Amino-functionalized gold nanoparticle ink modified ternary heterojunction biosensor and preparation method thereof

Abstract

This disclosure relates to a ternary heterojunction biosensor modified with aminated gold nano-ink and its preparation method, specifically involving the field of photoanode thin films for biosensors. The biosensor comprises a conductive substrate, and sequentially disposed on one side of the conductive substrate a TiO2 / BiVO4 / MoS2 composite thin film layer, an aminated gold nano-ink layer, and an aptamer probe layer. The preparation method includes: 1. Obtaining BiVO4 powder, a TiO2 / BiVO4 / MoS2 composite, aminated gold nano-ink, and an aptamer probe solution; 2. Printing the TiO2 / BiVO4 / MoS2 composite onto the conductive substrate to form a TiO2 / BiVO4 / MoS2 composite thin film layer; 3. Printing the aminated gold nano-ink onto the TiO2 / BiVO4 / MoS2 composite thin film layer to obtain a photoanode thin film; 4. Spraying the aptamer probe solution onto the photoanode thin film in a predetermined amount, and sealing non-specific binding sites with a protein-free blocking solution.

Description

Technical Field

[0001] This disclosure relates to the field of photoanode thin film technology for biosensors, and more specifically, to a ternary heterojunction biosensor modified with aminated gold nano-ink and its preparation method. Background Technology

[0002] Semiconductor photoelectric biosensors are a novel type of sensor integrating electrochemical and optical sensors. They utilize the non-equilibrium charge carriers generated after a semiconductor thin film absorbs photons to oxidize or reduce the target material specifically captured on its surface, achieving a depolarization reaction and thus inducing a change in photocurrent density. Since there is a linear relationship between the photocurrent density and the target material concentration, quantitative analysis of the target material can be achieved. Because the excitation signal (photon) and the detection signal (electron) do not interfere with each other (heterogeneous signal), they have advantages over traditional detection methods (chromatography, immunofluorescence, electrochemical methods, etc.) such as lower background noise, higher sensitivity, and higher cost-effectiveness. Therefore, PEC biosensors have great application prospects in many detection fields such as environment, medicine, and food.

[0003] However, there are still many key technological breakthroughs needed for the application of photoelectrochemical biosensors. First, how to achieve efficient directional transport of charge carriers in semiconductor materials under photoexcitation; second, how to ensure the stability of photoelectric signals from semiconductor materials; and finally, how to achieve biocompatibility on the surface of photoelectric materials.

[0004] It should be noted that the information disclosed in the background section above is only used to enhance the understanding of the background of this disclosure, and therefore may include information that does not constitute prior art known to those skilled in the art. Summary of the Invention

[0005] The purpose of this disclosure is to overcome the shortcomings of the prior art and provide a ternary heterojunction biosensor modified with aminated gold nano-ink and its preparation method, which improves the detection sensitivity of the biosensor and increases the binding affinity between the photoanode film and the biological probe.

[0006] According to one aspect of this disclosure, a ternary heterojunction biosensor modified with aminated gold nano-ink includes: a conductive substrate;

[0007] A TiO2 / BiVO4 / MoS2 composite thin film layer, an aminated gold nano-ink layer, and an aptamer probe layer are sequentially disposed on one side of a conductive substrate.

[0008] In an exemplary embodiment of this disclosure, the thickness of the TiO2 / BiVO4 / MoS2 composite thin film layer is 200nm to 1000nm; the mass ratio of TiO2 / BiVO4 / MoS2 in the TiO2 / BiVO4 / MoS2 composite thin film layer is (3 to 8): (0.5 to 2): (0.1 to 0.5).

[0009] In one exemplary embodiment of this disclosure, the size of the aminated gold nanoparticles in the aminated gold nano-ink layer is 2 nm to 10 nm.

[0010] In one exemplary embodiment of this disclosure, the aptamer probe layer includes a DNA aptamer base sequence: 5′-HS-TTTTTATACCAGCTTATTCAATTTGAGGCTCG ATCACAATCGTAATCAGTTAG-3′, for detecting quinolone antibiotics.

[0011] In one exemplary embodiment of this disclosure, the aptamer probe layer includes a DNA aptamer base sequence: 5′-HS-TTTTTGGGGGTTGAGGCTAAGCCGATTT-3′, for detecting kanamycin.

[0012] In one exemplary embodiment of this disclosure, the aptamer probe layer includes a DNA aptamer base sequence: 5′-HS-TTTTTCGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCT TGGGTTGGTCCGACTGCGCGTGGATCCGAGCTCCACGTG-3′, for detecting tetracycline.

[0013] According to another aspect of this disclosure, a method for preparing a ternary heterojunction biosensor modified with aminated gold nanoparticle ink includes the following steps:

[0014] S1. Obtain BiVO4 powder, TiO2 / BiVO4 / MoS2 complex, aminated gold nano-ink, and aptamer probe solution.

