Preparation method of thiamethoxam electrochemiluminescence sensor
By combining Fe/Zn-MOF@C-dots composite material with DNA aptamers, an electrochemiluminescence sensor for thiamethoxam was constructed, which solves the problems of expensive and low-sensitivity detection instruments in the existing technology. It achieves highly sensitive and stable detection of thiamethoxam and is suitable for residue detection in agricultural products and production environments.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ANALYSIS & TESTING CENT CHINESE ACADEMY OF TROPICAL AGRI SCI
- Filing Date
- 2023-07-10
- Publication Date
- 2026-04-24
AI Technical Summary
In existing technologies, liquid chromatography-mass spectrometry (LC-MS) has high precision but expensive instruments and complex pretreatment; electrochemical methods have poor stability and colorimetric methods have poor sensitivity; organic ECL luminescent materials have low luminescence efficiency and high biotoxicity; C-dots have weak electrochemiluminescence intensity, which limits their application on electrochemiluminescence sensing platforms.
The Fe/Zn-MOF@C-dots composite material was used as the base material for the electrochemiluminescence sensor. C-dots were prepared from simple raw materials such as sucrose, sulfuric acid and polyethylene glycol, and then combined with Fe/Zn-MOF to modify the surface of a glassy carbon electrode. Combined with DNA aptamers as recognition elements, a thiamethoxam electrochemiluminescence sensor was constructed.
The electrochemiluminescence intensity was significantly enhanced, improving the sensitivity and selectivity of the sensor, achieving highly sensitive detection of thiamethoxam, with good repeatability and long-term stability, making it suitable for the detection of thiamethoxam residues in agricultural products and production environments.
Smart Images

Figure CN117054500B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of electrochemiluminescence detection technology, and particularly relates to a method for preparing a thiamethoxam electrochemiluminescence sensor. Background Technology
[0002] Thiamethoxam is a neonicotinoid insecticide with high efficacy and broad spectrum, widely used in many crops such as tomatoes, peppers, and bananas. Although thiamethoxam is considered a moderately toxic and relatively safe insecticide, some studies suggest that thiamethoxam residues in agricultural products and the surrounding environment may be harmful to human health, and its toxicity may be underestimated. Therefore, it is essential to detect thiamethoxam residues in agricultural products and the surrounding environment. Currently, common methods for detecting thiamethoxam include high-performance liquid chromatography-mass spectrometry (HPLC-MS / MS), electrochemical methods, and fluorescence methods. While these methods have their own advantages, they also have significant limitations. HPLC-MS / MS offers high precision, but the instruments are expensive and the pretreatment process is complex; electrochemical methods generally have poor stability, and colorimetric methods generally have poor sensitivity. Therefore, developing new methods for detecting thiamethoxam with high selectivity, high sensitivity, and ease of use is of great significance.
[0003] With in-depth research, electrochemiluminescence (ECL) sensing technology has received increasing attention in pesticide residue analysis. This is due to the advantages of ECL sensing technology, such as low background, high signal-to-noise ratio, high sensitivity, and easy modulation. However, since the performance of the ECL reagent determines the detection capability, such as the sensitivity of the ECL sensor, the scarcity of efficient and stable ECL materials has become a major constraint on the further development of ECL sensing technology. Organic ECL luminescent materials, luminol, and metal quantum dots, as common luminescent reagents in this technology, have long faced the predicament of low luminescence efficiency, strong environmental sensitivity, and high biotoxicity. Therefore, developing high-efficiency, low-biotoxicity ECL reagents and constructing corresponding biosensor platforms is of great significance for achieving highly sensitive detection of thiamethoxam and is also an important development trend in the field of ECL sensing.
[0004] To further enhance the performance of electrochemiluminescence reagents, functional new materials have attracted increasing attention. Carbon quantum dots (C-dots) are a class of zero-dimensional carbon nanomaterials with electrochemiluminescence properties. C-dots possess numerous advantages, including good water solubility, low toxicity, environmental friendliness, and good biocompatibility. However, the quantum yield of C-dots is typically low, resulting in weak electrochemiluminescence intensity, which significantly limits their application in electrochemiluminescence sensing platforms. Enhancing the ECL intensity of C-dots to achieve sensor sensitization based on C-dots is an urgent problem to be solved. We believe that introducing other functional materials to construct composite carbon quantum dot materials, thereby enhancing electron transfer in electrochemiluminescence methods, is an effective solution. Kamyabi et al. used gC3N4 nanosheets as a supporting material for C-dots to construct a CuS / C-dots / gC3N4 composite modified electrode sensor, achieving amplification of C-dots electrochemiluminescence. With in-depth research, metal-organic frame materials (MOFs) have received increasing attention in the field of electrochemiluminescence. MOFs are a class of crystalline porous materials with a periodic network structure, formed by the self-assembly of inorganic metal centers and bridging organic ligands. The unique structure of MOFs, such as their large specific surface area, high porosity, and easily tunable pore channels, endows them with excellent properties. Therefore, MOFs can serve as an ideal platform for loading various electrochemiluminescent materials and developing MOF composites with extraordinary properties. Thus, combining MOFs with luminescent reagents can construct high-performance electrochemiluminescent reagents. Du et al. combined CdS quantum dots with MOF5 to obtain a stable and enhanced electrochemiluminescent material for constructing an immunosensor. However, the construction of an MOF@C-dots-based electrochemiluminescent reagent sensor for thiamethoxam detection has not yet been reported.
[0005] Based on the above analysis, the problems and shortcomings of the existing technology are as follows:
[0006] (1) Although the liquid chromatography-mass spectrometry method has high detection precision, the instruments are relatively expensive and the pretreatment is complicated; the stability of the electrochemical method and the sensitivity of the colorimetric method are generally poor.
[0007] (2) Organic ECL luminescent materials, luminol, metal quantum dots and other common luminescent reagents in electrochemiluminescence sensing technology have long faced the dilemma of low luminescence efficiency, strong environmental sensitivity and high biotoxicity.
[0008] (3) C-dots have many advantages such as good water solubility, low toxicity, environmental friendliness and good biocompatibility, but the production rate is usually low and its electrochemiluminescence intensity is weak, which greatly limits its application on electrochemiluminescence sensing platforms. Summary of the Invention
[0009] To address the problems existing in the prior art, this invention provides a method for preparing a thiamethoxam electrochemiluminescence sensor based on Fe / Zn-MOF@C-dots sensitization.
