Methylsulfonylurea compounds and uses thereof

Abstract

The application discloses a methylsulfonyl urea compound. Specifically disclosed are a compound shown in formula (I) and pharmaceutically acceptable salts of the compound.

Description

[0001] This application claims the following priority:

[0002] CN2021104946968, application date: May 7, 2021. Technical Field

[0003] This invention relates to a methanesulfonylurea compound. Specifically, it relates to the compound of formula (I) and its pharmaceutically acceptable salt. Background Technology

[0004] Hepatitis B virus belongs to the Hepatoviridae family. It can cause acute and / or progressively chronic disease. Hepatitis B virus can also cause many other pathological and clinical manifestations, especially chronic inflammation of the liver, cirrhosis, and hepatocellular carcinoma. Furthermore, co-infection with hepatitis D can have adverse effects on the progression of the disease.

[0005] Hepatitis B is a global medical challenge. Currently, there is no specific drug for treating hepatitis B worldwide. The first-line drugs for hepatitis B are mainly nucleoside analogs and interferon drugs, but these drugs cannot completely cure the disease and require long-term medication. They also have many problems such as renal insufficiency and lactic acidosis. Therefore, it is imperative to develop a new type of anti-hepatitis B drug that provides patients with more effective and safer treatment. Summary of the Invention

[0006] This invention provides compounds of formula (I) or pharmaceutically acceptable salts thereof.

[0007]

[0008] in,

[0009] R1 is independently selected from halogen, OH, CN, NH2, C, etc. 1-3 Alkyl and C 1-3 Alkoxy, the C 1-3 Alkyl and C 1-3 The alkoxy groups can be independently and optionally substituted by one, two, or three halogens;

[0010] m is selected from 0, 1, 2, 3, and 4;

[0011] T1 and T2 are each independently selected from CH and N;

[0012] It can be a single bond or a double bond;

[0013] R2 is selected from H, methyl, and F;

[0014] Ring A is selected from phenyl and C 4-10 cycloalkyl, the phenyl and C 4-10 Each cycloalkyl group is independently and optionally surrounded by 1, 2, or 3 R groups.a replace;

[0015] R a Each element is independently selected from halogens, OH, CN, NH2, and C. 1-3 Alkyl and C 1-3 Alkoxy, the C 1-3 Alkyl and C 1-3 The alkoxy groups can be independently and optionally substituted by one, two, or three halogens;

[0016] L1 is selected from single bonds, -C≡C-, and -CR2=;

[0017] L2 is selected from single bonds and methylene groups.

[0018] In some embodiments of the present invention, R1 is independently selected from F, Cl, Br, CN, -CH3 and -OCH3, and -CH3 and -OCH3 are independently and optionally replaced by one, two or three Fs, and other variables are as defined in the present invention.

[0019] In some embodiments of the present invention, R1 is independently selected from F, Cl, Br and CN, and other variables are as defined in the present invention.

[0020] In some embodiments of the present invention, L1 is selected from -C≡C-, -CH=, -C(F)= and -C(CH3)=, and other variables are as defined in the present invention.

[0021] In some embodiments of the present invention, the above-mentioned R a The components are independently selected from F, Cl, Br, CH3 and OCH3, respectively, wherein CH3 and OCH3 are independently and optionally replaced by 1, 2 or 3 F, and other variables are as defined in this invention.

[0022] In some embodiments of the present invention, the above-described structural unit Selected from Other variables are as defined in this invention.

[0023] In some embodiments of the present invention, the above-described structural unit Selected from

[0024] Other variables are as defined in this invention.

[0025] In some embodiments of the present invention, the aforementioned ring A is selected from phenyl, cyclobutyl, cyclohexyl, ... The phenyl, cyclobutyl, cyclohexyl, Each can be independently selected by 1, 2 or 3 Rs. a Replacement, other variables as defined in this invention.

[0026] In some embodiments of the present invention, the ring A is selected from... Other variables are as defined in this invention.

[0027] In some embodiments of the present invention, the above-described structural unit Selected from Other variables are as defined in this invention.

[0028] In some embodiments of the present invention, the above-described structural unit Selected from Other variables are as defined in this invention.

[0029] In some embodiments of the present invention, the above-mentioned compound or a pharmaceutically acceptable salt thereof is selected from:

[0030]

[0031] Wherein, R1, R2, L2 and m are as defined in any one of the present invention.

[0032] In some embodiments of the present invention, the above-mentioned compound or a pharmaceutically acceptable salt thereof is selected from:

[0033]

[0034] Wherein, R1, R2, L2 and m are as defined in any one of the present invention.

[0035] In some embodiments of the present invention, the above-mentioned compound or a pharmaceutically acceptable salt thereof is selected from:

[0036]

[0037] Wherein, R1, R2, L2 and m are as defined in any one of the present invention.

[0038] Some solutions in this invention are derived from arbitrary combinations of the above-mentioned variables.

[0039] This invention also provides the following compounds or pharmaceutically acceptable salts thereof, selected from:

[0040]

[0041]

[0042] This invention also provides the following compounds or pharmaceutically acceptable salts thereof, selected from:

[0043]

[0044]

[0045] This invention also provides the following compounds or pharmaceutically acceptable salts thereof, selected from:

[0046]

[0047]

[0048] This invention also provides the following compounds or pharmaceutically acceptable salts thereof, selected from:

[0049]

[0050]

[0051] The present invention also provides the use of the above-described compounds or pharmaceutically acceptable salts thereof in the preparation of medicaments for treating diseases related to hepatitis B virus infection.

[0052] In some embodiments of the present invention, the hepatitis B virus infection-related disease is chronic hepatitis B.

[0053] Definitions and Explanations

[0054] Unless otherwise stated, the following terms and phrases as used herein are intended to have the following meanings. A particular term or phrase should not be considered uncertain or unclear unless specifically defined, but should be understood in its ordinary sense. When a trade name appears herein, it is intended to refer to the corresponding product or its active ingredient.

[0055] The term “pharmaceutically acceptable” as used herein refers to compounds, materials, compositions, and / or dosage forms that, within the bounds of reliable medical judgment, are suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, in proportion to a reasonable benefit / risk ratio.

[0056] The term "pharmaceutically acceptable salt" refers to the salt of the compounds of this application, prepared by reacting a compound having specific substituents discovered in this application with a relatively non-toxic acid or base. When the compounds of this application contain relatively acidic functional groups, a base addition salt can be obtained by contacting such compounds with a sufficient amount of base in a pure solution or a suitable inert solvent. When the compounds of this invention contain relatively basic functional groups, an acid addition salt can be obtained by contacting such compounds with a sufficient amount of acid in a pure solution or a suitable inert solvent. Certain specific compounds of this invention contain both basic and acidic functional groups, and thus can be converted into either a base or an acid addition salt.

[0057] The pharmaceutically acceptable salts of the present invention can be synthesized from parent compounds containing acid radicals or bases by conventional chemical methods. Generally, such salts are prepared by reacting these compounds, in their free acid or base form, with a stoichiometric amount of a suitable base or acid in water or an organic solvent or a mixture thereof.

[0058] Unless otherwise stated, the term "isomer" is intended to include geometric isomers, cis-trans isomers, stereo isomers, enantiomers, optical isomers, diastereomers and tautomers.

[0059] The compounds of this invention can exist in specific geometric or stereoisomeric forms. This invention contemplates all such compounds, including cis and trans isomers, (-)- and (+)- enantiomers, (R)- and (S)- enantiomers, diastereomers, (D)- isomers, (L)- isomers, and racemic mixtures thereof, as well as other mixtures, such as mixtures enriched with enantiomers or diastereomers, all of which are within the scope of this invention. Additional asymmetric carbon atoms may be present in substituents such as alkyl groups. All such isomers and mixtures thereof are included within the scope of this invention.

[0060] Unless otherwise stated, the terms "enantiomer" or "optical isomer" refer to stereoisomers that are mirror images of each other.

[0061] Unless otherwise stated, the terms "cis-trans isomers" or "geometric isomers" arise because the single bonds of double bonds or cyclic carbon atoms cannot rotate freely.

[0062] Unless otherwise stated, the term "diastereomer" refers to a stereoisomer of a molecule having two or more chiral centers and being in a non-mirror relationship with each other.

[0063] Unless otherwise stated, "(+)" indicates right-handed rotation, "(-)" indicates left-handed rotation, and "(±)" indicates racemic rotation.

[0064] Unless otherwise specified, use wedge-shaped solid line keys. and wedge-shaped dashed key The absolute configuration of the center of a solid is represented by a straight solid line key. and straight dashed key Relative configurations representing the center of a solid, for example This indicates that Rx and Ry are in the same direction, and it contains... Two configurations.

[0065] Unless otherwise specified, when a group has one or more connectable sites, any one or more sites of that group can be connected to other groups by chemical bonds. When the chemical bond connection is non-directional and the connectable site contains H atoms, the number of H atoms at that site will decrease accordingly with the number of chemical bonds connected, resulting in a group with a corresponding valence. The chemical bonds connecting the site to other groups can be straight solid line bonds. Straight dashed key or wavy line For example, a straight solid line bond in -OCH3 indicates that the oxygen atom in that group is connected to other groups; A straight dashed bond in the diagram indicates a connection between the nitrogen atom in the group and other groups; a straight dashed double bond... This indicates that the groups are connected by double bonds, for example The straight dashed double bond in the figure represents the cyclohexyl group connected to other groups by a double bond.

[0066] The compounds of this invention can exist in specific forms. Unless otherwise stated, the terms "tautomer" or "tautomer form" refer to isomers of different functional groups in dynamic equilibrium at room temperature, capable of rapidly interconverting into each other. If tautomerization is possible (e.g., in solution), chemical equilibrium of the tautomer can be achieved. For example, proton tautomers (also called prototropic tautomers) include interconversions via proton migration, such as keto-enol isomerization and imine-enamine isomerization. Valence tautomers include interconversions involving the rearrangement of some bonding electrons. A specific example of keto-enol tautomerization is the interconversion between the two tautomers, pentane-2,4-dione and 4-hydroxypent-3-en-2-one.