[0015] S2. Print the TiO2 / BiVO4 / MoS2 composite on a predetermined position on a conductive substrate to form a TiO2 / BiVO4 / MoS2 composite thin film layer;

[0016] S3. Print aminated gold nano-ink onto a TiO2 / BiVO4 / MoS2 composite film layer to obtain a photoanode film; the photoanode film includes a stacked TiO2 / BiVO4 / MoS2 composite film layer and an aminated gold nano-ink layer;

[0017] S4. Spray the aptamer probe solution onto the photoanode film in a preset amount, and block the non-specific binding sites with a protein-free blocking solution.

[0018] In an exemplary embodiment of this disclosure, obtaining BiVO4 powder in step S1 includes: dissolving Bi(NO3)3·5H2O powder in a deionized aqueous solution and ultrasonically mixing for 30-60 min to obtain a Bi(NO3)3·5H2O aqueous solution;

[0019] Prepare a KI aqueous solution;

[0020] KI aqueous solution was added in batches to Bi(NO3)3·5H2O aqueous solution while stirring to obtain a suspension with BiOI precipitate; wherein, during the mixing of KI aqueous solution and Bi(NO3)3·5H2O aqueous solution, Bi was kept at a constant temperature. 3+ and I - The molar ratio is ≥1;

[0021] The suspension containing BiOI precipitate was heated to 160–180°C and kept at that temperature for 8–12 h. The heated product was washed repeatedly with ethanol and distilled water, filtered, and dried to obtain BiOI powder.

[0022] Vanadium acetylacetonate was dissolved in dimethyl sulfoxide solution to obtain a vanadium acetylacetonate solution;

[0023] The acetylacetone vanadium oxide solution was mixed and ground with BiOI powder, dried at 100-120℃ for 1-2 hours, and then kept at 450-500℃ for 1-2 hours to obtain the BiVO4 precursor.

[0024] BiVO4 precursor was washed with NaOH solution and dried to obtain BiVO4 powder.

[0025] In an exemplary embodiment of this disclosure, step S1, obtaining the TiO2 / BiVO4 / MoS2 composite includes:

[0026] TiO2 powder, BiVO4 powder and MoS2 powder are mixed and ground to obtain composite powder; wherein the mass ratio of TiO2 powder, BiVO4 powder and MoS2 powder is in the range of (3~8):(0.5~2):(0.1~0.5);

[0027] Butyl carbitol, butyl carbitol acetate, Span, glass powder and ethyl cellulose are mixed evenly and heated to 50-70°C to form a colloid.

[0028] The composite powder is mixed with the colloid to obtain a TiO2 / BiVO4 / MoS2 composite for preparing TiO2 / BiVO4 / MoS2 composite thin films.

[0029] In one exemplary embodiment of this disclosure, step S1, obtaining aminated gold nano-ink includes:

[0030] A mixture of L-cysteine ​​aqueous solution and chloroauric acid aqueous solution was heated and stirred until homogeneous to obtain a chloroauric acid / L-cysteine ​​mixed solution.

[0031] Sodium borohydride solution was added to a chloroauric acid / L-cysteine ​​mixed solution, stirred, and centrifuged at 10,000–12,000 rpm. The precipitate was collected and dispersed in an ethylene glycol solution to obtain aminated gold nano-ink.

[0032] This disclosure discloses a TiO2 / BiVO4 / MoS2 composite thin film layer prepared by mixing TiO2, BiVO4, and MoS2. This thin film layer possesses excellent photoelectric properties and higher stability as a photoanode material, resulting in increased sensitivity to target signals compared to biosensors prepared using a single semiconductor material. Furthermore, the addition of an aminated gold nano-ink layer to the TiO2 / BiVO4 / MoS2 composite thin film layer facilitates the immobilization of the aptamer probe, increasing the bioaffinity of the photoelectric material to the biological probe material.

[0033] It should be understood that the above general description and the following detailed description are exemplary and explanatory only, and are not intended to limit this disclosure. Attached Figure Description

[0034] The accompanying drawings, which are incorporated in and form part of this specification, illustrate embodiments consistent with this disclosure and, together with the description, serve to explain the principles of this disclosure. It is obvious that the drawings described below are merely some embodiments of this disclosure, and those skilled in the art can obtain other drawings based on these drawings without any inventive effort.

[0035] Figure 1 This is a schematic diagram of a ternary heterojunction biosensor structure modified with aminated gold nano-ink in one embodiment of the present disclosure.

[0036] Figure 2 This is a scanning electron microscope image of a BiVO4 thin film in one embodiment of the present disclosure.

[0037] Figure 3 This is a scanning electron microscope image of NH2-Au nanoparticles in one embodiment of the present disclosure.

[0038] Figure 4 This is a scanning electron microscope image of a TiO2 / BiVO4 / MoS2 composite film in one embodiment of the present disclosure.

[0039] Figure 5This is an element mapping image of the Ti element in one embodiment of the present disclosure.

[0040] Figure 6 This disclosure provides an element mapping image of the Bi element in one embodiment.