[0010] This invention is achieved by a method for preparing a thiamethoxam electrochemiluminescence sensor based on Fe / Zn-MOF@C-dots sensitization. The Fe / Zn-MOF@C-dots composite material is used as the base material, combined with the C-dots preparation method and the biosensor construction strategy, to achieve the detection of thiamethoxam through electrochemical and electrochemiluminescence methods.
[0011] Furthermore, including:
[0012] Fe / Zn-MOF and C-dots composite material is used as the base material of electrochemiluminescence sensor, and C-dots are introduced on the basis of Fe / Zn-MOF;
[0013] C-dots were rapidly prepared under ultrasonic conditions using simple raw materials such as sucrose, sulfuric acid, and polyethylene glycol.
[0014] Fe / Zn-MOF@C-dots were modified onto the surface of a glassy carbon electrode using chitosan, and then a single strand of thiamethoxam DNA aptamer was bound to the surface of the composite nanomaterial as a recognition element using a crosslinking agent.
[0015] The prepared sensor was characterized by cyclic voltammetry, electrochemical impedance spectroscopy, and electrochemiluminescence methods, and the detection of thiamethoxam was achieved.
[0016] Furthermore, the preparation method of the thiamethoxam electrochemiluminescence sensor based on Fe / Zn-MOF@C-dots sensitization includes:
[0017] Step 1, Preparation of Cdots:
[0018] Add 0.25g sucrose, 2mL deionized water, 0.25mL sulfuric acid and 6mL polyethylene glycol 200 to a 10mL beaker, mix under sonication for 15min, then centrifuge the product at 5000rpm for 10min, dialyze, and adjust the pH to 7.4 to obtain C-dots.
[0019] Step 2, Preparation of Fe / Zn-MOF:
[0020] 0.81 g FeCl3, 0.68 g ZnCl2, and 2.00 g H3BTC were slowly added to a mixed solvent containing 150 mL deionized water and 50 mL ethylene glycol. The mixture was stirred continuously for 1.5 h and reacted at 280 °C for 2 h. 3 mL of prepared Cdots was added, and the reaction was continued for another 2 h. The mixture was then cooled to room temperature, centrifuged at 10000 rpm / min for 5 min, washed with 150 mL of anhydrous ethanol, and centrifuged again. After repeating the same operation three times, the centrifuged solid was dried under vacuum at 60 °C to obtain Fe / Zn-MOF.
[0021] Step 3, Preparation of Fe / ZnMOF@C-dots:
[0022] Following steps one and two, comparative experiments were conducted to prepare Fe / Zn-MOF without adding C-dots, Fe-MOF@C-dots without adding ZnCl2, and Zn-MOF@C-dots without adding FeCl3.
[0023] Step 4, Sensor Construction:
[0024] Fe / Zn-MOF@C-dots were modified onto the surface of a glassy carbon electrode (GCE) using chitosan, and then a single strand of thiamethoxam DNA aptamer was bound to the surface of the composite nanomaterial as a recognition element to construct a biosensor that can recognize thiamethoxam.
[0025] Step 5, Electrochemical detection:
[0026] Using 0.05 mol / L K4[Fe(CN)6] / K3[Fe(CN)6] (containing 0.1 mol / L KCl) as the probe for the electrochemical method, the scanning potential range of cyclic voltammetry (CV) was 0.20 V to 0.6 V, the scanning rate was 50 mV / s, and the amplitude was 50 mV. Electrochemical impedance spectroscopy (EIS) was performed at a potential of 0.19 V using an AC voltage of 5 mV in the frequency range of 100 mHz to 100 kHz.
[0027] Step 6, Detection using electrochemiluminescence method:
[0028] The sensor was placed in thiamethoxam solutions of different concentrations for 12 min for adsorption, and then the electrochemiluminescence signal was detected. The electrochemiluminescence detection was performed by placing the electrode in 0.01 mol / L Tirs-HCl buffer (pH = 8.2, containing 25 μL of 30% H2O2) and using a three-electrode system to measure the intensity of ECL.
[0029] Furthermore, the sucrose, sulfuric acid, polyethylene glycol 200, FeCl3, ZnCl2, pyromellitic acid (H3BTC), ethylene glycol, terephthalaldehyde, tris(hydroxymethyl)aminomethane (Tris), and thiamethoxam standards were all purchased from Shanghai Aladdin Reagent Co., Ltd.
[0030] Furthermore, the sequence of the thiamethoxam DNA aptamer is: 5'NH2TATGTTCTTAACTGGTCGTCCTGTGAGCCGATCACTAGATAATTAG GAT3', which was purchased from Shanghai Sangon Biotech Co., Ltd.
[0031] Furthermore, the 0.01 mol / L TrisHCl solution was dissolved in 100 mL of deionized water with 0.12 g of tris(hydroxymethyl)aminomethane, and the pH was adjusted to 8.2 with 0.01 mol / L HCl. Unless otherwise specified, all reagents used in the experiment were of analytical grade, and the water used was deionized water (18.2 MΩ).
[0032] Further, in the construction of the sensor, GCE was ultrasonically treated with anhydrous ethanol and ultrapure water for 5 min each. Then, the GCE was immersed in Tris-HCl solution (0.02 mol / L, pH = 8.0, containing 0.05 g chitosan and 0.06 g Fe / Zn-MOF) and electrodeposited for 300 s. The electrode was then dried at room temperature (25 °C) to obtain Fe / Zn-MOF@C-dots modified GCE. The GCE was then immersed in 2% terephthalaldehyde (0.02 g terephthalaldehyde dissolved in 1 mL deionized water) solution for 0.5 h. Next, the GCE was incubated in 1.0 μmol / L DNA aptamer for 1 h to immobilize the aptamer, resulting in the Fe / Zn-MOF@C-dots / aptamer GCE modified sensor.
[0033] Furthermore, the electrochemiluminescence detection was performed on a MIP-E type electrochemiluminescence analysis system multifunctional luminescence detector (Xi'an Mindray Analytical Instruments Co., Ltd.). The sensor was placed in 0.01 mol / L Tirs-HCl buffer (pH = 8.2, containing 25 μL of 30% H2O2) to detect the electrochemiluminescence signal. The instrument is equipped with a three-electrode system: the working electrode is a Fe / Zn-MOF@C-dots / aptamer-modified GCE electrode, the reference electrode is an Ag / AgCl electrode, and the counter electrode is a platinum wire electrode. The scanning range was 0–0.8 V (vs. SCE), and the scan rate was 100 mV / s. The photomultiplier tube voltage was 800 V, the sampling rate was 10 T / s, the amplification factor was 3, and the measurement time was 90 s.