[0067] Unless otherwise stated, the terms "rich in one isomer," "isomer enrichment," "rich in one enantiomer," or "enantiomer enrichment" mean that the content of one isomer or enantiomer is less than 100%, and the content of the isomer or enantiomer is greater than or equal to 60%, or greater than or equal to 70%, or greater than or equal to 80%, or greater than or equal to 90%, or greater than or equal to 95%, or greater than or equal to 96%, or greater than or equal to 97%, or greater than or equal to 98%, or greater than or equal to 99%, or greater than or equal to 99.5%, or greater than or equal to 99.6%, or greater than or equal to 99.7%, or greater than or equal to 99.8%, or greater than or equal to 99.9%.

[0068] Unless otherwise stated, the terms "isomer excess" or "enantiomer excess" refer to the difference between the relative percentages of two isomers or two enantiomers. For example, if one isomer or enantiomer is 90% and the other isomer or enantiomer is 10%, then the isomer or enantiomer excess (ee value) is 80%.

[0069] Optically active (R)- and (S)- isomers, as well as D- and L- isomers, can be prepared by chiral synthesis, chiral reagents, or other conventional techniques. To obtain an enantiomer of a compound of the present invention, it can be prepared by asymmetric synthesis or derivatization with a chiral auxiliary, wherein the resulting diastereomeric mixture is separated, and the auxiliary group is cleaved to provide the desired enantiomer in pure form. Alternatively, when the molecule contains a basic functional group (such as an amino group) or an acidic functional group (such as a carboxyl group), a salt of the diastereomeric isomer is formed with a suitable optically active acid or base, followed by diastereomeric resolution using conventional methods known in the art, and then the pure enantiomer is recovered. Furthermore, the separation of enantiomers and diastereomeric isomers is typically accomplished by using chromatography employing a chiral stationary phase, optionally combined with chemical derivatization (e.g., from amines to carbamates).

[0070] The compounds of this invention may contain atomic isotopes in non-natural proportions on one or more atoms constituting the compound. For example, the compounds may be labeled with radioactive isotopes, such as tritium. 3 H), Iodine-125 125 I) or C-14 14 C). For example, deuterium can be used to replace hydrogen to form deuterated drugs. The bond between deuterium and carbon is stronger than that between ordinary hydrogen and carbon. Compared with undeuterated drugs, deuterated drugs have advantages such as reduced toxicity, increased drug stability, enhanced efficacy, and prolonged drug biological half-life. All isotopic variations of the compounds of this invention, regardless of radioactivity, are included within the scope of this invention.

[0071] Unless otherwise specified, the term "C" 1-3 "alkyl" is used to denote a straight-chain or branched saturated hydrocarbon group consisting of 1 to 3 carbon atoms. The C 1-3 Alkyl groups include C 1-2 and C 2-3 Alkyl groups, etc.; they can be monovalent (e.g., methyl), divalent (e.g., methylene), or polyvalent (e.g., methine). C 1-3 Examples of alkyl groups include, but are not limited to, methyl (Me), ethyl (Et), propyl (including n-propyl and isopropyl), etc.

[0072] Unless otherwise specified, the term "C" 1-3"Alkoxy" refers to alkyl groups containing 1 to 3 carbon atoms that are attached to the rest of the molecule by an oxygen atom. The C 1-3 Alkoxy groups include C 1-2 C 2-3 C3 and C2 alkoxy groups, etc. 1-3 Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy (including n-propoxy and isopropoxy), etc.

[0073] Unless otherwise specified, "C 4-10 "Cycloalkyl" refers to a saturated cyclic hydrocarbon group consisting of 4 to 10 carbon atoms, including monocyclic, bicyclic, and tricyclic systems, wherein bicyclic and tricyclic systems include spirocyclic, fused, and bridged rings. The C 4-10 Cycloalkyl groups include C 4-5 C 5-6 C 6-7 C 6-8 C 6-9 C6, C7, C8, C9 or C 10 etc.; it can be monovalent, divalent, or polyvalent. C 4-10 Examples of cycloalkyl groups include, but are not limited to, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, norbornel, [2.2.2]bicyclooctane, [4.4.0]bicyclodecane, etc.

[0074] Unless otherwise specified, the term “halogen” or “halogen” itself or as part of another substituent means a fluorine, chlorine, bromine or iodine atom.

[0075] The terms “optional” or “optionally” refer to events or conditions that may occur but are not required to occur as described below, and the description includes both cases where said events or conditions occur and cases where said events or conditions do not occur.

[0076] The term "substituted" means that any one or more hydrogen atoms on a particular atom are replaced by a substituent, which can include deuterium and hydrogen variants, provided that the valence state of the particular atom is normal and the substituted compound is stable. When the substituent is oxygen (i.e., =O), it means that two hydrogen atoms are replaced. Oxygen substitution does not occur on aromatic groups. The term "optionally substituted" means that it may or may not be substituted, unless otherwise specified, and the type and number of substituents can be arbitrary on a chemically feasible basis.

[0077] When any variable (e.g., R) appears more than once in the composition or structure of a compound, its definition is independent in each case. Thus, for example, if a group is substituted by 0-2 Rs, the group can optionally be substituted by at most two Rs, and the Rs in each case have independent options. Furthermore, combinations of substituents and / or their variants are only permitted if such combinations produce a stable compound.

[0078] When the number of a linking group is 0, such as -(CRR)0-, it indicates that the linking group is a single bond.

[0079] When one of the variables is selected as a single bond, it means that the two groups it connects to are directly connected. For example, when L in ALZ represents a single bond, it means that the structure is actually AZ.

[0080] When a substituent is vacant, it means that the substituent is not present. For example, in AX, if X is vacant, the structure is actually A. When the listed linking groups do not specify their linkage direction, the linkage direction is arbitrary. For example, The linker group L is -MW-. In this case, -MW- can connect ring A and ring B in the same direction as the reading order from left to right to form a ring. Alternatively, rings A and B can be connected in the opposite direction to the left-to-right reading order to form a ring. The combination of linking groups, substituents, and / or their variants is permitted only if such a combination produces a stable compound.

[0081] The compounds of the present invention can be prepared by a variety of synthetic methods known to those skilled in the art, including the specific embodiments listed below, embodiments formed by combining them with other chemical synthetic methods, and equivalent substitutions known to those skilled in the art. Preferred embodiments include, but are not limited to, the embodiments of the present invention.

[0082] The structures of the compounds of this invention can be confirmed by conventional methods well known to those skilled in the art. If this invention relates to the absolute configuration of a compound, that absolute configuration can be confirmed by conventional techniques in the art. For example, single-crystal X-ray diffraction (SXRD) is used, where the cultured single crystal is used to collect diffraction intensity data using a Bruker D8 venture diffractometer with CuKα radiation as the light source. The scanning method is as follows: After scanning and collecting relevant data, the crystal structure can be further analyzed using the direct method (Shelxs97) to confirm the absolute configuration.

[0083] The solvents used in this invention are commercially available. The following abbreviations are used in this invention: eq represents equivalent amount; M represents mol / L; DMF represents N,N-dimethylformamide; DMSO represents dimethyl sulfoxide; EtOH represents ethanol; MeOH represents methanol; CBz represents benzyloxycarbonyl, a protecting group of an amine; Boc represents tert-butyloxycarbonyl, an amine protecting group; IPA represents isopropanol; and dppf represents 1,1'-bis(diphenylphosphine)ferrocene.

[0084] Compounds are named according to conventional naming principles in the field or using Software naming conventions are used; commercially available compounds use supplier catalog names.

[0085] Technical effect

[0086] As a novel type of anti-hepatitis B drug, the compound of this invention has a significant inhibitory effect on HBV, no obvious cytotoxicity in various hepatocytes, high oral bioavailability in mice, a high hepatic-to-blood ratio, and significant antiviral effect in the HDI pharmacodynamic model. Detailed Implementation

[0087] The present invention will be described in detail below with reference to embodiments, but this does not imply any adverse limitation on the invention. The present invention has been described in detail, and specific embodiments thereof have been disclosed. It will be apparent to those skilled in the art that various changes and modifications can be made to the specific embodiments of the present invention without departing from the spirit and scope thereof.

[0088] Example 1

[0089]

[0090] Synthesis route:

[0091]

[0092]

[0093] Step 1: Synthesis of compound 1-b

[0094] Under nitrogen protection, compound 1-a (300 g, 2.36 mol, 243.90 mL, 1 eq), ethylene glycol (292.85 g, 4.72 mol, 263.83 mL, 2 eq), and toluene (1.5 L) were added to a round-bottom flask, followed by p-toluenesulfonic acid (40.63 g, 235.92 mmol, 0.1 eq). The mixture was refluxed at 120 °C for 12 hours, with water separated using a separator. The reaction solution was washed with water (300 mL × 2). The aqueous phase was extracted with ethyl acetate (100 mL). The combined organic phases were washed with saturated brine (300 mL × 2), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The concentrate was separated by silica gel column chromatography (petroleum ether: ethyl acetate = 100:0–50:50) to give compound 1-b.

[0095] 1 H NMR (400MHz, CDCl3) δppm 7.72 (d, J = 3.1Hz, 1H), 7.30-7.08 (m, 1H), 4.11-4.02 (m, 2H), 3.99-3.92 (m, 2H), 1.77 (s, 3H).

[0096] Step 2: Synthesis of compound 1-c

[0097] Compound 1-b (20 g, 116.81 mmol, 1 eq) was dissolved in tetrahydrofuran (360 mL), cooled to -78 °C, and butyllithium (2.5 M, 51.40 mL, 1.1 eq) was slowly added dropwise. The reaction mixture was stirred at -78 °C for 1 hour, then carbon tetrabromide (42.61 g, 128.49 mmol, 1.1 eq) in tetrahydrofuran (40 mL) was slowly added dropwise. The reaction mixture was stirred at -78 °C for 0.5 hours, then heated to 0 °C and stirred for another 0.5 hours. A saturated ammonium chloride solution (300 mL) was added dropwise to the reaction mixture, and the mixture was extracted with ethyl acetate (300 mL × 3). The combined organic phases were washed with saturated brine (300 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 10 / 1) to give compound 1-c.

[0098] MS m / z(ESI): 249.8 [M+1] + .

[0099] 1 H NMR (400MHz, CDCl3) δppm 7.65 (s, 1H), 4.12-4.07 (m, 2H), 4.03-3.98 (m, 2H), 1.79 (s, 3H).