[0041] Figure 7 This is an element mapping image of Au elements in one embodiment of the present disclosure.

[0042] Figure 8 This is a comparison chart of the IT curves of various photoanode thin films in one embodiment of this disclosure.

[0043] Figure 9 This is a comparison chart of JV curves for various photoanode thin films in one embodiment of this disclosure.

[0044] Figure 10 In one embodiment of this disclosure, TiO2 / BiVO4 / MoS 2- A schematic diagram of the detection results of kanamycin by the NH2-Au sensor.

[0045] Figure 11 This is a schematic diagram illustrating the detection results of tetracycline by the TiO2 / BiVO4 / MoS2-NH2-Au sensor in one embodiment of this disclosure.

[0046] Figure 12 This is a schematic diagram illustrating the detection results of a TiO2 / BiVO4 / MoS2-NH2-Au sensor for quinolones in one embodiment of this disclosure.

[0047] The attached figures are labeled as follows:

[0048] 10. Conductive substrate; 20. TiO2 / BiVO4 / MoS2 composite thin film layer; 30. Aminated gold nano-ink layer; 40. Aptamer probe layer. Detailed Implementation

[0049] Exemplary embodiments will now be described more fully with reference to the accompanying drawings. However, these exemplary embodiments can be implemented in many forms and should not be construed as limited to the embodiments set forth herein; rather, they are provided so that this disclosure will be thorough and complete, and will fully convey the concept of the exemplary embodiments to those skilled in the art. The same reference numerals in the drawings denote the same or similar structures, and therefore detailed descriptions of them will be omitted. Furthermore, the drawings are merely illustrative of this disclosure and are not necessarily drawn to scale.

[0050] Although relative terms, such as "above," are used in this specification to describe the relative relationship of one component of an icon to another, these terms are used only for convenience, such as according to the orientation of the examples shown in the accompanying drawings. It is understood that if the device of the icon is flipped so that it is upside down, the component described as "above" will become the component below. When a structure is "above" another structure, it may mean that the structure is integrally formed on the other structure, or that the structure is "directly" mounted on the other structure, or that the structure is "indirectly" mounted on the other structure through another structure.

[0051] The terms “a,” “one,” “the,” and “the” are used to indicate the existence of one or more elements / components / etc.; the terms “include” and “have” are used to indicate an open-ended meaning of inclusion and that other elements / components / etc. may exist in addition to the listed elements / components / etc.

[0052] This disclosure provides a ternary heterojunction biosensor modified with aminated gold nano-ink, such as... Figure 1 The biosensor comprises a conductive substrate 10, and a TiO2 / BiVO4 / MoS2 composite thin film layer 20, an aminated gold nano-ink layer 30, and an aptamer probe layer 40 sequentially disposed on one side of the conductive substrate 10. In this embodiment, the TiO2 / BiVO4 / MoS2 composite thin film layer 20 is prepared by mixing TiO2, BiVO4, and MoS2, giving the thin film layer excellent photoelectric properties and making it a more stable photoanode material. Compared with biosensors prepared using a single semiconductor material, the sensitivity of the response signal to the target substance is increased. Simultaneously, by adding the aminated gold nano-ink layer 30 to the TiO2 / BiVO4 / MoS2 composite thin film layer 20, the immobilization of the aptamer probe is facilitated, increasing the bioaffinity of the photoelectric material to the biological probe material.

[0053] In one embodiment of this disclosure, the thickness of the TiO2 / BiVO4 / MoS2 composite thin film layer 20 is 200 nm to 1000 nm; the mass ratio of TiO2 / BiVO4 / MoS2 in the TiO2 / BiVO4 / MoS2 composite thin film layer 20 is (3-8):(0.5-2):(0.1-0.5). For example, the thickness of the TiO2 / BiVO4 / MoS2 composite thin film layer 20 can be 200 nm, 300 nm, 400 nm, 450 nm, 600 nm, 700 nm, 850 nm, 900 nm, or 1000 nm. The mass ratio of TiO2 / BiVO4 / MoS2 in the TiO2 / BiVO4 / MoS2 composite thin film layer 20 can be 5.5:1:0.1, 3:2:0.3, 8:1.2:0.5, 4:0.5:0.45, or 7:1.8:0.2.

[0054] In one embodiment of this disclosure, the size of the aminated gold nanoparticles in the aminated gold nano-ink layer 30 is 2 nm to 10 nm. For example, the size of the aminated gold nanoparticles can be 2 nm, 10 nm, 6 nm, 8 nm, 4 nm, 5 nm, 3 nm, or 7 nm.