[0034] Furthermore, the electrochemical detection was performed on a CHI 660E electrochemical workstation (Shanghai Chenhua Instrument Co., Ltd., China), equipped with the same three-electrode system as the electrochemiluminescence detector. The morphology of the composite material was analyzed using scanning electron microscopy (SEM, Zeiss, Germany); crystal structure analysis was performed on an Ultima IV polycrystalline X-ray diffractometer (XRD, Rigaku Corporation, Japan). Elemental analysis of the composite material was performed on an ESCALAB 250 X-ray photoelectron spectrometer (XPS, Thermo Scientific, USA).
[0035] Furthermore, the thiamethoxam electrochemiluminescence sensor based on Fe / Zn-MOF@C-dots sensitization is used for highly sensitive detection of thiamethoxam, and the specific steps are as follows:
[0036] (1) Preparation of actual samples:
[0037] Weigh 25g of plant-derived sample, add 50mL of acetonitrile and homogenize at high speed for 3min. Filter using medium-speed qualitative filter paper, add 5g of NaCl, and shake thoroughly. After standing for 30min, take 10mL of the supernatant and dry it under vacuum at 45℃ using a rotary evaporator. Finally, dissolve in 25mL of Tris-HCl solution (0.01mol / L, pH=8.2) for analysis.
[0038] (2) Plotting the calibration curve:
[0039] Under optimal conditions, the sensor was placed in thiamethoxam solutions of different concentrations to capture the target molecules. Then, the electrode was placed in the luminescent substrate to measure the luminescence intensity and the electrochemiluminescence quenching value of the sensor before and after capturing thiamethoxam was calculated.
[0040] (3) Actual sample detection and analysis:
[0041] The sensor was used for the actual detection of thiamethoxam in vegetable samples such as bananas and cowpeas. According to the experimental procedure, the sensor was placed in the sample solution for adsorption for 12 min, the ECL intensity of the sensor was measured, and a spike recovery experiment was performed. At the same time, the sample was detected by high performance liquid chromatography-mass spectrometry (HPLC-MS) for comparison.
[0042] Based on the above technical solutions and the technical problems solved, please analyze the advantages and positive effects of the technical solution to be protected by this invention from the following aspects:
[0043] First, regarding the technical problems existing in the above-mentioned prior art, the creative technical effects resulting from solving these problems are described in detail below:
[0044] (1) In this invention, Fe / Zn-MOF@Cdots was synthesized. Fe / Zn-MOF provides a larger specific surface area for loading C-dots and enhances electron transfer during the luminescence process of C-dots on the electrode, thereby significantly amplifying the electrochemiluminescence intensity (at least 10 times) and improving the sensor sensitivity.
[0045] (2) This invention utilizes the specific recognition of the target molecule thiamethoxam by the aptamer as a signal switch. After thiamethoxam is captured, the electrochemiluminescence intensity of the sensor is quenched, thereby establishing a new method for detecting thiamethoxam. Due to the specific recognition ability of the aptamer for thiamethoxam, the sensor exhibits good selectivity.
[0046] Secondly, this invention first synthesizes Fe / Zn-MOF@C-dots and modifies them onto the surface of a glassy carbon electrode (GCE) using chitosan. Then, a single strand of thiamethoxam DNA aptamer is bound to the surface of the composite nanomaterial using a cross-linking agent as a recognition element, constructing a biosensor capable of recognizing thiamethoxam. This sensor exhibits significant repeatability, good selectivity, and long-term stability, and can serve as an effective means for detecting thiamethoxam residues in agricultural products and their production environment.
[0047] Third, as supplementary evidence of the inventive step of the claims of this invention, it is also reflected in the following important aspects:
[0048] (1) The expected benefits and commercial value of the technical solution of this invention after transformation are as follows:
[0049] This invention proposes a novel Fe / Zn-MOF-enhanced C-dots electrochemiluminescence strategy and uses it to construct a DNA-adapted ECL sensor for highly sensitive detection of thiamethoxam. This sensor exhibits significant repeatability, good selectivity, long-term stability, and a low detection limit, making it an effective means of detecting thiamethoxam residues in agricultural products and their surrounding environment. It meets the requirements for trace residue analysis and on-site analysis, and can serve as a technological foundation for the development of miniaturized on-site thiamethoxam detection equipment, possessing significant commercial value.
[0050] (2) The technical solution of this invention fills a technical gap in the industry both domestically and internationally:
[0051] The construction of an electrochemiluminescent reagent sensor based on MOF@C-dots by combining C-dots with MOF and its application in the detection of thiamethoxam has not been reported before. This invention is the first to utilize the Fe / ZnMOF@C-dots composite material as an electrochemiluminescent reagent. Compared with C-dots, the electrochemiluminescent signal of Fe / Zn-MOF@C-dots is significantly enhanced. Simultaneously, the sensor employs a DNA aptamer as a specific recognition element for the target molecule thiamethoxam, effectively improving the selectivity of the sensor.
[0052] (3) Whether the technical solution of the present invention solves the technical problem that people have long wanted to solve but have never been able to solve successfully:
[0053] Enhancing the ECL intensity of C-dots to achieve sensor sensitization based on C-dots is an urgent problem to be solved. This invention proposes a novel enzyme-free ECL platform for the ultrasensitive detection of thiamethoxam based on a novel electrochemiluminescence composite material, Fe / Zn trimesoate MOF (Fe / Zn-MOF), loaded with C-dots (Fe / Zn-MOF@C-dots), thus solving this technical challenge.
[0054] (4) Does the technical solution of the present invention overcome technical bias?
[0055] This invention first synthesizes Fe / Zn-MOF@C-dots and modifies them onto the surface of a glassy carbon electrode (GCE) using chitosan. Then, a single strand of thiamethoxam DNA aptamer is bound to the surface of the composite nanomaterial using a cross-linking agent as a recognition element, constructing a biosensor capable of recognizing thiamethoxam. Fe / Zn-MOF provides a larger specific surface area for loading C-dots and enhances electron transfer during the luminescence process of C-dots on the electrode, thereby significantly amplifying the electrochemiluminescence intensity and improving sensor sensitivity. Simultaneously, utilizing the aptamer's specific recognition of the target molecule thiamethoxam as a signal switch, the electrochemiluminescence intensity of the sensor is quenched upon capture of thiamethoxam, thus establishing a novel method for detecting thiamethoxam. Due to the aptamer's specific recognition ability for thiamethoxam, the sensor exhibits excellent selectivity. Attached Figure Description
[0056] Figure 1 This is a flowchart of the preparation method of the thiamethoxam electrochemiluminescence sensor based on Fe / Zn-MOF@C-dots sensitization provided in the embodiments of the present invention;
[0057] Figure 2 This is a schematic diagram of the construction of the thiamethoxam electrochemiluminescence sensor provided in the embodiments of the present invention;
[0058] Figure 3 These are SEM images, XRD patterns, and XPS patterns provided in embodiments of the present invention: (A) SEM image of Fe-MOF, (B) SEM image of Fe / Zn-MOF@C-dots, (C) XRD pattern of Fe / Zn-MOF@C-dots, and (D) XPS pattern of Fe / Zn-MOF@C-dots.
