A ginsenoside nucleic acid lipid nanoparticle, and a preparation method and application thereof
By using ginsenoside Rg3 to replace cholesterol to construct Rg3-LNP, the problem of LNP's inability to deliver nucleic acids to breast cancer tissue was solved, achieving specific expression of neoantigen and enhancing anti-tumor immune effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANDONG UNIV
- Filing Date
- 2023-09-28
- Publication Date
- 2026-08-04
AI Technical Summary
Existing lipid nanoparticles (LNPs) are not effective at delivering nucleic acids to tissues such as breast cancer, and the proportion of cholesterol in LNP formulations is not fully utilized, affecting the efficacy of nucleic acid therapy.
By replacing cholesterol with ginsenoside Rg3, ginsenoside Rg3 lipid nanoparticles (Rg3-LNP) were constructed, and the proportions of other components were optimized to prepare a nucleic acid lipid nanoparticle, thereby improving nucleic acid delivery efficiency.
It achieved specific expression of neoantigens in breast cancer, enhanced anti-tumor immune effects, and had higher transfection efficiency and immunomodulatory capacity.
Smart Images

Figure CN117257765B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of pharmaceutical preparation technology, specifically relating to a ginsenoside nucleic acid lipid nanoparticle, its preparation method, and its application. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] Immunotherapy is one of the fastest-growing and most important cancer treatment strategies in recent years. Significant breakthroughs have been achieved in tumor neoantigen vaccine immunotherapy in recent years. Neoantigens originate from the expression of mutated genes in tumor cells and are a class of tumor-specific antigens that can elicit tumor-specific T-cell immune responses. However, multiple clinical studies in recent years have shown that a large proportion of breast cancer patients still do not respond well to neoantigen immunotherapy. The main reason is that tumors remodel their own immunogenicity during their development, i.e., they lose or weaken neoantigen expression, resulting in T cells being unable to recognize tumor cells not labeled with neoantigens. Therefore, specifically anchoring neoantigens to tumor cells and promoting T-cell recognition and killing of tumors is key to improving the anti-tumor immune response of neoantigen vaccines.
[0004] Delivering nucleic acid sequences containing neoantigens to tumors to promote neoantigen expression is an effective means of reshaping tumor immunogenicity. To achieve efficient nucleic acid delivery, various delivery vectors, including liposomes, polymer micelles, and lipid nanoparticles (LNPs), are under development. LNPs are the most mainstream non-viral gene delivery vector in clinical practice, and the US Food and Drug Administration (FDA) has approved three nucleic acid drugs using LNP technology. An LNP is a modular nanoparticle containing an ionizable lipid, an assistive phospholipid, cholesterol, and a polyethylene glycol lipid. However, LNPs have difficulty delivering nucleic acids to tissues other than the liver and muscle, and the four components have not yet fully explored the potential of nucleic acid therapy. Current research on LNPs focuses on ionizable lipids, while research on other lipid components is limited. Cholesterol typically accounts for 30%–40% of LNP formulations and plays an important role in maintaining the structure of LNPs. Studies have shown that adjusting the cholesterol ratio can improve the transfection efficiency of cationic liposomes.
[0005] Ginsenosides are active ingredients extracted from ginseng. As early as 4000 years ago, people discovered that ginseng has the effects of "greatly replenishing vital energy, calming the mind and improving intelligence, invigorating qi and promoting body fluids, tonifying deficiency and strengthening the body, and prolonging life," making it a powerful tool for enhancing immunity. Ginsenosides are composed of hydrophilic glycosidic chains and hydrophobic aglycones. The aglycones have a steroidal structure similar to cholesterol; however, there are currently no reports of ginsenoside Rg3 participating in LNP formation as a cholesterol substitute. Summary of the Invention
[0006] To address the shortcomings of existing technologies, this invention provides ginsenoside-based nucleic acid lipid nanoparticles, their preparation method, and applications. Through experimental research, this invention has discovered that by replacing cholesterol with ginsenoside Rg3 to construct ginsenoside Rg3-based lipid nanoparticles (Rg3-LNP), nucleic acid-based active ingredients can be delivered, achieving specific expression of neoantigens in breast cancer and enhancing anti-tumor immune effects through the immunomodulatory effects of ginsenosides. Based on these research findings, this invention is thus completed.
