5 hours; After adding the colorimetric reagent, react at 37°C for 15 minutes; The detection signal includes detection fluorescence emission spectrum or ultraviolet-visible absorption spectrum.