[0059] Figure 4The following are (A) CV spectra and (B) EIS spectra during the sensor fabrication process provided in this embodiment of the invention: a. bare glassy carbon electrode, b. Fe / ZnMOF@C-dots modified glassy carbon electrode, c. Fe / ZnMOF@C-dots / DNA aptamer modified electrode, d. capture 5×10 -9 Fe / ZnMOF@C-dots / DNA aptamer modified electrode after mol / L thiamethoxam;
[0060] Figure 5 The following are the electrochemiluminescence responses of different modified electrode sensors provided in the embodiments of the present invention: a. C-dots modified electrode, b. Fe / Zn-MOF modified electrode, c. Fe-MOF@C-dots modified electrode, d. Fe / Zn-MOF modified electrode, e. Fe / ZnMOF@C-dots modified glassy carbon electrode, f. 2×10 -8 Quenching effect of mol / L thiamethoxam on Fe / Zn-MOF@C-dots modified glassy carbon electrode;
[0061] Figure 6 The following are the effects of different experimental conditions provided in the embodiments of the present invention on the electrochemiluminescence intensity of the sensor: (A) pH value of TrisHCl (B) H2O2 dosage (C) adsorption time;
[0062] Figure 7 The ECL response of the sensor provided in embodiment (A) after adsorbing different concentrations of thiamethoxam is as follows: a–j: (0, 5, 20, 100, 500, 1500, 2000, 3000, 4000 and 5000) × 10 -11 mol / L(B) calibration curve;
[0063] Figure 8 The sensor provided in this embodiment of the invention detects 5×10 -9 mol / L thiamethoxam and 5×10 -9 Mix 5 × 10 mol / L thiamethoxam separately -7 Deviations in ECL response values for interferences below mol / L: (a) imidacloprid, (b) acetamiprid, (c) thiamethoxam, (d) dinotefuran, (e) acetamiprid, (f) chloramphenicol, (g) enflufloxacin, (h) levofloxacin, (i) atrazine, (j) chlorpyrifos, (k) methyl parathion, and (h) mixtures of the above interferences;
[0064] Figure 9 The sensor provided in this embodiment of the invention detects 5×10 -9 ECL response of 10 cycles for mol / L thiamethoxam;
[0065] Figure 10The embodiment of the present invention provides 10 sensors to detect 5×10 -9 ECL response of mol / L thiamethoxam;
[0066] Figure 11 This refers to the change in ECL detection signal of the sensor provided in this embodiment of the invention at different storage times. Detailed Implementation
[0067] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0068] To enable those skilled in the art to fully understand how the present invention is specifically implemented, this section provides an explanatory description of the embodiments that expand upon the technical solutions of the claims.
[0069] The core innovations of the preparation method provided in this invention include:
[0070] 1) Design and synthesis of Fe / Zn-MOF@C-dots composite material: Fe / Zn-MOF and C-dots composite material is used as the base material of electrochemiluminescence sensor. C-dots are introduced on the basis of Fe / Zn-MOF to improve the sensitivity and stability of the sensor.
[0071] 2) Simple and rapid C-dots preparation method: C-dots can be rapidly prepared under ultrasonic conditions using simple raw materials such as sucrose, sulfuric acid and polyethylene glycol. It has the advantages of simple operation, low cost and environmental friendliness.
[0072] 3) Construction of biosensors: Fe / Zn-MOF@C-dots were modified onto the surface of glassy carbon electrode by chitosan, and then the DNA aptamer of thiamethoxam was bound to the surface of the composite nanomaterial as a recognition element by a cross-linking agent, which improved the thiamethoxam recognition ability of the sensor.
[0073] 4) Combination of electrochemical and electrochemiluminescence methods: Cyclic voltammetry, electrochemical impedance spectroscopy and electrochemiluminescence methods were used to characterize the performance of the prepared sensor and detect thiamethoxam, achieving highly sensitive, accurate and rapid detection of thiamethoxam.
[0074] In summary, this preparation method, through the design and synthesis of Fe / Zn-MOF@C-dots composite materials, constructs a biosensor and employs electrochemical and electrochemiluminescence methods for the detection of thiamethoxam, achieving highly sensitive, accurate, and rapid detection of thiamethoxam. It possesses high innovation and practicality.
[0075] like Figure 1As shown, the preparation method of the thiamethoxam electrochemiluminescence sensor based on Fe / Zn-MOF@C-dots sensitization provided in this embodiment of the invention includes the following steps:
[0076] (1) Preparation of Cdots:
[0077] Add 0.25 g sucrose, 2 mL deionized water, 0.25 mL sulfuric acid, and 6 mL polyethylene glycol 200 to a 10 mL beaker. Mix under sonication for 15 min. Then, centrifuge the product at 5000 rpm for 10 min to remove undissolved substances. After dialysis, adjust the pH to 7.4 to obtain C-dots.
[0078] (2) Preparation of Fe / Zn-MOF:
[0079] 0.81 g FeCl3, 0.68 g ZnCl2, and 2.00 g H3BTC were slowly added to a mixed solvent containing 150 mL deionized water and 50 mL ethylene glycol. The mixture was stirred continuously for 1.5 h and reacted at 280 °C for 2 h. 3 mL of prepared C-dots was added, and the reaction was continued for another 2 h. The mixture was then cooled to room temperature, centrifuged at 10000 rpm for 5 min, washed with 150 mL of anhydrous ethanol, and centrifuged again. After repeating the same operation three times, the centrifuged solid was dried under vacuum at 60 °C to obtain Fe / Zn-MOF.
[0080] (3) Preparation of Fe / Zn-MOF@C-dots:
[0081] To investigate the luminescence properties of Fe / Zn-MOF@C-dots, comparative experiments were conducted by preparing Fe / Zn-MOF without C-dots, preparing Fe-MOF@C-dots without ZnCl2, and preparing Zn-MOF@C-dots without FeCl3, following steps one and two.