[0007] To achieve the above-mentioned technical objectives, the technical solution adopted by the present invention is as follows:
[0008] This invention provides ginsenoside-based nucleic acid lipid nanoparticles, wherein the ginsenoside-based nucleic acid lipid nanoparticles are composed of DLin-MC3-DMA, β-sitosterol, distearate phosphatidylcholine (DSPC), and DSPE-PEG. 2000 It is composed of ginsenoside Rg3.
[0009] Among them, DLin-MC3-DMA, β-sitosterol, DSPC, and DSPE-PEG are mentioned. 2000 The molar ratio of ginsenoside Rg3 is 1–10:30–60:10–40:1–20:0.1–5:0.5–20; furthermore, the DLin-MC3-DMA, β-sitosterol, DSPC, and DSPE-PEG are... 2000 The molar ratio of ginsenoside Rg3 is 1-5:45-50:30-35:5-15:0.5-2:1-10. This invention successfully prepared a nucleic acid lipid nanoparticle (LNP) by replacing cholesterol with ginsenoside Rg3 and optimizing other raw materials and their ratios. Compared with cholesterol, LNP has a higher transfection efficiency.
[0010] In some embodiments, the DLin-MC3-DMA, β-sitosterol, DSPC, and DSPE-PEG are mentioned. 2000 The molar ratio of ginsenoside Rg3 is 4:49.3:33.5:9.9:1.5:5.9.
[0011] The nanoparticles also contain a pharmaceutically active ingredient, which is a nucleic acid or a nucleic acid analog; further, the nucleic acid or nucleic acid analog is siRNA, mRNA, shRNA, lncRNA, pDNA, polyIC, CpG, or a cyclic dinucleotide; specifically, the pharmaceutically active ingredient is pDNA containing a neoantigen nucleic acid sequence.
[0012] In some embodiments, a method for preparing the above-mentioned ginsenoside-based nucleic acid lipid nanoparticles is provided, the method comprising:
[0013] DLin-MC3-DMA, β-sitosterol, DSPC, and DSPE-PEG 2000 Ginsenoside Rg3 was dissolved in an organic solvent and mixed to obtain an organic phase solution;
[0014] The active pharmaceutical ingredient is dissolved in an aqueous phase to obtain an aqueous solution;
[0015] The organic phase solution and the aqueous phase solution are mixed and purified to obtain the final product.
[0016] Among them, DLin-MC3-DMA, β-sitosterol, DSPC, and DSPE-PEG are mentioned. 2000 The molar ratio of ginsenoside Rg3 is 1–10:30–60:10–40:1–20:0.1–5:0.5–20; furthermore, the DLin-MC3-DMA, β-sitosterol, DSPC, and DSPE-PEG are... 2000 The molar ratio of ginsenoside Rg3 is 1-5:45-50:30-35:5-15:0.5-2:1-10;
[0017] In some embodiments, the DLin-MC3-DMA, β-sitosterol, DSPC, and DSPE-PEG are mentioned. 2000 The molar ratio of ginsenoside Rg3 is 4:49.3:33.5:9.9:1.5:5.9.
[0018] The organic solvent may be ethanol, specifically anhydrous ethanol.
[0019] The active pharmaceutical ingredient is a nucleic acid or a nucleic acid analog; further, the nucleic acid or nucleic acid analog is siRNA, mRNA, shRNA, lncRNA, pDNA, polyIC, CpG, or a cyclic dinucleotide; specifically, the active pharmaceutical ingredient is pDNA containing a neoantigen nucleic acid sequence, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0020] The aqueous phase can be a buffer solution. In one specific embodiment of the present invention, the buffer solution is a citrate buffer solution with a pH of 4.0.
[0021] The volume ratio of the organic phase to the aqueous phase is 1:0.1 to 5, preferably 1:2.
[0022] When the active pharmaceutical ingredient is a nucleic acid or a nucleic acid analog, especially pDNA containing a neoantigen nucleic acid sequence, the nitrogen-to-phosphorus ratio (N / P) of DLin-MC3-DMA to the active pharmaceutical ingredient is 1 to 20:1, preferably 15:1.
[0023] The purification steps include: allowing the obtained mixed solution to stand, then dialyzing it in PBS buffer to remove ethanol.
[0024] The Rg3-LNP prepared by the above method exhibits a spherical structure with a particle size of about 150 nm, and also shows a significant Tyndall effect, with higher transfection efficiency.