[0055] In one embodiment of this disclosure, the aptamer probe layer 40 includes a DNA aptamer base sequence: 5′-HS-TTTTTATACCAGCTTATTCAATTTGAGGCTCG ATCACAATCGTAATCAGTTAG-3′ (SEQ ID NO: 1). This sequence can be used to detect quinolone antibiotics. It is understood that, according to actual detection needs, specific bases can be added to or adjusted on the above DNA aptamer base sequence to make it more specific for a single quinolone antibiotic. For example, the DNA aptamer base sequence can be 5′-HS-TTTTT ATA CCA GCT TAT TCA ATT-N10-TGA GGC TCG ATC-N40-ACA ATC GTA ATC AGT TAG-3′ (SEQ ID NO: 2), where N10 is an ATT base sequence repeated ten times, and N40 is an ATC base sequence repeated 40 times. The DNA aptamer base sequence corresponding to SEQ ID NO: 2 can achieve more sensitive measurement of quinolones.

[0056] In one embodiment of this disclosure, the aptamer probe layer 40 includes a DNA aptamer base sequence: 5′-HS-TTTTTGGGGGTTGAGGCTAAGCCGATTT-3′ (SEQ ID NO: 3), which can be used for the specific detection of kanamycin.

[0057] In one embodiment of this disclosure, the aptamer probe layer 40 includes a DNA aptamer base sequence: 5′-HS-TTTTTCGTACGGAATTCGCTAGCCCCCCG GCAGGCCACGGCTTGGGTTGGTCCGACTGCGCGTGGATCCGAGCT CCACGTG-3′ (SEQ ID NO:4), which can be used for the specific detection of tetracycline.

[0058] This disclosure also provides a method for preparing a ternary heterojunction biosensor modified with aminated gold nano-ink, the method comprising the following steps:

[0059] S1. Obtain BiVO4 powder, TiO2 / BiVO4 / MoS2 composite, aminated gold nano-ink, and aptamer probe solution.

[0060] In one embodiment of this disclosure, obtaining BiVO4 powder includes:

[0061] 1 mmol of Bi(NO3)3·5H2O powder can be dissolved in deionized water and ultrasonically mixed for 30–60 min, for example, ultrasonic mixing for 30 min, 35 min, 40 min, 45 min, 50 min, 55 min, and 60 min. 1 mmol of solid KI can be dissolved in deionized water to prepare a KI aqueous solution. The KI aqueous solution is added in batches to the prepared Bi(NO3)3·5H2O solution while stirring to obtain a suspension with BiOI precipitate. During the mixing of KI and Bi(NO3)3·5H2O, Bi... 3+ with I - The molar ratio is ≥1. The suspension containing BiOI precipitate can be placed in a polytetrafluoroethylene (PTFE) reactor and hydrothermally heated at 160–180°C for 8–12 hours. The product after hydrothermal treatment is repeatedly washed with ethanol and distilled water, filtered, and dried to obtain BiOI powder. For example, hydrothermal treatment can be performed at 160°C for 10 hours, 180°C for 8 hours, 170°C for 10 hours, 175°C for 9 hours, 165°C for 11 hours, or 170°C for 12 hours in a PTFE reactor.

[0062] Dissolve 0.5–0.8 g of vanadium acetylacetonate in 10 ml of dimethyl sulfoxide solution to obtain a vanadium acetylacetonate solution. The mass of vanadium acetylacetonate can be 0.5 g, 0.55 g, 0.6 g, 0.7 g, or 0.8 g. Mix the vanadium acetylacetonate solution with BiOI powder and grind. After drying at 100–120 °C for 1–2 h, place the mixture in a crucible and heat at 450–500 °C for 1–2 h to obtain a BiVO4 precursor. Wash the BiVO4 precursor with NaOH solution and dry it to obtain BiVO4 powder.

[0063] For example, after mixing and grinding acetylacetone vanadium oxide solution with BiOI powder, it can be dried at 100℃ for 1 hour, 110℃ for 1 hour, 120℃ for 1.5 hours, or 105℃ for 2 hours. High-temperature heating in a crucible can be performed by holding at 450℃ for 1.5 hours, 500℃ for 1 hour, 480℃ for 2 hours, or 465℃ for 1.5 hours.

[0064] In one embodiment of this disclosure, obtaining the TiO2 / BiVO4 / MoS2 composite includes: mixing and grinding TiO2 powder, BiVO4 powder and MoS2 powder to obtain composite powder; wherein the mass ratio of TiO2 powder, BiVO4 powder and MoS2 powder is in the range of (3-8):(0.5-2):(0.1-0.5).

[0065] In one example, 0.3–0.8 g of 2 μm hydrophilic TiO2 powder, 0.05–0.2 g of BiVO4 powder, and 0.01–0.05 g of MoS2 powder can be mixed and ground for 30–60 min to obtain a composite powder. For example, the TiO2 powder, BiVO4 powder, and MoS2 powder can be 0.55 g, 0.1 g, and 0.01 g, respectively, ground for 30 min; or 0.3 g, 0.2 g, and 0.03 g, ground for 50 min; or 0.8 g, 0.12 g, and 0.05 g, ground for 40 min; or 0.4 g, 0.05 g, and 0.045 g, ground for 60 min; or 0.7 g, 0.18 g, and 0.02 g, ground for 45 min.