[0082] (4) Sensor construction:
[0083] like Figure 2 As shown, Fe / Zn-MOF@C-dots were modified onto the surface of a glassy carbon electrode (GCE) using chitosan, and then a single strand of thiamethoxam DNA aptamer was bound to the surface of the composite nanomaterial as a recognition element using a crosslinking agent to construct a biosensor that can recognize thiamethoxam.
[0084] (5) Electrochemical detection method:
[0085] 0.05 mol / L K₄[Fe(CN)₆] / K₃[Fe(CN)₆] (containing 0.1 mol / L KCl) was used as the probe for the electrochemical method. Cyclic voltammetry (CV) was performed at a scanning potential range of 0.20 V to 0.6 V, a scan rate of 50 mV / s, and an amplitude of 50 mV. Electrochemical impedance spectroscopy (EIS) was performed at a potential of 0.19 V using an AC voltage of 5 mV in the frequency range of 100 mHz to 100 kHz.
[0086] (6) Electrochemiluminescence detection method:
[0087] The sensor was placed in thiamethoxam solutions of different concentrations for 12 min for adsorption before the electrochemiluminescence signal was detected. Electrochemiluminescence detection was performed by placing the electrode in a 0.01 mol / L TirsHCl buffer (pH = 8.2, containing 25 μL of 30% H2O2) using a three-electrode system to measure the intensity of ECL.
[0088] The sucrose, sulfuric acid, polyethylene glycol 200, FeCl3, ZnCl2, pyromellitic acid (H3BTC), ethylene glycol, terephthalaldehyde, tris(hydroxymethyl)aminomethane (Tris), and thiamethoxam standards provided in the embodiments of this invention were all purchased from Shanghai Aladdin Reagent Co., Ltd.
[0089] The sequence of the thiamethoxam DNA aptamer provided in this embodiment of the invention is: 5'NH2TATGTTCTTAACTGGTCGTCCTGTGAGCCGATCACTAGATAATTAG GAT3', which was purchased from Shanghai Sangon Biotech Co., Ltd.
[0090] The 0.01 mol / L Tris-HCl solution provided in this embodiment of the invention was prepared by dissolving 0.12 g of tris(hydroxymethyl)aminomethane in 100 mL of deionized water and adjusting the pH to 8.2 with 0.01 mol / L HCl. Unless otherwise specified, all reagents used in the experiment were of analytical grade and the water used was deionized water (18.2 MΩ).
[0091] The sensor constructed according to this embodiment of the invention involves ultrasonically treating GCE with anhydrous ethanol and ultrapure water for 5 min each. Then, the GCE is immersed in Tris-HCl solution (0.02 mol / L, pH = 8.0, containing 0.05 g chitosan and 0.06 g Fe / Zn-MOF) and electrodeposited for 300 s. The electrode is then dried at room temperature (25°C) to obtain Fe / Zn-MOF@C-dots modified GCE. Next, the GCE is immersed in 2% terephthalaldehyde (0.02 g terephthalaldehyde dissolved in 1 mL deionized water) solution for 0.5 h. Finally, the GCE is incubated in 1.0 μmol / L DNA aptamer for 1 h to immobilize the aptamer, resulting in the Fe / Zn-MOF@C-dots / aptamer GCE modified sensor.
[0092] The electrochemiluminescence detection provided in this embodiment of the invention was performed on a MIPE-type electrochemiluminescence analysis system multifunctional luminescence detector (Xi'an Mindray Analytical Instruments Co., Ltd.). The instrument is equipped with a three-electrode system: the working electrode is a Fe / Zn-MOF@C-dots / aptamer-modified GCE electrode, the reference electrode is an Ag / AgCl electrode, and the counter electrode is a platinum wire electrode. The scanning range is 0–0.8 V (vs. SCE), and the scan rate is 100 mV / s. The photomultiplier tube voltage is 800 V, the sampling rate is 10 T / s, the amplification factor is 3, and the measurement time is 90 s.
[0093] The electrochemical detection provided in this embodiment of the invention was performed on a CHI 660E electrochemical workstation (Shanghai Chenhua Instrument Co., Ltd., China), equipped with the same three-electrode system as the electrochemiluminescence detector. The morphology of the composite material was analyzed using a scanning electron microscope (SEM, Zeiss, Germany); crystal structure analysis of the composite material was performed on an Ultima IV polycrystalline X-ray diffractometer (XRD, Rigaku Corporation, Japan). Elemental analysis of the composite material was performed on an ESCALAB 250 X-ray photoelectron spectrometer (XPS, Thermo Scientific, USA).
[0094] The thiamethoxam electrochemiluminescence sensor based on Fe / Zn-MOF@C-dots sensitization provided in this invention is used for highly sensitive detection of thiamethoxam. The specific steps are as follows:
[0095] (1) Preparation of actual samples:
[0096] Weigh 25g of plant-derived sample, add 50mL of acetonitrile, homogenize at high speed for 3min, filter with medium-speed qualitative filter paper, add 5g of NaCl, and shake thoroughly. After standing for 30min, take 10mL of the supernatant and dry it under vacuum at 45℃ using a rotary evaporator. Finally, dissolve in 25mL of Tris-HCl solution (0.01mol / L, pH=8.2) for analysis.
[0097] (2) Plotting the calibration curve:
[0098] Under optimal conditions, the sensor was placed in thiamethoxam solutions of different concentrations to capture the target molecules. Then, the electrode was placed in the luminescent substrate to measure the luminescence intensity and the electrochemiluminescence quenching value of the sensor before and after capturing thiamethoxam was calculated.
[0099] (3) Actual sample detection and analysis:
[0100] The sensor was used for the actual detection of thiamethoxam in vegetable samples such as bananas and cowpeas. According to the experimental procedure, the sensor was placed in the sample solution for adsorption for 12 min, the ECL intensity of the sensor was measured, and a spike recovery experiment was performed. At the same time, the sample was detected by high performance liquid chromatography-mass spectrometry (HPLC-MS) for comparison.
[0101] To demonstrate the inventiveness and technical value of the technical solution of this invention, this section provides specific product or related technology application examples of the technical solution claimed.
[0102] The method for preparing a thiamethoxam electrochemiluminescence sensor based on Fe / Zn-MOF@C-dots sensitization provided in the application embodiment of the present invention is applied to a computer device. The computer device includes a memory and a processor. The memory stores a computer program. When the computer program is executed by the processor, the processor performs the steps of the method for preparing a thiamethoxam electrochemiluminescence sensor based on Fe / Zn-MOF@C-dots sensitization.