[0025] In some embodiments, the above-described application of ginsenoside-based nucleic acid lipid nanoparticles in the preparation of drugs is provided.
[0026] The drug can be a drug that targets tumors and also has anti-tumor immune effects.
[0027] It should be noted that, in this invention, the tumor is an abnormal mass of tissue originating from uncontrolled, progressive, excessive cell division, also known as a tumor. Tumors can be benign (non-cancerous) or malignant. Benign tumors described in this invention include one or more of thyroid adenomas, adrenocortical adenomas, pituitary adenomas, gliomas, astrocytomas, and meningiomas; the drugs of this invention can also be used to treat malignant tumors. Examples of malignant tumors treatable with the drugs of this invention include solid tumors and hematologic malignancies. These malignant solid tumors are composed of atypical cells, possess the ability to grow autonomously, have indistinct boundaries, the ability to invade adjacent tissues and blood vessels, and a tendency to spread through the formation of metastases. Malignant solid tumors described in this invention include, but are not limited to, one or more of breast cancer, bladder cancer, melanoma, non-Hodgkin's lymphoma, colorectal cancer, pancreatic cancer, endometrial cancer, prostate cancer, kidney cancer, renal cell carcinoma, non-melanomatous skin cancer, leukemia, thyroid cancer, lung cancer, cervical cancer, ovarian cancer, testicular cancer, and central nervous system tumors.
[0028] The present invention also provides a medicament for tumor treatment comprising the above-mentioned ginsenoside-based nucleic acid lipid nanoparticles. The tumor may be breast cancer.
[0029] The tumor treatment specifically targets the tumor while also having anti-tumor immune effects. The ginsenoside-based nucleic acid lipid nanoparticles also include pharmaceutically acceptable excipients.
[0030] The beneficial technical effects of one or more of the above technical solutions are as follows:
[0031] The above technical solution replaces cholesterol with ginsenoside Rg3, thereby successfully constructing ginsenoside Rg3 lipid nanoparticles Rg3-LNP. At the same time, it contains pDNA with a neoantigen nucleic acid sequence as its active pharmaceutical ingredient, which can effectively realize the specific expression of neoantigen in breast cancer and enhance the anti-tumor immune effect by utilizing the immunomodulatory effect of ginsenoside. Therefore, it has good industrial application value and market prospects. Attached Figure Description
[0032] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0033] Figure 1 Characterization of Rg3-LNP in Example 1 of this invention. (a) Particle size distribution of Rg3-LNP. (b) Zeta potential of Rg3-LNP. (c) Representative cryo-electron microscopy image of Rg3-LNP. (d) Appearance of Rg3-LNP.
[0034] Figure 2 This refers to the transfection efficiency of Rg3-LNP in Example 2 of the present invention.
[0035] Figure 3 This is the flow cytometry result of Rg3-LNP uptake in 4T1 cells in Example 3 of the present invention.
[0036] Figure 4 (a) In vivo DC maturation in Example 4 of the present invention. (b, c) The relative ratio of CD4+ T cells to CD8+ T cells in 4T1 tumor tissue. Detailed Implementation
[0037] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0038] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the present invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. It should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for the purpose of describing specific embodiments and not for limiting the scope of protection of the present invention.
[0039] This invention provides ginsenoside-based nucleic acid lipid nanoparticles, wherein the ginsenoside-based nucleic acid lipid nanoparticles are composed of DLin-MC3-DMA, β-sitosterol, DSPC, and DSPE-PEG. 2000 The nanoparticles are composed of ginsenoside Rg3; the nanoparticles also contain a pharmaceutically active ingredient, which is a nucleic acid or a nucleic acid analog; further, the nucleic acid or nucleic acid analog is siRNA, mRNA, shRNA, lncRNA, pDNA, polyIC, CpG or cyclic dinucleotide; specifically, the pharmaceutically active ingredient is pDNA containing a neoantigen nucleic acid sequence, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0040] The preparation method of ginsenoside-based nucleic acid lipid nanoparticles includes:
[0041] S1, DLin-MC3-DMA, β-sitosterol, DSPC, DSPE-PEG 2000 Ginsenoside Rg3 was dissolved in an organic solvent and mixed to obtain an organic phase solution;
[0042] S2. Dissolve the active pharmaceutical ingredient in an aqueous phase to obtain an aqueous solution;
[0043] S3. The organic phase solution obtained in step S1 and the aqueous phase solution obtained in step S2 are mixed and purified to obtain the final product.