[0100] Step 3: Synthesis of compound 1-d

[0101] Compound 1-c (49.1 g, 196.31 mmol, 1 eq) and acetone (280 mL) were added to a three-necked flask. Hydrochloric acid aqueous solution (6 M, 196.31 mL, 6 eq) was added at 0 °C, and the mixture was stirred at 25 °C for 2 hours. Water (200 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate (200 mL × 3). The combined organic phases were washed with saturated brine (200 mL × 3), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain compound 1-d.

[0102] 1 H NMR (400MHz, CDCl3) δppm 7.87 (s, 1H), 2.65 (d, J = 0.8Hz, 3H).

[0103] Step 4: Synthesis of compound 1-e

[0104] Compound 1-d (22 g, 106.76 mmol, 1 eq) and methanol (300 mL) were added to a three-necked flask. Then, a methanol solution of sodium methoxide (5 M, 42.71 mL, 2 eq) and dimethyl oxalate (18.91 g, 160.15 mmol, 1.5 eq) were slowly added at 0 °C. The mixture was stirred at 70 °C for 1 hour. The reaction mixture was cooled to 0 °C, water (300 mL) was added, and the pH was adjusted to 2–3 with 2 mol / L dilute hydrochloric acid. After stirring at 0 °C for 30 minutes, the mixture was filtered. The filter cake was washed with methanol (30 mL × 3) and dried under reduced pressure to obtain compound 1-e. MS m / z (ESI): 291.9 [M+1] + .

[0105] 1 H NMR (400MHz, DMSO-d6) δppm 7.92 (s, 1H), 6.55 (s, 1H), 3.69 (s, 3H).

[0106] Step 5: Synthesis of compound 1-f

[0107] Compound 1-e (65 g, 222.52 mmol, 1 eq), sulfonamide (32.08 g, 333.78 mmol, 19.93 mL, 1.5 eq), and hydrochloric acid / methanol solution (4 M, 500 mL, 8.99 eq) were added to a round-bottom flask. The mixture was stirred at 70 °C for 2 hours. The reaction mixture was cooled to 0 °C, stirred for 1 hour, and then filtered. Water (300 mL) was added to the filter cake, and the mixture was stirred for 30 minutes and then filtered. Tert-butyl methyl ether (200 mL) was added to the filter cake, and the mixture was stirred for 30 minutes and then filtered. The filter cake was dried under reduced pressure to give compound 1-f. MSm / z (ESI): 351.9 [M+1] + .

[0108] 1 H NMR (400MHz, DMSO-d6) δppm 8.05 (s, 1H), 6.84 (s, 1H), 3.81 (s, 3H).

[0109] Step 6: Synthesis of compound 1-g

[0110] Under nitrogen protection, compound 1-f (20 g, 56.79 mmol, 1 eq) and DMF (200 mL) were added to a three-necked flask and stirred until dissolved. Then, sodium hydride (2.95 g, 73.82 mmol, 60% purity, 1.3 eq) was added in portions at 0 °C. The reaction mixture was stirred at 0 °C for 30 minutes, followed by the addition of iodomethane (24.18 g, 170.37 mmol, 10.61 mL, 3 eq). The mixture was stirred at 50 °C for 12 hours. The reaction solution was slowly poured into ice water (200 mL), and the pH was adjusted to 2–3 with 1 M dilute hydrochloric acid. After stirring for 15 minutes, the mixture was filtered. The filter cake was washed with water (50 mL) and methanol (20 mL × 2), and then dried under reduced pressure to obtain compound 1-g.

[0111] MS m / z (ESI): 365.7 [M+1] + .

[0112] 1 H NMR (400MHz, DMSO-d6) δppm 8.35(s,1H),7.37(s,1H),3.95(s,3H),3.60(s,3H).

[0113] Step 7: Synthesis of compound 1-h

[0114] Compound 1-g (50 g, 136.53 mmol, 1 eq) and triethylamine (69.08 g, 682.67 mmol, 95.02 mL, 5 eq) were added to acetonitrile (250 mL) and water (250 mL), and the mixture was stirred at 50 °C for 1 hour. Water (200 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate (200 mL × 2). The combined organic phases were washed successively with water (100 mL) and saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to give compound 1-h.

[0115] MS m / z(ESI): 351.8 [M+1] + .

[0116] Step 8: Synthesis of compound 1-j

[0117] Compound 1-i (15 g, 77.51 mmol, 1 eq) was dissolved in methanol (450 mL) and acetic acid (18 mL), and then reduced iron powder (15.00 g, 268.60 mmol, 3.47 eq) was added in portions. The reaction solution was heated to 65 °C and stirred for 2 hours. The reaction solution was cooled to 25 °C and filtered. The filtrate was concentrated under reduced pressure to obtain the crude product. Ethyl acetate (300 mL) was added to the crude product, and then the mixture was washed successively with 1 N sodium hydroxide aqueous solution (300 mL × 2) and saturated brine (300 mL × 2). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain compound 1-j.

[0118] 1 H NMR (400MHz, CDCl3) δ = 6.47-6.41 (m, 1H), 6.41-6.33 (m, 1H), 3.71 (br s, 2H).

[0119] Step 9: Synthesis of compound 1-k

[0120] Compound 1-h (15 g, 42.59 mmol, 1 eq), compound 1-j (6.97 g, 42.59 mmol, 1 eq), N,N-diisopropylethylamine (16.51 g, 127.77 mmol, 22.26 mL, 3 eq), and a 50% ethyl acetate solution of tri-n-propyl cyclic phosphoric anhydride (40.66 g, 63.89 mmol, 38.00 mL, 1.5 eq) were dissolved in dichloromethane (450 mL) at 0 °C. The reaction mixture was purged with nitrogen three times, and then heated to 25 °C and stirred for 12 hours. Water (500 mL) was added to the reaction mixture, and the mixture was extracted with dichloromethane (500 mL × 2). The organic phases were combined, washed with saturated brine (500 mL × 2), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 10 / 3) to give compound 1-k.

[0121] MS m / z(ESI): 498.7 [M+1] + .

[0122] Step 10: Synthesis of compound 1-l

[0123] Compound 1-k (6.87 g, 13.80 mmol, 1 eq) was dissolved in ethanol (100 mL). The reaction solution was cooled to 0 °C, and sodium borohydride (1.04 g, 27.61 mmol, 2 eq) was slowly added in portions. The reaction mixture was then stirred for 2 hours. The pH was adjusted to 1–2 by slowly adding 1 M hydrochloric acid solution, followed by the addition of water (100 mL). The mixture was stirred for 5 minutes and then filtered. Methanol (20 mL) was added to the filter cake, and the mixture was stirred for 30 minutes. The filter cake was then filtered and vacuum dried to obtain compound 1-l.

[0124] MS m / z(ESI): 502.8 [M+1] + .

[0125] Step 11: Synthesis of compound 1-o

[0126] 2,2,6,6-Tetramethylpiperidine (498.33 mg, 3.53 mmol, 598.95 μL, 1.2 eq) was dissolved in tetrahydrofuran (6 mL). The system was cooled to -30 °C, and n-butyllithium (2.5 M, 1.4 mL, 1.19 eq) was added dropwise. The reaction was stirred at -30 °C for 0.5 h. Then the reaction was cooled to -78 °C, and a tetrahydrofuran solution of compound 1-n (787.81 mg, 2.94 mmol, 1 eq) (6 mL) was added dropwise. The mixture was stirred at -78 °C for 30 min, and then a tetrahydrofuran solution of compound 1-m (0.5 g, 2.94 mmol, 467.29 μL, 1 eq) (6 mL) was added dropwise. The reaction was slowly heated to 25 °C and stirred at 25 °C for 12 h. The reaction system was cooled to 0°C, and saturated ammonium chloride solution (5 mL) was added dropwise. The reaction mixture was stirred at 0°C for 1 hour. After filtration, the filtrate was concentrated under reduced pressure, and extracted with water (20 mL) and ethyl acetate (20 mL). The organic phase was washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain the crude product. The crude product was purified by rapid column chromatography (eluent: ethyl acetate / petroleum ether, gradient: 0-20%) to obtain compound 1-o.

[0127] 1 H NMR (400MHz, CDCl3) δ = 5.08 (s, 1H), 4.13 (q, J = 7.1Hz, 2H), 3.18-3.09 (m, 1H), 2.49 (tt, J = 3.7, 10.9Hz, 1H), 2.40-2.33(m,1H),2.20(dt,J=3.9,12.6Hz,1H),2.12-1.99(m,3H),1.72-1.58(m,2H),1.30-1.23(m,15H).

[0128] Step 12: Synthesis of compound 1-p

[0129] Under nitrogen protection, compounds 1-l (100 mg, 199.30 μmol, 1 eq), 1-o (87.95 mg, 298.95 μmol, 1.5 eq), sodium carbonate (63.37 mg, 597.90 μmol, 3 eq), dioxane (3 mL), and water (0.5 mL) were added to a thumb flask, followed by tetra(triphenylphosphine)palladium (23.03 mg, 19.93 μmol, 0.1 eq). The reaction mixture was stirred at 90 °C for 3 hours. The reaction mixture was extracted with water (10 mL) and ethyl acetate (10 mL), and the organic phase was concentrated under reduced pressure to obtain the crude product. The crude product was purified by column chromatography (eluent: ethyl acetate / petroleum ether: 0-50%) to obtain compound 1-p.

[0130] MS m / z(ESI): 589.0 [M+1] + .

[0131] 1 H NMR (400MHz, CD3OD) δ=7.71-7.61(m,2H),7.57(s,1H),6.37(s,1H),5.04-4.98(m,1H),4.48(dd,J=3.3,11.8Hz,1H),4.18-4.12 (m,2H),2.99-2.92(m,1H),2.75(s,3H),2.60-2.20(m,6H),2.07(td,J=3.6,12.5Hz,2H),1.67-1.56(m,2H),1.27-1.24(m,3H).

[0132] Step 13: Synthesis of Compound 1

[0133] Compound 1-p (50 mg, 84.88 μmol, 1 eq) was dissolved in methanol (1 mL), and a solution of sodium hydroxide (10.18 mg, 254.64 μmol, 3 eq) in water (1 mL) was added. The reaction was stirred at 25 °C for 1 hour. The pH of the reaction mixture was adjusted to 1–3 with 2 M dilute hydrochloric acid, and ethyl acetate (20 mL) was added for extraction. The organic phase was concentrated under reduced pressure to obtain the crude product. The crude product was purified by preparative high-performance liquid chromatography (pHPLC) (column: Phenomenex Gemini-NX C1875*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 40%–70%, 7 min) to obtain compound 1.