[0103] The embodiments of the present invention have achieved some positive results during the research and development or use process, and have indeed great advantages compared with the prior art. The following content describes them in conjunction with the data, charts and other information of the experimental process.
[0104] (1) Characterization of Fe / ZnMOF@Cdots
[0105] The Fe / Zn-MOF was characterized using SEM, XRD, and XPS techniques. SEM images are shown below. Figure 3 As shown, Fe-MOFs have a regular hexahedral morphology. Figure 3 A) Zn-MOF exhibits a hexagonal polygonal structure, and its C-dots are spherical with a diameter of approximately 20 nm. Figure 3 B). However, in Fe / Zn-MOF, a mixture of two forms can be obtained, with Zn uniformly distributed on the Fe-MOF surface as spherical surfaces, and C-dots distributed on the Zn-MOF surface. The XRD pattern of the prepared Fe / Zn-MOF@C-dots is shown below. Figure 3As shown in Figure C, the relatively broad peak at 2θ = 8.6° is an amorphous crystal plane peak of C(002), belonging to C-dots. The appearance of obvious sharp diffraction peaks in Zn-MOF and Cu-MOF indicates the high crystallinity of Fe / Zn-MOF, which is consistent with previously reported Zn-based MOFs and Fe-based MOFs and simulation results ( Figure 3 D) Consistent. The peaks at 2θ = 7.2°, 10.3°, 12.6°, 16.4°, 17.9°, 24.5°, and 26.6° mainly belong to the Zn crystal surface. The peaks at 2θ = 9.4°, 14.5°, 13.4°, 17.4°, 16.5°, 19.0°, and 25.9° mainly belong to the Fe crystal surface. XPS spectra are as follows: Figure 3 As shown in Figure D, strong signals correspond to 285 eV C (1s), 533 eV O (1s), 712 eV Fe (2p), and 1022 eV and 1045 eV Zn (2p). The results indicate that Fe / Zn-MOF@C-dots contain only four elements: C, O, Zn, and Fe, and no other impurity elements. These results demonstrate the successful synthesis of Fe / Zn-MOF@C-dots.
[0106] (2) Sensor fabrication and characterization
[0107] Since the binding of functional nanomaterials to the electrode surface affects the response of the K3[Fe(CN)6] / K4[Fe(CN)6] solution at the sensing interface, a 3×10⁻⁶ nanometer diameter electrode was selected. -4 A mol / L K3[Fe(CN)6] / K4[Fe(CN)6] solution was used as a probe, and the sensor fabrication process was characterized using CV and EIS. For example... Figure 4 As shown in Figure A, when Fe / Zn-MOF@C-dots are modified onto the glassy carbon electrode surface, the probe's CV response is enhanced. This is because the good conductivity and large specific surface area of Fe / Zn-MOF@C-dots increase the number of probe responses on the electrode surface (curves a to b). However, when the DNA aptamer binds to the electrode surface, the probe's CV response decreases (curve c), and as the aptamer captures the target molecule thiamethoxam, the CV response further decreases (curve d). This is because the poor conductivity of both the DNA aptamer and thiamethoxam affects electron transfer. Corresponding to the CV response, when Fe / Zn-MOF@C-dots are modified onto the glassy carbon electrode surface, the electrode resistance decreases (curves a to b), and as the DNA aptamer and thiamethoxam bind to the electrode one by one (curves c and d), the sensor resistance further decreases. These results indicate that the sensor has been successfully fabricated.
[0108] (3) Electrochemiluminescence response of the sensor
[0109] The amplification effect of Fe / Zn-MOF on the ECL response signal of C-dots was investigated. Electrode sensors modified with C-dots, Fe / Zn-MOF, Fe-MOF@C-dots, Zn-MOF@C-dots, and Fe / Zn-MOF@C-dots were fabricated, and the ECL response values of the sensors were detected. Figure 5 As shown, C-dots exhibit a significant and stable ECL response signal on the glassy carbon electrode (curve a), while Fe / Zn-MOF shows no response signal (curve b). In the composite nanomaterials, both Fe-MOF and Zn-MOF amplify the ECL response signal of C-dots (curves c and d), but the amplification efficiency is limited. However, in the Fe / Zn-MOF@C-dots composite material, Fe / Zn-MOF significantly amplifies the ECL response signal of C-dots (curve e). Compared to single-metal MOF materials, Fe / Zn-MOF shows better amplification, amplifying the ECL response signal of C-dots by approximately 11 times or more. We hypothesize that the possible mechanism for signal amplification in Fe / Zn-MOF@C-dots is that the material has a larger specific surface area, loading more C-dots and increasing the electron transfer rate; secondly, the electronic coupling effect of the bimetallic elements in the MOF material further enhances the electrocatalytic activity. Thiamethoxam, the target molecule, can effectively quench the ECL response signal of Fe / Zn-MOF@C-dots. The quenching mechanism involves the electro-oxidation and reduction of C-dots in the presence of H₂O₂ to generate anionic and cationic carbon radicals. These anionic and cationic carbon radicals annihilate through electron transfer reactions, thus producing ECL. However, thiamethoxam undergoes a reduction reaction at the electrode, generating anionic nitro radical intermediates. These intermediates bind to cationic carbon radicals, thereby hindering the annihilation of both anionic and cationic carbon radicals and quenching the ECL signal of C-dots.
[0110] (4) Optimization of experimental conditions
[0111] In the detection of thiamethoxam using a sensor, the pH of the Tris-HCl buffer, the amount of H2O2 used as the co-reactant in the electrochemical luminescence reaction, and the reaction time for DNA capture of thiamethoxam all affect the ECL signal intensity of the sensor. Therefore, it is necessary to optimize these influencing factors to determine the optimal experimental conditions. Figure 6 As shown in Figure A, the ECL response of the sensor gradually increases with increasing pH of Tris-HCl from 7.2, reaching a maximum at 8.2, and then decreases with further increases in pH. Therefore, pH 8.2 of Tris-HCl is selected as the optimal condition. Figure 6As shown in Figure B, when the amount of H2O2 is between 5 and 25 μL, the ECL signal of the sensor increases with the increase of H2O2 amount. However, as the amount of H2O2 continues to increase, exceeding 25 μL, the ECL signal of the sensor shows a decreasing trend. Therefore, an H2O2 amount of 25 μL is selected as the optimal amount. The sensor is placed in a 5 × 10⁻⁶… -8 Adsorption in mol / L thiamethoxam solution, such as Figure 6 As shown in Figure C, as the adsorption reaction proceeds, more and more thiamethoxam is adsorbed onto the sensor, thereby quenching the sensor's ECL signal. After 12 minutes of reaction, the sensor's ECL signal reaches its minimum and no longer changes, indicating that the adsorption is complete. Therefore, 12 minutes is selected as the optimal adsorption time.