[0044] There is no specific order between steps S1 and S2.
[0045] The ginsenoside nucleic acid lipid nanoparticles are used as anti-tumor drugs, and can be drugs that target tumors while also having anti-tumor immune effects. The ginsenoside-based nucleic acid lipid nanoparticles also include pharmaceutically acceptable excipients. This invention constructs ginsenoside Rg3 lipid nanoparticles Rg3-LNP, which contain the active pharmaceutical ingredient pDNA containing a neoantigen nucleic acid sequence, thereby effectively achieving the specific expression of neoantigens in breast cancer and enhancing the anti-tumor immune effect by utilizing the immunomodulatory effect of ginsenosides.
[0046] The following examples further illustrate the present invention, but do not constitute a limitation thereof. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention. It should be noted that all raw materials used in the present invention are commercially available.
[0047] Example 1: Preparation of Rg3-LNP
[0048] The construction method of Rg3-LNP is as follows: Weigh a certain amount of DLin-MC3-DMA, β-sitosterol, DSPC, and DSPE-PEG. 2000 Cholesterol and ginsenoside Rg3 were dissolved in anhydrous ethanol and mixed in the following molar ratio (DLin-MC3-DMA: β-sitosterol: DSPC: DSPE-PEG). 2000 The ratio of ginsenosides to cholesterol was 4:49.3:33.5:9.9:1.5:5.9 to obtain an organic phase solution. pDNA was dissolved in citrate buffer (pH 4.0) to obtain an aqueous phase solution. The organic and aqueous phases were rapidly mixed at a volume ratio of 1:2, with a DLin-MC3-DMA to pDNA ratio (N / P) of 15:1. After standing for 30 minutes, Rg3-LNP was dialyzed in phosphate-buffered saline (PBS) at pH 7.4 to remove trace amounts of ethanol.
[0049] DLS was used to determine the particle size and PDI of Rg3-LNP prepared with different formulations. Cryo-electron microscopy was used to examine the morphological characteristics of Rg3-LNP. The prepared Rg3-LNP was placed in a transparent cuvette, and the appearance of the formulation was observed and photographed. A red laser beam was used to irradiate one side of the cuvette to observe whether the Tyndall effect was present and photographed.
[0050] The particle size and polydispersity index (PDI) of Rg3-LNP were determined using dynamic light scattering (DLS). The particle size of Rg3-LNP was approximately 150 nm. Figure 1 a) The potential is 2mV ( Figure 1 b). Its microstructure was observed using cryo-electron microscopy, and the results are shown in the figure. Figure 1 c) Rg3-LNPs exhibit a spherical structure with a particle size of approximately 150 nm. The prepared Rg3-LNPs were placed in a transparent cuvette, and the appearance of the formulation was observed and photographed. A red laser beam was then used to illuminate one side of the cuvette to observe and photograph the Tyndall effect. The results are shown in the figure. Figure 1 d) Rg3-LNP exhibits the Tyndall effect.
[0051] Example 2: Evaluation of Rg3-LNP in vitro transfection efficiency
[0052] The transfection efficiency of Rg3-LNP in 4T1 cells was investigated by flow cytometry. 4T1 cells were routinely cultured in RPMI 1640 medium containing 10% FBS and seeded into 12-well plates at a cell number of 1 × 10⁶ cells / well. 5 Transfections were performed on wells. After 12 hours, the medium was replaced with RPMI 1640 medium (without FBS) containing Rg3-LNP (2 μg pDNA per well). After 4 hours, the medium was removed, and the cells were cultured again with 1 mL of medium containing 10% FBS. After 48 hours, the transfection efficiency was quantitatively analyzed by flow cytometry.
[0053] The transfection efficiency of Rg3-LNP in 4T1 cells was investigated by flow cytometry. The results are shown in the figure. Figure 2 Compared with the control group (LNP with cholesterol instead of Rg3), Rg3-LNP had a higher transfection efficiency (p < 0.01).