[0066] Mix 0.5–1.5 g of butyl carbitol, 1.0–2.0 g of butyl carbitol acetate, 0.01–0.03 g of Span, 0.01–0.05 g of glass powder, and 0.1–0.2 g of ethyl cellulose evenly and heat to 50–70°C to form a slightly yellow resinous colloid.

[0067] The composite powder is mixed with the colloid to obtain a TiO2 / BiVO4 / MoS2 composite for screen printing to prepare TiO2 / BiVO4 / MoS2 composite thin film layer 20.

[0068] In one embodiment of this disclosure, the preparation of aminated gold nano-ink specifically involves:

[0069] Take 10 mL of a concentrated chloroauric acid aqueous solution with a concentration of 10 mg / mL, add water, and stir on a magnetic stirrer for 1–2 hours until homogeneous to obtain a chloroauric acid aqueous solution. Dissolve 0.5–0.8 mol of L-cysteine ​​in water to obtain an L-cysteine ​​aqueous solution. For example, the molar amount of L-cysteine ​​can be 0.5 mol, 0.55 mol, 0.6 mol, 0.7 mol, 0.75 mol, or 0.8 mol.

[0070] Aqueous solutions of L-cysteine ​​and chloroauric acid were mixed and heated and stirred until homogeneous to obtain a chloroauric acid / L-cysteine ​​mixed solution.

[0071] Sodium borohydride solution is added to a chloroauric acid / L-cysteine ​​mixed solution, and after continuous stirring, it is centrifuged at 10,000–12,000 rpm for 10–20 min. The precipitate is collected and dispersed in ethylene glycol solution to obtain aminated gold nano-ink. For example, the precipitate can be centrifuged at 12,000 rpm for 10 min, 11,500 rpm for 20 min, 11,000 rpm for 15 min, 10,500 rpm for 13 min, or 10,000 rpm for 18 min. It should be noted that for small-scale laboratory operations, sodium borohydride solution can be added to the chloroauric acid / L-cysteine ​​mixed solution all at once. However, for large-scale production, the sodium borohydride solution can be added to the chloroauric acid / L-cysteine ​​mixed solution in batches, depending on the actual situation.

[0072] S2. The TiO2 / BiVO4 / MoS2 composite is printed onto the conductive substrate 10 according to the preset positions, and then cured by heating to form a TiO2 / BiVO4 / MoS2 composite thin film layer 20. The conductive substrate can be ITO conductive glass. Before use, the ITO conductive glass is pretreated. For example, the ITO conductive glass can be immersed in a special cleaning agent, maintaining the cleaning solution temperature at 60°C, and ultrasonically cleaned for 30 minutes. After cleaning, it is dried with high-purity N2 gas, thus completing the pretreatment.

[0073] In one example, the TiO2 / BiVO4 / MoS2 composite is screen-printed onto a conductive substrate 10 using a 300-500 mesh screen. For example, the screen can be 300 mesh, 400 mesh, 450 mesh, 380 mesh, or 500 mesh.

[0074] In one example, the printed conductive substrate 10 can be cured by heating it in a muffle furnace at 300–400°C for 30–60 minutes. For example, it can be heated in a muffle furnace at 300°C for 60 minutes, or at 350°C for 50 minutes, or at 320°C for 40 minutes, or at 400°C for 30 minutes, or at 380°C for 55 minutes.

[0075] S3. After cooling, the TiO2 / BiVO4 / MoS2 composite thin film layer 20 is printed with aminated gold nano-ink to obtain a TiO2 / BiVO4 / MoS2-NH2-Au photoanode thin film.

[0076] S4. The aptamer probe solution is uniformly sprayed onto the TiO2 / BiVO4 / MoS2-NH2-Au photoanode film at a preset amount. The film is then incubated at 37°C. After removal and cleaning, non-specific binding sites are blocked with a protein-free blocking solution. In one example, the preset amount of the aptamer probe solution sprayed can be 10–30 μL; for example, the preset amount can be 10 μL, 15 μL, 20 μL, 25 μL, or 30 μL.

[0077] The method for fabricating a ternary heterojunction biosensor modified with aminated gold nanoparticle ink disclosed in this disclosure involves preparing a composite photoanode semiconductor thin film by mixing TiO2 powder, BiVO4 powder, and MoS2 powder in a specific ratio, resulting in a more stable photoelectric signal in the prepared biosensor. Simultaneously, the addition of an aminated gold nanolayer suppresses carrier recombination, which is beneficial for the efficient directional transport of photoexcited carriers. The aminated gold nanolayer also enhances the immobilization of biological probes and improves the bioaffinity of the photoelectric film layer for the biological probes.

[0078] The following specific examples, in conjunction with the accompanying drawings, further illustrate the fabrication method of the biosensor provided in this disclosure.

[0079] Example 1

[0080] Step 1: Pre-treat the conductive substrate 10. In this embodiment, ITO conductive glass (2.5cm×1.2cm×0.55cm, sheet resistance ≤10Ω) is used.