[0112] (5) Plotting calibration curves
[0113] Under optimal conditions, the sensor was placed in thiamethoxam solutions of different concentrations to capture the target molecules. Then, the electrode was placed in a luminescent substrate to measure the luminescence intensity, and the electrochemiluminescence quenching values of the sensor before and after thiamethoxam capture were calculated. The results are as follows: Figure 7 As shown in Figure A, the degree of ECL quenching increases with the increase of the thiamethoxam concentration captured by the sensor, and the ECL reduction value (ΔI) is related to the thiamethoxam concentration (c) at 5.0 × 10⁻⁶. -11 ~5000×10 -11 A relatively good linear relationship was observed between mol / L. The linear regression equation for the working curve was ΔI = 1.25c(10 -11 mol / L) + 146.9 Figure 7 B), the correlation coefficient r is 0.9985, and the detection limit is 9.81 × 10⁻⁶. -12 mol / L (LOD = 3σ / m, where σ is the standard deviation of the blank and m is the slope of the calibration plot).
[0114] (6) Sensor Selectivity Study
[0115] The selective recognition capability for thiamethoxam is the core of the sensor. The sensor's selective recognition performance for thiamethoxam was validated by adding it to other pesticide molecules. Sensing adsorption capacity: 5.0 × 10⁻⁶ -9 The ECL intensity (I0) after applying 5.0 × 10 mol / L thiamethoxam was measured. -9 mol / L thiamethoxam and 5.0×10 -7 The ECL strength (I1) of the mixture of imidacloprid, acetamiprid, thiamethoxam, dinotefuran, acetamiprid, chloramphenicol, atrazine, chlorpyrifos, and methyl parathion was calculated. The relative deviation of the two ECL strengths was calculated as: Relative deviation RD% = [(I0-I1) / I0×100%]. Results are as follows... Figure 8As shown, the RD% values are all less than 5%. These results demonstrate that the sensor has excellent selective recognition performance for thiamethoxam.
[0116] (7) Sensor repeatability and stability
[0117] The stability and reproducibility of the sensor for detecting thiamethoxam were investigated. The same sensor was re-adsorbed at a rate of 5.0 × 10⁻⁶. 9 After applying mol / L trichlorfon, 10 consecutive ECL measurements were performed. Figure 9 The relative standard deviation of 10 ECL measurements was calculated to be 0.35%. Ten sensors were prepared following the same experimental procedure, and each sensor was re-adsorbed with 5.0 × 10⁻⁶ ppm. -9 After measuring the ECL of thiamethoxam at a concentration of mol / L, the relative standard deviation of 10 tests was calculated to be 0.29%. Figure 10 Furthermore, the stability of the sensor was studied by placing it for an extended period of time, and the sensor was re-adsorbed at a depth of 5.0 × 10⁻⁶. -9 After applying 1 mol / L thiamethoxam for 8 min, the ECL was measured. The sample was kept moist and stored at 4°C. After 15 days, the sample was removed and the ECL was measured again. The relative deviation (RD%) was calculated to be 1.05%. After 30 days, the signal intensity decreased to 88.4% of the original signal. Figure 11 This indicates that the sensor has good stability.
[0118] (8) Actual sample testing and analysis
[0119] To further demonstrate the practicality of the sensor, it was used for the actual detection of thiamethoxam in vegetable samples such as bananas and cowpeas. Following the experimental procedure, the sensor was immersed in the sample solution for 12 min for adsorption. The ECL intensity of the sensor was measured, and a spiked recovery experiment was performed. Simultaneously, high-performance liquid chromatography-mass spectrometry (HPLC-MS) was used to detect the samples for comparison. Table 1 shows that the recovery rate of the proposed method was 90.5%–109.3%, RSD < 5%, and relative standard deviation less than 5%. The sensor's detection results were consistent with those obtained by HPLC-MS.
[0120] Table 1. Actual Sample Determination and Spiked Recovery Test
[0121]
[0122]
[0123] Example 1: Fe / Zn-MOF@C-dots modified chitosan composite nanomaterial sensor
[0124] Step 1: Preparation of Cdots
[0125] Add 0.25 g of sucrose, 2 ml of deionized water, 0.25 ml of sulfuric acid, and 6 ml of polyethylene glycol 200 to a 10 ml beaker.
[0126] Mix for 15 minutes under ultrasonic conditions.
[0127] Centrifuge at 5000 rpm for 10 minutes, then dialyze. Adjust the pH to 7.4 to obtain C-dots.
[0128] Step 2: Preparation of Fe / Zn-MOF
[0129] 0.81 g FeCl3, 0.68 g ZnCl2 and 2.00 g H3MOF were slowly added to a mixed solvent containing 150 mL deionized water and 50 mL ethylene glycol.
[0130] Stir continuously for 1.5 hours and react at 280°C for 2 hours.
[0131] Add 3 ml of the prepared C-dots and continue the reaction for 2 hours.
[0132] Cool to room temperature and centrifuge at 10,000 rpm for 5 minutes.
[0133] Wash with 150 ml of anhydrous ethanol and centrifuge again.
[0134] After repeating the same operation three times, the product was dried under vacuum at 60°C to obtain Fe / Zn-MOF.
[0135] Step 3: Preparation of Fe / Zn-MOF@C-dots
[0136] Fe / Zn-MOF was prepared according to the methods in steps one and two, without the addition of C-dots, as a comparative experiment.
[0137] Step 4: Sensor Construction
[0138] Fe / Zn-MOF@C-dots were modified onto the surface of a glassy carbon electrode (GCE) using chitosan.
[0139] A biosensor capable of recognizing thiamethoxam was constructed by binding single strands of thiamethoxam DNA aptamers to the surface of composite nanomaterials using a cross-linking agent.
[0140] Step 5: Electrochemical detection
[0141] 0.05 mol / L K4[Fe(CN)6] / K3[Fe(CN)6] (containing 0.1 mol / L KCl) was used as a probe for the electrochemical method.
[0142] Cyclic voltammetry (CV) was performed with a scanning potential range of 0.20V to 0.6V, a scanning rate of 50mV / s, and an amplitude of 50mV.
[0143] Electrochemical impedance spectroscopy (EIS) was performed at a potential of 0.19 V using an AC voltage of 5 mV in the frequency range of 100 mHz to 100 kHz.