[0134] MS m / z(ESI): 561.2 [M+1] + .

[0135] 1H NMR (400MHz, CD3OD) δ = 7.72-7.61 (m, 2H), 7.59-7.56 (m, 1H), 7.58 (s, 1H), 6.38 (s, 1H), 5.02 (br dd,J=3.2,11.7Hz,1H),4.48(dd,J=3.1,11.8Hz,1H),2.97(br d,J=13.9Hz,1H),2.76(s,3H),2.64-2.55(m,1H),2.52-2.45(m,1H),2.4 3-2.29(m,3H),2.28-2.18(m,1H),2.14-2.06(m,2H),1.72-1.54(m,2H).

[0136] Step 14: Synthesis of compounds 2, 3, 4 and 5

[0137] Compound 1 (90 mg, 160.42 μmol, 1 eq) was separated by SFC (column type: DAICL CHIRALPAK AD (250 mm * 30 mm, 10 μm); mobile phase: [0.1% NH3H2O ​​IPA]: 50%-50%) to obtain a mixture of compounds 3 and 4, as well as compounds 2 and 5. The mixture of compounds 3 and 4 was separated by a second SFC (column type: DAICL CHIRALPAK IG (250 mm * 30 mm, 10 μm); mobile phase: [0.1% NH3H2O ​​IPA]: 60%-60%) to obtain compounds 3 and 4.

[0138] Compound 2: MS m / z (ESI): 560.9 [M+1] + SFC analysis method (column type: Chiralpak IG-3 50*4.6mm ID, 3μm; mobile phase: isopropanol (0.05% diethylamine); flow rate: 4mL / min), SFC retention time: 0.513 min, ee% = 100%.

[0139] 1H NMR (400MHz, CD3OD) δ=7.59-7.50(m,2H),7.46(s,1H),6.26(s,1H),4.90(brdd,J=3.3,11.7Hz,1H),4.35(dd,J=3.3,11.8Hz,1H),2.85(br d,J=14.0Hz,1H),2.64(s,3H),2.46(br t,J=10.6Hz,1H),2.36(br d,J=13.4Hz,1H),2.31-2.17(m,3H),2.14-2.05(m,1H),2.01-1.93(m,2H),1.60-1.47(m,2H).

[0140] Compound 3: MS m / z (ESI): 560.9 [M+1] + SFC retention time: 0.861 minutes, ee% = 100%.

[0141] 1 H NMR (400MHz, CD3OD) δ=7.59-7.50(m,2H),7.46(s,1H),6.26(s,1H),4.90(dd,J=3.3,11.7Hz,1H),4.36(dd,J=3.3,11.8Hz,1H),2.85(br d,J=13.9Hz,1H),2.64(s,3H),2.50-2.42(m,1H),2.40-2.32(m,1H),2.2 9-2.16(m,3H),2.14-2.05(m,1H),2.02-1.94(m,2H),1.59-1.46(m,2H).

[0142] Compound 4: MS m / z (ESI): 561.0 [M+1] + SFC retention time: 2.802 minutes, ee% = 100%.

[0143] 1 H NMR (400MHz, CD3OD) δ=7.59-7.51(m,2H),7.46(s,1H),6.25(s,1H),4.90(dd,J=3.3,11.8Hz,1H),4.36(dd,J=3.1,11.7Hz,1H),2.86(br d,J=14.1Hz,1H),2.64(s,3H),2.47-2.41(m,1H),2.40-2.33(m,1H),2.2 9-2.17(m,3H),2.13-2.03(m,1H),2.00-1.93(m,2H),1.61-1.43(m,2H).

[0144] Compound 5: MS m / z (ESI): 560.9 [M+1] + SFC retention time: 3.495 minutes, ee% = 100%.

[0145] 1 H NMR (400MHz, CD3OD) δ=7.71-7.62(m,2H),7.58(s,1H),6.38(s,1H),5.02(dd,J=3.4,11.8Hz,1H),4.47(dd,J=3.2,11.7Hz,1H),2.97(br d,J=13.8Hz,1H),2.76(s,3H),2.62-2.54(m,1H),2.48(br d,J=13.5Hz,1H),2.43-2.29(m,3H),2.25-2.15(m,1H),2.13-2.05(m,2H),1.71-1.58(m,2H).

[0146] Example 2

[0147]

[0148] Synthesis route:

[0149]

[0150] Step 1: Synthesis of compound 6-b

[0151] Compound 1-l (50 mg, 99.65 μmol, 1 eq) was dissolved in N,N-dimethylformamide (1.4 mL) and triethylamine (1.4 mL) under nitrogen protection. Compound 6-a (86.79 mg, 498.25 μmol, 5 eq), dichlorobis(triphenylphosphine)palladium (3.50 mg, 4.98 μmol, 0.05 eq), and cuprous iodide (3.80 mg, 19.93 μmol, 0.2 eq) were then added. The reaction mixture was heated to 80 °C and stirred for 12 hours. The mixture was extracted with water (10 mL) and ethyl acetate (10 mL × 3). The organic phase was washed successively with 1 M dilute hydrochloric acid (10 mL × 2) and saturated brine (10 mL × 2), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 2 / 1) to give compound 6-b.

[0152] MS m / z(ESI): 594.9 [M+1] + .

[0153] 1H NMR (400MHz, CD3OD) δ = 8.05 (d, J = 8.5Hz, 2H), 7.98 (s, 1H), 7.70-7.62 (m, 4H), 5.05 (dd, J = 3.1, 11.9Hz, 1H), 4.48 (dd, J = 3 .0,12.1Hz,1H),4.39(d,J=7.1Hz,2H),2.75(s,3H),2.45(td,J=3.2,14.3Hz,1H),2.36-2.27(m,1H),1.42-1.38(m,3H).

[0154] Step 2: Synthesis of Compound 6

[0155] Compound 6-b (40 mg, 67.22 μmol, 1 eq) was dissolved in methanol (1 mL) and water (1 mL), and sodium hydroxide (13.44 mg, 336.11 μmol, 5 eq) was added. The mixture was stirred at 25 °C for 2 hours. Water (10 mL) was added to the reaction solution, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. The solution was then extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by preparative high-performance liquid chromatography (pHPLC) (column: Phenomenex Gemini-NX C18 75 × 30 mm × 3 μm; mobile phase: [water (0.225% formic acid) - acetonitrile]; acetonitrile %: 45%-75%, 7 min) to obtain compound 6.

[0156] MS m / z(ESI): 567.1 [M+1] + .

[0157] 1 H NMR (400MHz, CD3OD) δ = 8.04 (d, J = 8.5Hz, 2H), 7.97 (s, 1H), 7.70-7.60 (m, 4H), 5.04 (d d,J=3.0,12.0Hz,1H),4.48(dd,J=3.0,12.0Hz,1H),2.74(s,3H),2.48-2.24(m,2H).

[0158] Example 3

[0159]

[0160] Synthesis route:

[0161]

[0162] Step 1: Synthesis of compound 7-c:

[0163] Compound 1-l (9.3 g, 18.54 mmol, 1 eq) was separated by SFC (column type: REGIS(s,s)WHELK-O1 (250 mm * 50 mm, 10 μm); mobile phase: [0.1% NH3H2O, EtOH]%: 25%-25%), and the second peak was collected to obtain compound 7-c.

[0164] MS m / z(ESI): 500.8 [M+1] + SFC analysis method (column type: (S,S)-Whelk-O1 100*4.6mm I.D., 3μm; mobile phase: ethanol (0.05% diethylamine); flow rate: 2.8mL / min); retention time: 2.990 min; ee% = 100%.

[0165] Step 2: Synthesis of compound 7-a

[0166] Compound 1-m (2 g, 11.75 mmol, 1.87 mL, 1 eq), tribromofluoromethane (3.82 g, 14.10 mmol, 1.2 eq), triphenylphosphine (3.70 g, 14.10 mmol, 1.2 eq), and tetrahydrofuran (60 mL) were added to a reaction flask. Diethylzinc (1 M, 14.10 mL, 1.2 eq) was added dropwise at 20 °C. The reaction mixture was stirred at 20 °C for 1 hour. Methanol (50 mL) was added to the reaction mixture, and after stirring for 20 minutes, the mixture was concentrated under reduced pressure. The residue was separated by an automated COMBI-FLASH column chromatography system (eluent: petroleum ether: ethyl acetate = 100:0 to 10:1) to give compound 7-a.

[0167] 1 H NMR (400MHz, CDCl3) δ=4.08-4.02(m,2H),2.72-2.68(m,1H),2.39-2.34(m,2H),1.95-1.81(m,4H),1.52-1.49(m,2H),1.21-1.18(m,3H).

[0168] Step 3: Synthesis of compound 7-b

[0169] Compound 7-a (2.3 g, 8.68 mmol, 1 eq) was dissolved in 1,4-dioxane (30 mL), followed by the addition of pinacol borate (4.41 g, 17.35 mmol, 2 eq), potassium acetate (2.55 g, 26.03 mmol, 3 eq), and Pd(dppf)Cl2.CH2Cl2 (708.46 mg, 867.54 μmol, 0.1 eq). After three nitrogen purgings, the mixture was heated to 90 °C and stirred for 16 hours. Water (50 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate (30 mL × 2). The combined organic phases were washed with saturated sodium chloride aqueous solution (50 mL × 1), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was separated by an automated COMBI-FLASH column chromatography system (eluent: petroleum ether: ethyl acetate = 100:0 to 10:1) to give compound 7-b.

[0170] 1 H NMR(400MHz, CDCl3)δ=4.08-4.02(m,2H),2.92-2.88(m,2H),2.43-2.37(m,1H) ,1.97-1.92(m,2H),1.97-1.92(m,2H),1.52-1.49(m,2H),1.21-1.18(m,15H).

[0171] Step 4: Synthesis of compound 7-d

[0172] Under nitrogen protection, compounds 7-c (150.00 mg, 298.95 μmol, 1 eq), 7-b (466.64 mg, 1.49 mmol, 5 eq), sodium carbonate (158.43 mg, 1.49 mmol, 5 eq), 1,4-dioxane (8 mL), and water (1.5 mL) were added to a thumb flask, followed by Pd(PPh3)4 (34.55 mg, 29.90 μmol, 0.1 eq). The mixture was stirred at 100 °C for 16 hours. After the reaction temperature dropped to approximately 25 °C, water (10 mL) was added to the reaction mixture, the pH was adjusted to 1–2 with 1 M dilute hydrochloric acid, and the mixture was extracted with ethyl acetate (15 mL × 3). The combined organic phases were washed with saturated brine (30 mL) and concentrated under reduced pressure. The residue was separated by an automated column chromatography system, COMBI-FLASH (gradient elution: petroleum ether: ethyl acetate = 100:0 to 70:30), to obtain compound 7-d.