[0081] Step 2: Dissolve 1 mmol Bi(NO3)3·5H2O powder in 50 mL of deionized water and sonicate for 30 min. Dissolve 1 mmol KI in 20 mL of deionized water; add the KI solution dropwise to the prepared Bi(NO3)3·5H2O solution while stirring. The solution gradually turns brick red, obtaining a suspension with a brick red BiOI precipitate. After static sedimentation, a brick red BiOI precipitate will form. Place the suspension with the brick red BiOI precipitate in a 100 mL polytetrafluoroethylene reactor and hydrothermally heat at 180 °C for 8 h.

[0082] The reactants obtained by hydrothermal treatment were repeatedly washed with ethanol and distilled water and filtered. They were then dried at 80°C for 8 hours to obtain BiOI powder.

[0083] Weigh 0.6g of acetylacetonate vanadyl and dissolve it in 10mL of dimethyl sulfoxide solution. Shake until completely dissolved to obtain acetylacetonate vanadyl solution.

[0084] The acetylacetone vanadium oxide solution was mixed and ground with BiOI powder, and dried at 100℃ for 1 hour. Then the dried powder was placed in a crucible and kept at 450℃ for 1 hour. The resulting powder sample is the BiVO4 precursor.

[0085] The obtained BiVO4 precursor powder was washed with 1M NaOH solution to obtain BiVO4 powder, as shown below. Figure 2 The image shown is a scanning electron microscope image of a BiVO4 thin film.

[0086] Step 3: Take 10 mL of concentrated chloroauric acid aqueous solution with a concentration of 10 mg / mL, dilute with water, place on a magnetic stirrer and stir for 1 hour until homogeneous to obtain chloroauric acid aqueous solution.

[0087] 0.7 mol of L-cysteine ​​was dissolved in 10 mL of water and shaken until dissolved to obtain an aqueous solution of L-cysteine.

[0088] Mix aqueous solutions of chloroauric acid and L-cysteine, and heat and stir continuously for 30 minutes until the amino acids and gold ions are fully mixed and homogeneous. The resulting solution is a chloroauric acid / L-cysteine ​​mixed solution.

[0089] Dissolve 1 mol of sodium borohydride in 5 mL of ultrapure water and shake until homogeneous. The resulting solution is a sodium borohydride solution.

[0090] Adding sodium borohydride solution to a chloroauric acid / L-cysteine ​​mixed solution at once resulted in a gradual color change. After stirring for 1 hour, the solution was transferred to a 10 mL centrifuge tube and centrifuged at 12000 rpm for 10 minutes. The precipitate obtained by centrifugation was redispersed in ethylene glycol solution to obtain aminated gold nano-ink. Figure 3The image shown is a scanning electron microscope image of NH2-Au nanoparticles.

[0091] Step 4: Weigh 0.55g of 2μm hydrophilic TiO2 powder, 0.1g of BiVO4 powder and 0.01g of MoS2 powder, mix and grind the three powders for 30min to obtain a gray composite powder.

[0092] Mix 1.1g of butyl carbitol, 1.8g of butyl carbitol acetate, 0.025g of Span, 0.05g of glass powder and 0.1g of ethyl cellulose evenly and heat to 60°C to form a slightly yellow resinous colloid.

[0093] The prepared composite powder was mixed with the colloid to obtain a TiO2 / BiVO4 / MoS2 composite for screen printing. Figure 4 The image shown is a scanning electron microscope image of the TiO2 / BiVO4 / MoS2 composite film.

[0094] Step 5: The prepared TiO2 / BiVO4 / MoS2 composite was screen-printed onto a conductive ITO substrate using a 500-mesh screen and placed in a muffle furnace at 350℃ for 50 minutes. After cooling, NH2-Au ink was printed onto the TiO2 / BiVO4 / MoS2 film using a microelectronic printer, thus obtaining the TiO2 / BiVO4 / MoS2-NH2-Au photoanode film. Figures 5-7 The images shown are elemental composition images of Ti, Bi, and Au obtained using scanning electron microscopy, with the bright fields corresponding to Ti, Bi, or Au, respectively. Figure 8 and Figure 9 The diagram shows a comparison of the IT and JV curves of the photoanode films for the biosensor, specifically TiO2, TiO2 / BiVO4, TiO2 / BiVO4 / MoS2, and TiO2 / BiVO4 / MoS2-NH2-Au photoanode films. It can be seen that compared to pure TiO2, TiO2 / BiVO4 / MoS2-NH2-Au exhibits superior photoelectric performance. Furthermore, the JV characteristic shows a linear increasing trend, which will enable the biosensor to have a wider linear detection region.