[0054] Example 3 Evaluation of Rg3-LNP cell uptake
[0055] Nile red-labeled Rg3-LNP was selected. A certain mass of lipids and ginsenosides were weighed and dissolved in anhydrous ethanol (the molar ratio was DLin-MC3-DMA: β-sitosterol: DSPC: DSPE-PEG). 2000 Ginsenosides (r:glucosinolates = 49.3:33.5:9.9:1.5:5.9) were weighed and dissolved in anhydrous ethanol to prepare a 0.1 mg / mL stock solution. A certain volume of the Nile Red stock solution was added to the ethanol solution (Nile Red to lipid molar ratio of 1:200) to prepare the organic phase solution. Citrate buffer at pH 4.0 was used as the aqueous phase. The organic phase and aqueous phase were rapidly mixed at a volume ratio of 1:2. After standing for 30 minutes, Rg3-LNP was dialyzed in buffer at pH 7.4 to remove trace amounts of organic solvent, yielding Nile Red probe-labeled Rg3-LNP. The uptake of Rg3-LNP in 4T1 cells was evaluated by fluorescence inverted microscopy and flow cytometry, respectively. 4T1 cells were cultured in RPMI 1640 medium containing 10% fetal bovine serum and seeded in 12-well plates, 1×10⁶ cells per well. 5 Cells were incubated for 12 hours. Nile red-labeled Rg3-LNP diluted in serum-containing medium was added to each well, with a final Nile red concentration of 200 ng / mL. After 4 hours of incubation, the medium was removed, and the cells were washed three times with PBS. Rg3-LNP uptake by cells was evaluated using flow cytometry.
[0056] The uptake of Rg3-LNP was quantitatively investigated by flow cytometry, and the results are shown in the figure. Figure 3The fluorescence intensities in the control group were 5082.067±494.1647 and 14024.3±161.999, respectively. This indicates that Rg3-LNP was taken up more by tumor cells 4T1 compared to the control group.
[0057] Example 4: Evaluation of the in vivo immunogenicity of Rg3-LNP
[0058] A 4T1 cell orthotopic breast cancer model was established using female BALB / c mice. In short, 0.1 mL of 4T1 cells (1 × 10⁻⁶ cells) was used... 7 An orthotopic breast cancer model was established by injecting Rg3 solution (number of cells / mL) into the mammary fat pads of mice. When the tumor volume approached 100 mm³, the tumor-bearing mice were randomly divided into 5 groups: 1) normal saline (NS); 2) Cho-LNP; 3) Rg3 solution group; 4) Rg3-LNP group. After 15 days, the mice were sacrificed and tumor tissue and lymph nodes were collected. The treated tumor tissue was collected, minced, ground, and filtered through a 200-mesh copper mesh to obtain a single-cell suspension. Lymphocytes were isolated using Percoll and labeled with antibodies. CD3+CD4+ T cells and CD3+CD8+ T cells were analyzed using APC anti-mouse CD3, FITC anti-mouse CD4, and PE anti-mouse CD8. The treated lymph nodes were collected, ground, and filtered through a copper mesh. Mature dendritic cells (DCs) were labeled with anti-PE anti-mouse CD11c, FITC anti-mouse CD80, and PerCP / Cyanine 5.5 anti-mouse CD86. Finally, the content of each immune cell was determined by flow cytometry.
[0059] The in vivo antitumor immune function of Rg3-LNP was evaluated. The maturation status of dendritic cells (DCs) in mouse lymph nodes was assessed by flow cytometry. DC maturation was compared by measuring the ratio of CD80 and CD86 molecules. Figure 4 As shown, compared to the normal saline (NS) group, Cho-LNP group, and free Rg3 group, the Rg3-LNP group significantly increased the proportion of dendritic cells (DCs). The efficacy of immunotherapy was assessed by measuring the levels of CD4+ T cells and CD8+ T cells in mouse tumor tissue. Compared to the NS group, Cho-LNP group, and free Rg3 group, the Rg3-LNP group increased the proportion of CD4+ T and CD8+ T cells in the tumor.