[0173] MS m / z(ESI): 607.0 [M+1] + .

[0174] 1H NMR (400MHz, DMSO-d6) δ=7.97-7.90(m,2H),7.73(q,J=5.5Hz,2H),4.97(brt,J=9.8Hz,1H),4.43(dd,J=2.5,12.0Hz,1H),4.10-4.06(m,2H),2.78(br d,J=14.1Hz,1H),2.63(s,3H),2.57(td,J=3.8,10.4Hz,1H),2.42-2.35(m,1H),2.24-2.14(m,2H),2.13-2.05(m,1H ),1.87-1.77(m,1H),1.76-1.66(m,1H),1.64-1.57(m,1H),1.56-1.43(m,3H),1.39-1.27(m,1H),1.21-1.18(m,3H).

[0175] Step 5: Synthesis of Compound 7

[0176] Compound 7-d (100 mg, 164.73 μmol, 1 eq) and tetrahydrofuran (0.5 mL) were added to a thumb flask, followed by an aqueous sodium hydroxide solution (2 M, 0.5 mL, 6.07 eq). The mixture was stirred at 25 °C for 1 hour. Water (5 mL) was added to the reaction mixture, and the pH was adjusted to 1–2 with 1 M dilute hydrochloric acid. Extraction was performed with ethyl acetate (15 mL × 3). The combined organic phases were washed with saturated brine (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was separated by preparative high-performance liquid chromatography (HPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 40%–70%, 7 min) to obtain compound 7.

[0177] MS m / z(ESI): 579.0 [M+1] + .

[0178] 1H NMR (400MHz, DMSO-d6) δ=7.99-7.88(m,2H),7.78-7.68(m,2H),4.98(br t,J=9.6Hz,1H),4.43(dd,J=2.5,12.0Hz,1H),2.77(br d,J=13.8Hz,1H),2.63(s,3H),2.55(br s,1H),2.49-2.45(m,1H),2.43-2.35(m,1H),2.24-2.11(m,2H),2.08-2.04(m,1H),1.98(br dd,J=4.1,8.1Hz,2H),1.49(q,J=11.6Hz,2H).

[0179] Example 4

[0180]

[0181] Synthesis route:

[0182]

[0183] Step 1: Synthesis of compound 8-c

[0184] Compound 8-a (500 mg, 2.97 mmol, 1 eq) was dissolved in tetrahydrofuran (15 mL). The reaction solution was cooled to -78 °C, and then LiHMDS (1 M, 2.97 mL, 1 eq) was slowly added dropwise. The reaction was stirred at -78 °C for 0.5 hours. Then, a tetrahydrofuran solution of compound 8-b (1.06 g, 2.97 mmol, 1 eq) was slowly added dropwise to the reaction solution. The reaction was stirred at -78 °C for 0.5 hours, and then the temperature was raised to 25 °C and stirred for 1 hour. Water (20 mL) was slowly added to the reaction solution, followed by extraction with ethyl acetate (20 mL × 3). The combined organic phases were washed with saturated brine (10 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 10 / 1) to obtain compound 8-c.

[0185] 1 H NMR (400MHz, CDCl3) δ = 5.62-5.39 (m, 1H), 3.71 (d, J = 3.5Hz, 3H), 3.16-3.02 (m, 1H), 2.92 (d, J = 16.6Hz, 2H), 2.62-2.50 (m, 2H), 2.48-2.38 (m, 2H).

[0186] Step 2: Synthesis of compound 8-d

[0187] Compound 8-c (400 mg, 1.33 mmol, 1 eq), bis-pinacolborate (405.96 mg, 1.60 mmol, 1.2 eq), potassium acetate (392.24 mg, 4.00 mmol, 3 eq), and 1,1-bis(diphenylphosphine)ferrocene palladium chloride (97.48 mg, 133.22 μmol, 0.1 eq) were dissolved in 1,4-dioxane (7 mL) under nitrogen protection. The reaction system was purged with nitrogen three times and then heated to 90 °C with stirring for 3 hours. The reaction solution was directly concentrated under reduced pressure, and the crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 10 / 1) to give compound 8-d.

[0188] 1 H NMR (400MHz, CDCl3) δ=7.12-6.70(m,1H),3.68(s,3H),3.10-2.99(m,1H),2.68-2.53(m,2H),2.53-2.32(m,4H),1.27(s,12H).

[0189] Step 3: Synthesis of compound 8-e

[0190] Under nitrogen protection, compound 7-c (100 mg, 199.30 μmol, 1 eq), compound 8-d (166.31 mg, 597.90 μmol, 3 eq), potassium phosphate (126.91 mg, 597.90 μmol, 3 eq), and 1,1-bis(diphenylphosphine)ferrocene palladium chloride (14.58 mg, 19.93 μmol, 0.1 eq) were dissolved in 1,4-dioxane (1.4 mL) and water (0.4 mL). The reaction system was purged with nitrogen three times and then heated to 80 °C with stirring for 3 hours. The reaction solution was directly concentrated under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 2 / 1) to give compound 8-e.

[0191] MS m / z(ESI): 573.2 [M+1] + .

[0192] 1 H NMR (400MHz, CD3OD) δ = 7.70-7.60 (m, 5H), 6.43-6.22 (m, 1H), 5.01-4.97 (m, 1H), 4.47-4.44 ( m,1H),3.68(s,3H),2.79(s,1H),2.73(s,3H),2.49-2.44(m,3H),2.42-2.36(m,2H),2.28(br d,J=14.3Hz,2H).

[0193] Step 4: Synthesis of compound 8-f

[0194] Compound 8-e (50.00 mg, 87.26 μmol, 1 eq) was dissolved in methanol (3 mL). The reaction system was purged with nitrogen three times, then wet palladium on carbon (92.86 mg, 87.26 μmol, 10% purity, 1 eq) was added. After purging with hydrogen three times, the reaction solution was stirred at 25 °C under a hydrogen atmosphere (15 Psi) for 3 hours. The reaction solution was filtered through diatomaceous earth and concentrated under reduced pressure to obtain compound 8-f.

[0195] MS m / z (ESI): 575.2 [M+1] + .

[0196] Step 5: Synthesis of Compound 8

[0197] Compound 8-f (15.00 mg, 26.08 μmol, 1 eq) was dissolved in methanol (1 mL) and water (1 mL), and sodium hydroxide (5.22 mg, 130.42 μmol, 5 eq) was added. The mixture was stirred at 25 °C for 2 hours. Water (10 mL) was added to the reaction solution, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. The solution was then extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by preparative high-performance liquid chromatography (pHPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 40%-70%, 7 min) to obtain compound 8.

[0198] MS m / z(ESI): 561.2 [M+1] + .

[0199] 1 H NMR (400MHz, CD3OD) δ = 7.70-7.58 (m, 2H), 7.44 (s, 1H), 4.94 (br d,J=3.3Hz,1H),4.51-4.39(m,1H),3.02(quin,J=8.3Hz,1H),2.73(s,3H),2.66-2.58(m,1H),2.52-2.09(m,10H).

[0200] Example 5

[0201]

[0202] Synthesis route:

[0203]

[0204] Step 1: Synthesis of compound 9-b

[0205] 2,2,6,6-Tetramethylpiperidine (2.38 g, 16.88 mmol, 2.87 mL, 1.2 eq) was dissolved in tetrahydrofuran (24 mL), and the mixture was cooled to -30 °C. Butyllithium (2.5 M, 6.70 mL, 1.19 eq) was added. The reaction was stirred at -30 °C for 0.5 h. The mixture was then cooled to -78 °C, and a tetrahydrofuran solution of compound 1-n (3.77 g, 14.07 mmol, 1 eq) (24 mL) was added. The mixture was stirred at -78 °C for 30 min, and then a tetrahydrofuran solution of compound 9-a (2 g, 14.07 mmol, 1.87 mL, 1 eq) (24 mL) was added. The mixture was slowly heated to 25 °C and stirred at 25 °C for 12 h. The system was cooled to 0°C, and saturated ammonium chloride solution (20 mL) was added dropwise. The reaction mixture was stirred at 0°C for 1 hour. After filtration, the filtrate was concentrated under reduced pressure, and water (20 mL) was added. Extraction was performed with ethyl acetate (20 mL × 2). The organic phase was washed with saturated brine (20 mL) and concentrated under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 100:0-90:10) to give compound 9-b.

[0206] 1 H NMR (400MHz, CDCl3) δ = 5.25-5.15 (m, 1H), 4.27-4.08 (m, 2H), 3.23-3.08 (m, 4H), 3.00-2.93 (m, 1H), 1.30-1.28 (m, 3H), 1.25 (d, J = 1.5Hz, 12H).

[0207] Step 2: Synthesis of compound 9-c

[0208] Under nitrogen protection, compound 7-c (100.00 mg, 199.30 μmol, 1 eq), compound 9-b (159.13 mg, 597.90 μmol, 3 eq), sodium carbonate (63.37 mg, 597.90 μmol, 3 eq), 1,4-dioxane (2 mL), and water (0.3 mL) were added to a thumb flask, followed by tetra(triphenylphosphine)palladium (23.03 mg, 19.93 μmol, 0.1 eq). The reaction was stirred at 90 °C for 12 hours. The reaction solution was concentrated under reduced pressure to obtain a crude product. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 100:0-50:50) to obtain compound 9-c.

[0209] MS m / z(ESI): 561.0 [M+1] + .

[0210] 1H NMR (400MHz, CD3OD) δ = 7.71-7.62 (m, 2H), 7.55 (s, 1H), 6.47 (br s, 1H), 5.01 (br d,J=9.3Hz,1H),4.47(dd,J=3.0,11.8Hz,1H),4.19(q,J=7.1Hz,2H),3.33(s, 1H),3.22-3.10(m,4H),2.75(s,3H),2.43-2.30(m,2H),1.29(t,J=7.0Hz,3H).