[0095] Step 6: 20 μL of kanamycin probe solution was uniformly and quantitatively sprayed onto the surface of the TiO2 / BiVO4 / MoS2-NH2-Au photoanode film prepared in Step 5. The probe-sprayed photoanode film was then incubated at 37°C for 20 min in a constant temperature incubator, followed by rinsing with phosphate buffer. After rinsing, non-specific binding sites were blocked using a protein-free blocking solution, followed by washing again and drying to obtain a biosensor for the specific detection of kanamycin. The base sequence of the kanamycin DNA aptamer is: 5′-HS-TTTTTGGGGGTTGAGGCTAAGCCGATTT-3′ (SEQ ID NO: 3).

[0096] like Figure 10 The results of the biosensor provided in this embodiment for the detection of kanamycin are shown. It can be seen that the detection range of the biosensor for kanamycin is 10 pg / mL to 100 ng / mL, and the detection limit is 3.50 pg / mL.

[0097] It should be noted that the order of steps 1 to 4 can be changed, and is not limited to the above order of operations.

[0098] Example 2

[0099] Steps 1 to 5 are the same as in Example 1.

[0100] Step 6: 20 μL of tetracycline probe solution was uniformly and quantitatively sprayed onto the surface of the TiO2 / BiVO4 / MoS2-NH2-Au photoanode film prepared in Step 5. The photoanode film after probe spraying was incubated at 37°C for 20 min in a constant temperature incubator. It was then rinsed with phosphate buffer, and non-specific binding sites were blocked using a protein-free blocking solution. After washing again and drying, a biosensor for specific tetracycline detection was obtained. The base sequence of the tetracycline DNA aptamer is: 5′-HS-TTTTTCGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTT GGGTTGGTCCGACTGCGCGTGGATCCGAGCTCCACGTG-3′ (SEQ ID NO:4).

[0101] like Figure 11 The results shown are for the detection of tetracycline by the biosensor provided in this embodiment. It can be seen that the detection range of the biosensor for kanamycin is 10 pg / mL to 1 μg / mL, and the detection limit is 3.20 pg / mL.

[0102] Example 3

[0103] Steps 1 to 5 are the same as in Example 1.

[0104] Step 6: 20 μL of quinolone probe solution was uniformly and quantitatively sprayed onto the surface of the TiO2 / BiVO4 / MoS2-NH2-Au photoanode film prepared in Step 5. The probe-sprayed photoanode film was then incubated at 37°C for 20 min in a constant temperature incubator. Subsequently, it was rinsed with phosphate buffer. The rinsed photoanode film was then blocked at non-specific binding sites with a protein-free blocking solution, followed by washing again and drying to obtain a biosensor for the specific detection of quinolones. The quinolone DNA aptamer sequence is: 5′-HS-TTTTT ATA CCA GCT TAT TCA ATT-N10-TGA GGC TCG ATC-N40-ACAATC GTA ATC AGT TAG-3′ (SEQ ID NO:2), where N10 is the ATT base sequence repeated ten times, and N40 is the ATC base sequence repeated 40 times.

[0105] like Figure 12 The results of the biosensor provided in this embodiment for quinolone detection are shown. It can be seen that the detection range of the biosensor for quinolone is 100 pg / mL to 1 μg / mL, and the detection limit is 33.0 pg / mL.

[0106] By changing the type of biological probe, the TiO2 / BiVO4 / MoS2 ternary composite heterogeneous PEC biosensor modified with aminated gold nano-ink provided in this disclosure can, but is not limited to, exhibit extremely high detection sensitivity for tetracycline, kanamycin, and quinolones, and has excellent application breadth. It is a universal ultra-sensitive semiconductor optoelectronic biosensor.

[0107] It should be noted that although the steps of the preparation method of the ternary heterojunction biosensor modified with aminated gold nano-ink in this disclosure are described in a specific order in the above embodiments, this does not require or imply that these steps must be performed in that specific order, or that all the steps shown must be performed to achieve the desired result. Additional or alternative steps may be omitted, multiple steps may be combined into one step, and / or one step may be broken down into multiple steps, etc.

[0108] Other embodiments of this disclosure will readily occur to those skilled in the art upon consideration of the specification and practice of the invention disclosed herein. This application is intended to cover any variations, uses, or adaptations of this disclosure that follow the general principles of this disclosure and include common knowledge or customary techniques in the art not disclosed herein. The specification and examples are to be considered exemplary only, and the true scope and spirit of this disclosure are indicated by the appended claims.

Claims

1. An aminated gold nano-ink modified ternary heterojunction biosensor, characterized in that, include: Conductive substrate; A TiO2 / BiVO4 / MoS2 composite thin film layer, an aminated gold nano-ink layer, and an aptamer probe layer are sequentially disposed on one side of a conductive substrate.

2. The amino-functionalized gold nanoink-modified ternary heterojunction biosensor according to claim 1, wherein, The thickness of the TiO2 / BiVO4 / MoS2 composite film layer is 200nm to 1000nm; the mass ratio of TiO2 / BiVO4 / MoS2 in the TiO2 / BiVO4 / MoS2 composite film layer is (3 to 8): (0.5 to 2): (0.1 to 0.5).