[0060] Nucleotide sequences used in the examples
[0061] pDNA containing neoantigen nucleic acid sequences:
[0062] GCTAGCGCCACCATGGAGACAGATACACTGCTGCTGTGGGTGCTGCTGTGGGTCC
[0063] CCGGCAGCACAGGCGACATGGTGAGGTCCGACAAGACCCACACCTGTCCTCCTT
[0064] GCCCTGCCCCTGAGCTGCTGGCGGACCAAGCGTGTTCCTGTTCCCTCCTAAGCC
[0065] CAAGGACACACTGATGATCAGCAGAACACCTGAGGTGACATGCGTGGTGGA
[0066] TGTGAGCCACGAGGACCCCGAGGTGAAGTTCAACTGGTACGTGGACGGCGTGGA
[0067] GGTGCACAACGCCAAGACCAAGCCCAGGGAGGAGCAGTACAACAGCACATACA
[0068] GAGTGGTGAGCGTGCTGACCGTGCTGCACCAGGACTGGCTGAACGGCAAGGAGT
[0069] ACAAGTGTAAGGTGTCCAACAAGGCCCTGCCCGCCCCTATCGAGAAGACCATCA
[0070] GCAAGGCCAAGGGCCAGCCCAGGGAGCCCCAGGTTTACACCCTGCCTCCTTCCA
[0071] GAGAGGAGATGACAAAAGAACCAGGTGTCCCTGACCTGCCTGGTGGAAGGGCTTCT
[0072] ACCCTTCCGATATTGCCGTGGAGTGGGAGTCCAACGGCCAGCCCGAGAAACACT
[0073] ACAAGACAACACCTCCTGTGCTGGACTCCGACGGCAGCTTCTTCCTGTACTCCAA
[0074] GCTGACCGTGGATAAGTCCAGGTGGCAGCAGGGCAACGTGTTCAGCTGTTCCGT
[0075] GATGCACGAGGCCCTGCACAACCACTACACACAGAAGAGCCTGAGCCTGTCCCC
[0076] TGGCAAGATGCAGGGAGTGACCGTGCTGGCCGTGTCCGCCGTGTACGACATCTTCGTGTTCCACAGGCTGAAGATGAAGCAGATCCTGCCCCCACCGGT (SEQ ID NO.1) It should be noted that the above examples are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to the given examples, those skilled in the art can modify or make equivalent substitutions to the technical solutions of the present invention as needed, without departing from the spirit and scope of the technical solutions of the present invention.
Claims
1. A ginsenoside nucleic acid lipid nanoparticle, comprising, The ginsenoside-based nucleic acid lipid nanoparticles are composed of DLin-MC3-DMA, β-sitosterol, distearate phosphatidylcholine (DSPC), and DSPE-PEG. 2000 Composed of ginsenoside Rg3; The nanoparticles also contain a pharmaceutically active ingredient, which is pDNA containing a neoantigen nucleic acid sequence, the nucleotide sequence of which is shown in SEQ ID NO.
1.
2. The ginsenoside nucleic acid lipid nanoparticle of claim 1, wherein, The molar ratio of the DLin-MC3-DMA, beta-sitosterol, DSPC, DSPE-PEG 2000 and ginsenoside Rg3 is 1-10: 30-60: 10-40: 1-20: 0.1-5: 0.5-20.
3. The ginsenoside-based nucleic acid lipid nanoparticles as described in claim 2, characterized in that, DLin-MC3-DMA, beta-sitosterol, DSPC, DSPE-PEG 2000 and ginsenoside Rg3 are in a molar ratio of 1-5:45-50:30-35:5-15:0.5-2:1-10.
4. The method of claim any one of claims 1-3, wherein the ginsenoside- based nucleic acid lipid nanoparticle is prepared by, The preparation method includes: DLin-MC3-DMA, beta-sitosterol, DSPC, DSPE-PEG 2000 and ginsenoside Rg3 were dissolved in organic solvents to obtain an organic phase solution; The active pharmaceutical ingredient is dissolved in an aqueous phase to obtain an aqueous solution; The organic phase solution and the aqueous phase solution are mixed and purified to obtain the final product.
5. The production method according to claim 4, wherein The organic solvent is ethanol.
6. The production method according to claim 5, wherein The organic solvent is anhydrous ethanol.
7. The production method according to claim 4, wherein The aqueous phase is a buffer solution; The volume ratio of the organic phase to the aqueous phase is 1:0.1~5; The nitrogen-to-phosphorus ratio of DLin-MC3-DMA to the active pharmaceutical ingredient is 1~20:
1.
8. The production method according to claim 7, wherein The buffer solution is a citrate buffer solution with a pH of 4.
0.
9. The production method according to claim 4, wherein The purification steps include: allowing the obtained mixed solution to stand, then dialyzing it in PBS buffer to remove ethanol.