[0211] Step 3: Synthesis of Compound 9

[0212] Compound 9-c (25.00 mg, 44.56 μmol, 1 eq) was dissolved in methanol (2 mL), and a solution of sodium hydroxide (5.35 mg, 133.68 μmol, 3 eq) in water (2 mL) was added. The reaction was stirred at 25 °C for 30 min. The pH of the reaction mixture was adjusted to 2–3 with 2 M dilute hydrochloric acid, and extracted with ethyl acetate (10 mL × 3). The organic phase was concentrated under reduced pressure to obtain the crude product. The crude product was purified by preparative high-performance liquid chromatography (column type: Welch Xtimate C18100 * 40 mm * 3 μm; mobile phase: [water (0.075% trifluoroacetic acid) - acetonitrile]; acetonitrile %: 45%–75%, 8 min) to obtain compound 9.

[0213] MS m / z(ESI): 533.1 [M+1] + .

[0214] 1 H NMR (400MHz, CD3OD) δ = 7.72-7.62 (m, 2H), 7.56 (s, 1H), 6.49 (t, J = 2.3Hz, 1H), 5.01 (br d,J=9.3Hz,1H),4.47(dd,J=3.4,11.9Hz,1H),3.30(s,1H),3.20(br s,2H),3.14(br d,J=8.5Hz,2H),2.75(s,3H),2.44-2.25(m,2H).

[0215] Example 6

[0216]

[0217] Synthesis method:

[0218]

[0219] Step 1: Synthesis of compound 10-b

[0220] Under nitrogen protection, 2,2,6,6-tetramethylpiperidine (9.20 g, 65.14 mmol, 11.06 mL, 1.2 eq) was dissolved in tetrahydrofuran (120 mL). The reaction system was cooled to -30 °C, and n-butyllithium (2.5 M, 26.05 mL, 1.2 eq) was slowly added dropwise. The reaction solution was stirred at -30 °C for 0.5 hours, and then cooled to -78 °C. A tetrahydrofuran solution of compound 1-n (14.54 g, 54.28 mmol, 1 eq) in 120 mL was slowly added dropwise. The reaction solution was stirred at -78 °C for 0.5 hours, and then a tetrahydrofuran solution of compound 10-a (10 g, 54.28 mmol, 1 eq) in 120 mL was added. The reaction solution was heated to 25 °C and stirred for 12 hours. After the reaction was complete, the reaction solution was cooled to 0°C, and then saturated ammonium chloride solution (100 mL) was slowly added dropwise. The reaction solution was stirred at 0°C for 10 minutes. The reaction solution was filtered, evaporated to dryness, and water (60 mL) was added. The solution was extracted with ethyl acetate (60 mL × 3). The organic phase was washed with saturated brine (60 mL × 3), dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated under reduced pressure to obtain the crude product. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 10 / 1) to give compound 10-b.

[0221] 1 H NMR (400MHz, CDCl3) δ = 5.05 (s, 1H), 4.18-4.08 (m, 2H), 3.14 (br dd,J=1.4,13.4Hz,1H),2.34-2.18(m,4H),2.05-1.95(m,2H),1.91-1.82(m,2H),1.28-1.24(m,15H),1.20-1.09(m,2H).

[0222] Step 2: Synthesis of compounds 10-d and 10-e

[0223] Compound 7-c (200 mg, 398.60 μmol, 1 eq), compound 10-b (614.29 mg, 1.99 mmol, 5 eq), and N,N-diisopropylethylamine (154.55 mg, 1.20 mmol, 208.29 μL, 3 eq) were dissolved in 1,4-dioxane (1.5 mL) and water (1.5 mL) under nitrogen protection. Dichlorobis(triphenylphosphine)palladium (27.98 mg, 39.86 μmol, 0.1 eq) was then added. The reaction mixture was heated to 100 °C and stirred for 12 hours. The reaction mixture was then concentrated directly under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 2 / 1) to give compound 10-c. The compounds 10-d and 10-e were then purified by SFC (column type: DAICEL CHIRALPAK IG (250mm*30mm, 10μm); mobile phase: [0.1% NH3H2O, EtOH]%: 60%-60%).

[0224] Compound 10-c: MS m / z (ESI): 603.1 [M+1] + .

[0225] 1 H NMR (400MHz, CD3OD) δ = 7.71-7.59 (m, 2H), 7.54 (s, 1H), 6.33 (s, 1H), 4.99 (dd, J=3.5,11.5Hz,1H),4.46(dd,J=3.4,11.7Hz,1H),4.14-4.11(m,2H),2.99(br d,J=13.8Hz,1H),2.74(s,3H),2.44-2.24(m,6H),2.15-2.02(m,2H),1.93(br d,J=12.8Hz,2H),1.25(d,J=1.0Hz,3H),1.17-1.08(m,2H).

[0226] SFC analysis method: Column type: Chiralpak IG-3 50*4.6mm ID, 3μm; Mobile phase: Ethanol (0.05% diethylamine); Flow rate: 4mL / min.

[0227] Compound 10-d: MS m / z (ESI): 603.1 [M+1] + SFC retention time: 1.982 minutes; ee% = 100%.

[0228] Compound 10-e: MS m / z (ESI): 603.1 [M+1] + SFC retention time: 4.655 minutes; ee% = 99.5%.

[0229] Step 3: Synthesis of Compound 10

[0230] Compound 10-c (70 mg, 116.07 μmol, 1 eq), sodium hydroxide (2 M, 290.17 μL, 5 eq), tetrahydrofuran (3 mL), and water (1 mL) were added to a round-bottom flask, and the reaction mixture was stirred at 20 °C for 2 hours. Water (10 mL) was added to the reaction mixture, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. The mixture was then extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by preparative high-performance liquid chromatography (pHPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 25%-95%, 7 min) to obtain compound 10.

[0231] MS m / z(ESI): 575.1 [M+1] + .

[0232] 1 H NMR (400MHz, CD3OD) δ=7.78-7.48(m,3H),6.34(br s,1H),5.01(br d,J=9.5Hz,1H),4.47(br d,J=9.0Hz,1H),3.01(br d,J=14.1Hz,1H),2.75(s,3H),2.51-1.84(m,10H),1.42-1.05(m,2H).

[0233] Step 4: Synthesis of Compound 11

[0234] Compound 10-d (260 mg, 431.11 μmol, 1 eq) was dissolved in methanol (2 mL) and water (2 mL), and sodium hydroxide (86.21 mg, 2.16 mmol, 5 eq) was added. The mixture was stirred at 25 °C for 2 hours. Water (10 mL) was added to the reaction solution, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. The solution was then extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by preparative high-performance liquid chromatography (p-column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 40%-70%, 7 min) to obtain compound 11.

[0235] MS m / z(ESI): 575.1 [M+1]+ .

[0236] SFC analysis method (column type: ChiralPak AS-3 150×4.6mm ID, 3μm; mobile phase: isopropanol (0.05% diethylamine); flow rate: 2.5mL / min); SFC retention time: 5.559 min; ee% = 100%.

[0237] 1 H NMR (400MHz, CD3OD) δ=7.70-7.60(m,2H),7.54(s,1H),6.33(s,1H),4.99(brdd,J=3.3,11.8Hz,1H),4.46(dd,J=3.3,11.8Hz,1H),3.00(br d,J=13.8Hz,1H),2.74(s,3H),2.46-2.28(m,4H),2.22(d,J=7.0Hz,2H),2.15-2.00(m,2H),1.96(br d,J=12.8Hz,2H),1.24-1.08(m,2H).

[0238] Step 5: Synthesis of Compound 12

[0239] Compound 10-e (210.00 mg, 348.20 μmol, 1 eq) was dissolved in methanol (2 mL) and water (2 mL), and sodium hydroxide (69.64 mg, 1.74 mmol, 5 eq) was added. The mixture was stirred at 25 °C for 2 hours. Water (10 mL) was added to the reaction solution, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. The solution was then extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by preparative high-performance liquid chromatography (pHPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 40%-70%, 7 min) to obtain compound 12.

[0240] MS m / z(ESI): 575.1 [M+1] + SFC retention time: 5.847 minutes; ee% = 98.5% 。

[0241] 1H NMR (400MHz, CD3OD) δ=7.70-7.60(m,2H),7.54(s,1H),6.33(s,1H),4.99(brdd,J=3.3,11.8Hz,1H),4.46(dd,J=3.3,11.8Hz,1H),3.00(br d,J=13.8Hz,1H),2.74(s,3H),2.46-2.28(m,4H),2.22(d,J=7.0Hz,2H),2.15-2.00(m,2H),1.96(br d,J=12.8Hz,2H),1.24-1.08(m,2H).

[0242] Example 7

[0243]

[0244] Synthesis route:

[0245]

[0246] Step 1: Synthesis of compound 13-a

[0247] 2,2,6,6-Tetramethylpiperidine (2.90 g, 20.53 mmol, 3.48 mL, 1.1 eq) was added to tetrahydrofuran (50 mL), and the mixture was cooled to -78 °C. Butyllithium (2.5 M, 9.70 mL, 1.3 eq) was added dropwise, and the reaction was stirred at -78 °C for 30 minutes. The temperature was then raised to 0 °C, and a tetrahydrofuran solution of compound 1-n (15 mL) was added dropwise. The reaction was stirred at 0 °C for 30 minutes, and then iodomethane (3.97 g, 27.99 mmol, 1.74 mL, 1.5 eq) in tetrahydrofuran (15 mL) was added dropwise. The reaction was stirred at 0 °C for 10 minutes, then heated to 25 °C and stirred for 12 hours. The system was cooled to 0 °C, and a saturated ammonium chloride solution (30 mL) was added to the reaction mixture. The mixture was stirred for 20 minutes and extracted with ethyl acetate (20 mL × 2). The combined organic phases were concentrated under reduced pressure to obtain the crude product. The crude product was purified by column chromatography (eluent: petroleum ether / ethyl acetate, gradient: 0-10%) to give compound 13-a.

[0248] 1 H NMR (400MHz, CDCl3) δ = 1.23 (s, 24H), 1.07 (s, 3H), 0.90-0.84 (m, 1H).