3. The amino-functionalized gold nanoink-modified ternary heterojunction biosensor of claim 1, wherein, The size of the aminated gold nanoparticles in the aminated gold nano-ink layer is 2nm to 10nm.

4. The ternary heterojunction biosensor modified with aminated gold nano-ink according to any one of claims 1-3, characterized in that, The aptamer probe layer includes the DNA aptamer base sequence: 5′-HS-TTTTTATACCAGCTTATTCAATTTGAGGCTCGATCAC AATCGTAATCAGTTAG-3′, used for the detection of quinolone antibiotics.

5. The ternary heterojunction biosensor modified with aminated gold nano-ink according to any one of claims 1-3, characterized in that, The aptamer probe layer includes the DNA aptamer base sequence: 5′-HS-TTTTTGGGGGTTGAGGCTAAGCCGATTT-3′, used for the detection of kanamycin.

6. The ternary heterojunction biosensor modified with aminated gold nano-ink according to any one of claims 1-3, characterized in that, The aptamer probe layer includes a DNA aptamer base sequence: 5′-HS-TTTTTCGTACGGAATTCGCTAGCCCCCCGGCAGGC CACGGCTTGGGTTGGTCCGACTGCGCGTGGATCCGAGCTCCACGTG-3′, used for the detection of tetracycline.

7. A method for preparing a ternary heterojunction biosensor modified with aminated gold nano-ink, characterized in that, Includes the following steps: S1. Obtain BiVO4 powder, TiO2 / BiVO4 / MoS2 complex, aminated gold nano-ink, and aptamer probe solution. S2. Print the TiO2 / BiVO4 / MoS2 composite on a predetermined position on a conductive substrate to form a TiO2 / BiVO4 / MoS2 composite thin film layer; S3. Print aminated gold nano-ink onto a TiO2 / BiVO4 / MoS2 composite film layer to obtain a photoanode film; the photoanode film includes a stacked TiO2 / BiVO4 / MoS2 composite film layer and an aminated gold nano-ink layer; S4. Spray the aptamer probe solution onto the photoanode film in a preset amount, and use a protein-free blocking solution to block the non-specific binding sites to form an aptamer probe layer.

8. The method for preparing the ternary heterojunction biosensor modified with aminated gold nano-ink according to claim 7, characterized in that, In step S1, obtaining BiVO4 powder includes: Bi(NO3)3·5H2O powder was dissolved in a deionized aqueous solution and ultrasonically mixed for 30-60 min to obtain a Bi(NO3)3·5H2O aqueous solution. Prepare a KI aqueous solution; KI aqueous solution was added in batches to Bi(NO3)3·5H2O aqueous solution while stirring to obtain a suspension with BiOI precipitate; wherein, during the mixing of KI aqueous solution and Bi(NO3)3·5H2O aqueous solution, Bi was kept at a constant temperature. 3+ and I - The molar ratio is ≥1; The suspension containing BiOI precipitate was heated to 160–180°C and kept at that temperature for 8–12 h. The heated product was washed repeatedly with ethanol and distilled water, filtered, and dried to obtain BiOI powder. Vanadium acetylacetonate was dissolved in dimethyl sulfoxide solution to obtain a vanadium acetylacetonate solution; The acetylacetone vanadium oxide solution was mixed and ground with BiOI powder, dried at 100-120℃ for 1-2 hours, and then kept at 450-500℃ for 1-2 hours to obtain the BiVO4 precursor. BiVO4 precursor was washed with NaOH solution and dried to obtain BiVO4 powder.

9. The method for preparing the ternary heterojunction biosensor modified with aminated gold nano-ink according to claim 7, characterized in that, In step S1, obtaining the TiO2 / BiVO4 / MoS2 complex includes: TiO2 powder, BiVO4 powder and MoS2 powder are mixed and ground to obtain composite powder; wherein the mass ratio of TiO2 powder, BiVO4 powder and MoS2 powder is in the range of (3~8):(0.5~2):(0.1~0.5); Butyl carbitol, butyl carbitol acetate, Span, glass powder and ethyl cellulose are mixed evenly and heated to 50-70°C to form a colloid. The composite powder is mixed with the colloid to obtain a TiO2 / BiVO4 / MoS2 composite for preparing TiO2 / BiVO4 / MoS2 composite thin films.

10. The method for preparing the amino-functionalized gold nano-ink modified ternary heterojunction biosensor according to claim 7, characterized in that, In step S1, obtaining aminated gold nano-ink includes: A mixture of L-cysteine ​​aqueous solution and chloroauric acid aqueous solution was heated and stirred until homogeneous to obtain a chloroauric acid / L-cysteine ​​mixed solution. Sodium borohydride solution was added to a chloroauric acid / L-cysteine ​​mixed solution, stirred, and centrifuged at 10,000–12,000 rpm. The precipitate was collected and dispersed in an ethylene glycol solution to obtain aminated gold nano-ink.

Images