[0144] Step Six: Electrochemiluminescence Detection
[0145] The sensor was placed in thiamethoxam solutions of different concentrations for 12 minutes for adsorption before the electrochemiluminescence signal was detected.
[0146] Electrochemiluminescence detection involves placing the electrode in a 0.01 mol / L Tirs-HCl buffer solution (pH = 8.2, containing 25 μL of 30% H2O2) and using a three-electrode system to measure the intensity of ECL.
[0147] In this embodiment, an electrochemiluminescence sensor capable of recognizing thiamethoxam was constructed by preparing Fe / Zn-MOF@C-dots composite nanomaterials and modifying them onto chitosan composite nanomaterials. The concentration of thiamethoxam can be detected using both electrochemical and electrochemiluminescence methods, exhibiting advantages such as high sensitivity, selectivity, rapid response time, repeatability, and stability.
[0148] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions, and improvements made by those skilled in the art within the scope of the technology disclosed in the present invention, and within the spirit and principles of the present invention, should be covered within the scope of protection of the present invention.
Claims
1. A method for preparing a thiamethoxam electrochemiluminescence sensor based on Fe / Zn-MOF@C-dots sensitization, characterized in that, Using Fe / Zn-MOF@C-dots composite nanomaterials as the basic material, combined with C-dots preparation methods and biosensor construction strategies, the detection of thiamethoxam was achieved through an electrochemiluminescence method; The method for preparing the sensor includes: C-dots were prepared under ultrasonic conditions using sucrose, sulfuric acid, and polyethylene glycol 200 as raw materials. Fe / Zn-MOF and C-dots composite nanomaterials were used as the basic material for electrochemiluminescence sensors. C-dots were introduced onto Fe / Zn-MOF to obtain Fe / Zn-MOF@C-dots. A thiamethoxam electrochemiluminescence sensor was constructed by modifying Fe / Zn-MOF@C-dots onto the surface of a glassy carbon electrode using chitosan and then binding a single strand of thiamethoxam DNA aptamer to the surface of the Fe / Zn-MOF@C-dots composite nanomaterial as a recognition element. The prepared sensor was characterized by cyclic voltammetry, electrochemical impedance spectroscopy, and electrochemiluminescence methods, and the detection of thiamethoxam was achieved.
2. The method for preparing the thiamethoxam electrochemiluminescence sensor based on Fe / Zn-MOF@C-dots sensitization according to claim 1, characterized in that, The preparation method of the C-dots includes: Add 0.25 g sucrose, 2 mL deionized water, 0.25 mL sulfuric acid and 6 mL polyethylene glycol 200 to a 10 mL beaker, mix under sonication for 15 min, then centrifuge the product at 5000 rpm for 10 min, dialyze, and adjust the pH to 7.4 to obtain C-dots. The preparation method of the Fe / Zn-MOF@C-dots includes: 0.81 g FeCl3, 0.68 g ZnCl2, and 2.00 g H3BTC were slowly added to a mixed solvent containing 150 mL deionized water and 50 mL ethylene glycol. The mixture was stirred continuously for 1.5 h and reacted at 280 °C for 2 h. 3 mL of the prepared C-dots was added, and the reaction was continued for another 2 h. The mixture was then cooled to room temperature, centrifuged at 10000 rpm / min for 5 min, washed with 150 mL of anhydrous ethanol, and centrifuged again. After repeating the same operation three times, the solid after centrifugation was dried under vacuum at 60 °C to obtain Fe / Zn-MOF@C-dots. The method for constructing the sensor includes: Fe / Zn-MOF@C-dots were modified onto the surface of a glassy carbon electrode (GCE) using chitosan, and then a single strand of thiamethoxam DNA aptamer was bound to the surface of the composite nanomaterial as a recognition element to construct a biosensor for recognizing thiamethoxam. The electrochemiluminescence method includes the detection of: The sensor was placed in thiamethoxam solutions of different concentrations for 12 min for adsorption, and then the electrochemiluminescence signal was detected. The electrochemiluminescence detection was performed by placing the electrode in a Tris-HCl buffer solution of pH 8.2 containing 25 μL of 30% H2O2 and using a three-electrode system to measure the intensity of ECL.
3. The method for preparing the thiamethoxam electrochemiluminescence sensor based on Fe / Zn-MOF@C-dots sensitization according to claim 1, characterized in that, The sequence of the DNA aptamer of the thiamethoxam is: 5'NH2TATGTTCTTAACTGGTCGTCCTGTGAGCCGATCACTAGATAATTAGGAT3'.
4. The method for preparing the thiamethoxam electrochemiluminescence sensor based on Fe / Zn-MOF@C-dots sensitization according to claim 1, characterized in that, The electrochemiluminescence detection was performed on a multifunctional luminescence detector of the MIP-E type electrochemical analysis system. The instrument is equipped with a three-electrode system: the working electrode is a Fe / Zn-MOF@C-dots / aptamer modified GCE electrode, the reference electrode is an Ag / AgCl electrode, and the counter electrode is a platinum wire electrode. The scanning range is 0 ~ 0.8 V, the scan rate is 100 mV / s, the photomultiplier tube voltage is 800 V, the sampling rate is 10 T / s, the amplification factor is 3, and the measurement time is 90 s.
5. The method for preparing the thiamethoxam electrochemiluminescence sensor based on Fe / Zn-MOF@C-dots sensitization according to claim 1, characterized in that, The thiamethoxam electrochemiluminescence sensor based on Fe / Zn-MOF@C-dots sensitization is used for highly sensitive detection of thiamethoxam. The specific steps are as follows: (1) Preparation of actual samples: Weigh 25 g of vegetable sample, add 50 mL of acetonitrile high-speed homogenate for 3 min, filter with medium-speed qualitative filter paper, add 5 g of NaCl, shake well, let stand for 30 min, take 10 mL of supernatant, dry under vacuum at 45℃ on a rotary evaporator, and finally dissolve in 25 mL of Tris-HCl solution for analysis. (2) Plotting the standard curve: Under optimal conditions, the sensor was placed in thiamethoxam solutions of different concentrations to capture the target molecules. Then, the electrode was placed in the luminescent substrate to measure the luminescence intensity and the electrochemiluminescence quenching value of the sensor before and after capturing thiamethoxam was calculated. (3) Actual sample testing and analysis: The sensor was used for the actual detection of thiamethoxam in vegetable samples. After the sensor was placed in the sample solution for adsorption for 12 min, the ECL intensity of the sensor was measured and a spike recovery experiment was performed. At the same time, the sample was detected by high performance liquid chromatography-mass spectrometry for reference.