[0249] Step 2: Synthesis of compound 13-b

[0250] 2,2,6,6-Tetramethylpiperidine (2.49 g, 17.63 mmol, 2.99 mL, 1.2 eq) was dissolved in tetrahydrofuran (30 mL), and the system was cooled to -30 °C. Butyllithium (2.5 M, 6.99 mL, 1.19 eq) was added dropwise. The reaction was stirred at -30 °C for 0.5 h, then cooled to -78 °C. A tetrahydrofuran solution of compound 13-a (4.14 g, 14.69 mmol, 1 eq) was added dropwise, and the mixture was stirred at -78 °C for 30 min. Then, a tetrahydrofuran solution of compound 1-m (2.5 g, 14.69 mmol, 2.34 mL, 1 eq) was added dropwise. The reaction was slowly heated to 25 °C and stirred at 25 °C for 12 h. The system was cooled to 0°C, and saturated ammonium chloride solution (30 mL) was added dropwise. The reaction mixture was stirred at 0°C for 20 minutes. After filtration, the filtrate was concentrated under reduced pressure. Water (20 mL) and ethyl acetate (20 mL) were added for extraction. The combined organic phases were washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The crude product was purified by column chromatography (eluent: petroleum ether / ethyl acetate, gradient: 0-10%) to give compound 13-b.

[0251] MS m / z(ESI): 309.0 [M+1] + .

[0252] 1 H NMR (400MHz, CDCl3) δ = 4.13 (q, J = 7.1Hz, 2H), 3.04 (br d, J = 13.6Hz, 1H), 2.74 (br d,J=13.8Hz,1H),2.56-2.45(m,1H),2.10-1.96(m,3H),1.90-1.81(m,1H),1.70(s,3H),1.62-1.55(m,2H),1.28(s,12H),1.26(br s,3H).

[0253] Step 3: Synthesis of compound 13-c

[0254] Compound 13-b (100 mg, 199.30 μmol, 1 eq) and compound 7-c (307.14 mg, 996.51 μmol, 5 eq) were dissolved in 1,4-dioxane (3 mL), and water (0.6 mL) and sodium carbonate (105.62 mg, 996.51 μmol, 5 eq) were added. After nitrogen purging, 1,1-bis(diphenylphosphine)ferrocene palladium chloride (29.17 mg, 39.86 μmol, 0.2 eq) was added. The reaction was stirred at 100 °C for 12 hours. The reaction solution was concentrated under reduced pressure to obtain a crude product. The crude product was purified by column chromatography (eluent: petroleum ether / ethyl acetate, gradient: 0-40%) to obtain compound 13-c.

[0255] MS m / z(ESI): 603.0 [M+1] + .

[0256] 1 H NMR (400MHz, CD3OD) δ=7.73-7.62(m,2H),7.43(s,1H),5.02(dd,J=3.5,11.8H z,1H),4.48(dd,J=3.3,11.8Hz,1H),4.18-4.11(m,2H),2.86-2.79(m,1H),2.7 6(s,3H),2.64-2.55(m,2H),2.44-2.28(m,2H),2.16-2.07(m,2H),2.04(s,3H ),2.02-1.90(m,2H),1.69-1.60(m,1H),1.56-1.46(m,1H),1.28-1.25(m,3H).

[0257] Step 4: Synthesis of Compound 13

[0258] Compound 13-c (30 mg, 49.74 μmol, 1 eq) was dissolved in methanol (2 mL), and a solution of sodium hydroxide (1.99 mg, 49.74 μmol, 1 eq) in water (2 mL) was added. The reaction was stirred at 25 °C for 0.5 h. The pH of the reaction mixture was adjusted to 2-3 with 2 M dilute hydrochloric acid, and ethyl acetate (10 mL × 3) was added for extraction. The combined organic phases were concentrated under reduced pressure. The crude product was purified by preparative high performance liquid chromatography (column type: Phenomenex Gemini-NX C1875*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 45%-75%, 7 min) to obtain compound 13.

[0259] MS m / z(ESI): 575.0 [M+1] + .

[0260] 1 H NMR (400MHz, CD3OD) δ=7.73-7.60(m,2H),7.43(s,1H),5.02(dd,J=3.4,11.8Hz,1H),4.48(dd,J=3.2,11.8Hz,1H),2.83(br d,J=14.5Hz,1H),2.76(s,3H),2.67-2.51(m,2H),2.44-2.27(m,2H),2.16-2.07(m,2H),2.05(s,3H),1.98(br t,J=11.4Hz,2H),1.68-1.46(m,2H).

[0261] Example 8

[0262]

[0263] Synthesis route:

[0264]

[0265] Step 1: Synthesis of compound 14-a

[0266] Methyltriphenylphosphine bromide (23.09 g, 64.63 mmol, 1.1 eq) was dissolved in tetrahydrofuran (160 mL). The reaction solution was cooled to -5 °C, and butyllithium (2.5 M, 25.85 mL, 1.1 eq) was slowly added dropwise under a nitrogen atmosphere. The reaction solution was then stirred at 0 °C for 1 hour, followed by the slow addition of compound 1-m (10 g, 58.75 mmol, 9.35 mL, 1 eq). The reaction solution was stirred at 25 °C for 12 hours. After the reaction was complete, the reaction solution was cooled to 0 °C, and a saturated ammonium chloride solution (100 mL) was slowly added. After stirring for 10 minutes, ethyl acetate (200 mL × 3) was added for extraction. The organic phase was washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 20 / 1) to give compound 14-a.

[0267] 1 H NMR (400MHz, CDCl3) δ = 4.65 (s, 2H), 4.13 (q, J = 7.1Hz, 2H), 2.51-2.25 (m, 3H), 2.14-1.94 (m, 4H), 1.65-1.54 (m, 2H), 1.32-1.19 (m, 3H).

[0268] Step 2: Synthesis of compound 14-b

[0269] Compound 14-a (3 g, 17.83 mmol, 1 eq) was dissolved in tetrahydrofuran (150 mL), followed by the addition of zinc-copper (20.69 g, 160.49 mmol, 9 eq), and then trichloroacetyl chloride (16.21 g, 89.16 mmol, 9.95 mL, 5 eq). The reaction mixture was stirred at 25 °C for 12 hours. The reaction mixture was slowly poured into ice water, and then extracted with ethyl acetate (200 mL × 3). The combined organic phases were washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 10 / 1) to give compound 14-b.

[0270] 1 H NMR (400MHz, CDCl3) δ = 4.16 (dd, J = 7.2, 13.4Hz, 2H), 3.04 (d, J = 14.3Hz, 2H), 2.57-2.46 (m, 1H), 2.39-2.26 (m, 1H), 2.19-2.07 (m, 3H), 1.92 (br d,J=13.3Hz,1H),1.81-1.61(m,3H),1.28(d,J=7.0Hz,3H).

[0271] Step 3: Synthesis of compound 14-c

[0272] Compound 14-b (2.3 g, 8.24 mmol, 1 eq) was dissolved in glacial acetic acid (20 mL), and zinc powder (2.16 g, 32.96 mmol, 4 eq) was added. The reaction mixture was stirred at 50 °C for 2 hours. The reaction mixture was filtered, the filter cake was quenched with 4 M dilute hydrochloric acid, and the pH was adjusted to neutral with saturated sodium hydroxide aqueous solution. The filtrate was poured into water (50 mL), extracted with ethyl acetate (30 mL × 2), and the combined organic phases were washed with saturated sodium chloride aqueous solution (50 mL × 1), dried over anhydrous sodium sulfate, filtered, and rotary evaporated. The residue was purified by automated COMBI-FLASH column chromatography (eluent: petroleum ether: ethyl acetate = 100:0 to 10:1) to give compound 14-c.

[0273] 1 H NMR(400MHz, CDCl3)δ=4.16-1.33(m,2H),2.77-2.76(d,J=8.0Hz,,4H),2.37-2.31(m ,1H),1.97-1.93(m,2H),1.81-1.77(m,2H),1.65-1.55(m,4H),1.26(t,J=7.2Hz,3H).

[0274] Step 4: Synthesis of compound 14-d

[0275] Compound 14-c (300 mg, 1.43 mmol, 1 eq) was dissolved in tetrahydrofuran (10 mL), and lithium bis(trimethylsilyl)amino (1.0 M, 1.57 mL, 1.1 eq) was added dropwise at -78 °C. After the addition was complete, the mixture was stirred at -78 °C for 0.5 h, followed by the addition of a mixture of N-phenylbis(trifluoromethanesulfonyl)imide (560.67 mg, 1.57 mmol, 1.1 eq) and tetrahydrofuran (10 mL). The reaction mixture was stirred at -78 °C for 0.5 h, then heated to -78 °C and stirred for 1 h. Water (10 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate (10 mL × 2). The combined organic phases were washed with saturated sodium chloride aqueous solution (20 mL × 1), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by automated column chromatography using a COMBI-FLASH system (eluent: petroleum ether: ethyl acetate = 100:0 to 10:1) to give compound 14-d.

[0276] 1 H NMR (400MHz, CDCl3) δ = 5.69 (s, 0.5H), 5.42 (s, 0.5H), 4.09-4.03 (m, 2H), 2.51-2.50 (m,, 2H), 2.2 6-2.19(m,1H),1.89-1.86(m,2H),1.59-1.51(m,6H),1.18(t,J=6.0Hz,,3H),0.81-0.79((m,1H).

[0277] Step 5: Synthesis of compound 14-e

[0278] Compound 14-d (400 mg, 1.17 mmol, 1 eq), bis(diphenylphosphine)boronic acid ester (356.06 mg, 1.40 mmol, 1.2 eq), potassium acetate (344.03 mg, 3.51 mmol, 3 eq), and [1,1-bis(diphenylphosphine)ferrocene]palladium dichloromethane (95.42 mg, 116.85 μmol, 0.1 eq) were added to 1,4-dioxane (7 mL). The mixture was purged with nitrogen three times and then heated to -78 °C and stirred for 3 hours. Water (10 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate (10 mL). The combined organic phases were washed with saturated sodium chloride aqueous solution (10 mL × 1), dried over anhydrous sodium sulfate, filtered, and rotary evaporated. The residue was purified by automated column chromatography using a COMBI-FLASH column (eluent: petroleum ether: ethyl acetate = 100:0 to 10:1) to give compound 14-e.

[0279] 1H NMR (400MHz, CDCl3) δ = 7.15 (s, 0.5H), 6.86 (s, 0.5H), 4.08-4.02 (m, 2H), 2.21 (d, J = 6.0 Hz,,2H),1.82-1.79(m,3H),1.69-1.56(m,2H),1.49-1.39(m,4H),1.23-1.18(m,15H).

[0280] Step 6: Synthesis of compound 14-f

[0281] Compound 1-l (100 mg, 199.30 μmol, 1 eq), compound 14-e (191.47 mg, 597.90 μmol, 3 eq), potassium phosphate (126.91 mg, 597.90 μmol, 3 eq), and [1,1-bis(diphenylphosphine)ferrocene]palladium dichloromethane (16.28 mg, 19.93 μmol, 0.1 eq) were added to a mixture of 1,4-dioxane (1.4 mL) and water (0.4 mL). The reaction mixture was heated to 80 °C and stirred for 3 hours. The reaction mixture was poured into water (10 mL), extracted with ethyl acetate (10 mL × 3), and the combined organic phases were washed with saturated sodium chloride aqueous solution (10 mL), dried over anhydrous sodium sulfate, filtered, and rotary evaporated. The residue was purified by automated column chromatography using a COMBI-FLASH system (eluent: petroleum ether: ethyl acetate = 100:0 to 2:1) to give compound 14-f.

[0282] MS m / z (ESI): 615.2 [M+1] + .

[0283] 1 H NMR (400MHz, CD3OD) δ = 7.64-7.61 (m, 3H), 6.63 (s, 0.5H), 6.33 (s, 0.5H), 5.03 (dd, J = 3.2Hz, 1H), 4.49 (dd, J = 3.2Hz, 1H), 4.16 -4.11(m,2H),2.75(s,3H),2.53(d,J=3.2Hz,1H),2.39-2.32(m,3H),1.70-1.69(m,2H),1.69-1.49(m,7H),1.29-1.25(m,3H).

[0284] Step 7: Synthesis of compound 14-g

[0285] Compound 14-f (90 mg, 146.32 μmol, 1 eq) was dissolved in methanol (3 mL), and wet palladium on carbon (90 mg, 146.32 μmol, 10% purity, 1.00 eq) was added after three purgings with nitrogen. The reaction was then purged three times with hydrogen. The mixture was stirred at 20 °C under hydrogen (15 Psi) for 12 hours. The reaction solution was directly filtered, and the filtrate was concentrated under reduced pressure and dried to obtain compound 14-g.

[0286] MS m / z (ESI): 617.2 [M+1] + .

[0287] Step 8: Synthesis of Compound 14

[0288] Compound 14-g (30 mg, 48.61 μmol, 1 eq) was dissolved in tetrahydrofuran (2 mL), and a mixture of sodium hydroxide (9.72 mg, 243.06 μmol, 5 eq) and water (1 mL) was added. The reaction was stirred at 20 °C for 1 hour. The organic solvent was directly distilled off from the reaction solution, the pH was adjusted to 3-4 with 4N hydrochloric acid aqueous solution, and the solution was extracted with dichloromethane (10 mL × 2). The combined organic phases were concentrated and dried under reduced pressure. The crude product was separated by preparative high performance liquid chromatography (column type: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 45%-75%, 7 min) to obtain compound 14.

[0289] MS m / z(ESI): 589.2 [M+1] + .

[0290] 1 H NMR (400MHz, CD3OD) δ=7.68-7.63(m,3H),7.62-7.47(m,1H),4.97-4.96(m,1H),4.47(dd, J=3.2Hz,1H),3.79-3.70(m,1H),2.75(s,3H),2.47-2.37(m,1H),2.32-2.29(m,1H),2.25 -2.06(m,3H),1.93-1.89(m,4H),1.69-1.51(m,2H),1.49-1.44(m,4H).

[0291] Example 9

[0292]

[0293] Synthesis route:

[0294]

[0295] Step 1: Synthesis of compound 15-a

[0296] Compound 1-h (152 g, 431.59 mmol, 1 eq) was added to ethanol (1520 mL). The reaction solution was cooled to 0 °C, and sodium borohydride (24.49 g, 647.39 mmol, 1.5 eq) was slowly added. The reaction solution was then stirred at 25 °C for 0.5 h. The reaction solution was slowly quenched with saturated ammonium chloride aqueous solution (500 mL), and the pH was adjusted to neutral with 0.5 M dilute hydrochloric acid. Most of the ethanol was removed by concentration under reduced pressure, and 500 mL of water was added. The pH was adjusted to 4–6 with 0.5 M dilute hydrochloric acid, and the mixture was extracted with ethyl acetate (1000 mL × 2). The combined organic phases were washed successively with water (1000 mL) and saturated brine (1000 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was slurried with 500 mL of methyl tert-butyl ether at room temperature for 1 h, filtered, and the filter cake was collected and dried under reduced pressure to give compound 15-a.

[0297] MS m / z (ESI): 355.8 [M+1] + .

[0298] 1 H NMR (400MHz, CD3OD) δ = 7.98-7.54 (m, 1H), 4.99 (dd, J = 3.0, 12.0Hz, 1H), 4.41 (dd, J = 2.9, 12.4Hz,1H),2.81-2.71(m,3H),2.57-2.44(m,1H),2.27-2.12(m,1H),2.27-2.12(m,1H).

[0299] Step 2: Synthesis of compound 15-b

[0300] Under nitrogen protection, compound 15-a (2 g, 5.61 mmol, 1 eq), compound 1-o (8.26 g, 28.07 mmol, 5 eq), N,N-diisopropylethylamine (3.63 g, 28.07 mmol, 4.89 mL, 5 eq), and dichlorobis(triphenylphosphine)palladium (394.08 mg, 561.46 μmol, 0.1 eq) were dissolved in 1,4-dioxane (20 mL) and water (20 mL), and the mixture was heated to 80 °C and stirred for 12 hours. The pH of the reaction mixture was adjusted to 1–2 with 1 M dilute hydrochloric acid, followed by the addition of water (50 mL). The mixture was extracted with ethyl acetate (50 mL × 3), and the combined organic phases were washed with saturated brine (50 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by rapid column chromatography (dichloromethane / methanol = 1 / 0 to 5 / 1) to give compound 15-b.

[0301] MS m / z(ESI): 444.0 [M+1] + .

[0302] 1 H NMR (400MHz, CD3OD) δ = 7.57 (dd, J = 3.3, 7.5Hz, 1H), 6.36 (s, 1H), 4.98-4.93 (m, 1H), 4.27 (dd, J = 2.9, 12.4Hz, 1H), 4.14-4.07 (m, 1H), 2.94 (br d,J=14.3Hz,1H),2.75(s,3H),2.60(tt,J=4.0,10.7Hz,1H),2.50-2.41(m,2H),2.31(dt,J=3 .9,12.7Hz,2H),2.23-2.14(m,2H),2.10-2.03(m,2H),1.68-1.54(m,2H),1.27-1.23(m,3H).

[0303] Step 3: Synthesis of compound 15-d

[0304] Compound 15-b (0.1 g, 225.46 μmol, 1 eq) and compound 15-c (70.34 mg, 338.19 μmol, 1.5 eq) were dissolved in dichloromethane (5 mL). The system was cooled to 0 °C, and tri-n-propylcyclic phosphoric anhydride (215.21 mg, 338.19 μmol, 201.13 μL, 50% concentration, 1.5 eq) and N,N-diisopropylethylamine (87.42 mg, 676.38 μmol, 117.81 μL, 3 eq) were added. The reaction was stirred at 25 °C for 16 hours. The reaction solution was concentrated under reduced pressure, and the crude product was purified by column chromatography (eluent: petroleum ether / ethyl acetate, gradient: 0-50%) to obtain compound 15-d.

[0305] MS m / z(ESI): 632.7 [M+1] + .

[0306] Step 4: Synthesis of Compound 15

[0307] Compound 15-d (50 mg, 78.92 μmol, 1 eq) was dissolved in methanol (2 mL), and a solution of sodium hydroxide (9.47 mg, 236.77 μmol, 3 eq) in water (2 mL) was added. The reaction mixture was stirred at 25 °C for 30 min. The pH of the reaction mixture was adjusted to 3–4 with 2 M dilute hydrochloric acid, and ethyl acetate (10 mL × 3) was added for extraction. The combined organic phases were concentrated under reduced pressure. The crude product was purified by preparative high-performance liquid chromatography (p-column: Phenomenex Gemini-NX C1875 * 30 mm * 3 μm; mobile phase: [water (0.225% formic acid) - acetonitrile]; acetonitrile %: 40%–70%, 7 min) to obtain compound 15.

[0308] MS m / z (ESI): 605.1 [M+1] + .

[0309] 1 H NMR (400MHz, CD3OD) δ=7.78-7.68(m,2H),7.58(s,1H),6.38(s,1H),5.04-4.98(m,1H),4.47(dd,J=3.0,11.8Hz,1H),2.97(br d,J=14.1Hz,1H),2.76(s,3H),2.59(brs,1H),2.51-2.29(m,4H),2.28-2.19(m,1H),2.09(br d,J=12.0Hz,2H),1.71-1.55(m,2H).

[0310] Example 10

[0311]

[0312] Synthesis route:

[0313]

[0314] Step 1: Synthesis of compound 16-b

[0315] Compound 15-b (100 mg, 225.46 μmol, 1 eq) and compound 16-a (49.75 mg, 338.19 μmol, 1.5 eq) were dissolved in dichloromethane (5 mL). The reaction solution was cooled to 0 °C, and then tri-n-propylcyclic phosphoric anhydride (215.21 mg, 338.19 μmol, 201.13 μL, 50% concentration, 1.5 eq) and N,N-diisopropylethylamine (87.42 mg, 676.38 μmol, 117.81 μL, 3 eq) were added. The reaction solution was heated to 25 °C and stirred for 12 hours. The reaction solution was then concentrated directly under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 2 / 1) to obtain compound 16-b.

[0316] MS m / z(ESI): 573.2 [M+1] + .

[0317] Step 2: Synthesis of Compound 16

[0318] Compound 16-b (50 mg, 87.32 μmol, 1 eq) was dissolved in methanol (1 mL) and water (1 mL), and sodium hydroxide (17.46 mg, 436.59 μmol, 5 eq) was added. The reaction mixture was stirred at 25 °C for 2 hours. Water (10 mL) was added to the reaction mixture, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. The mixture was then extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by preparative high-performance liquid chromatography (pHPLC) (column: Phenomenex Gemini-NX C18 75 × 30 mm × 3 μm; mobile phase: [water (0.225% formic acid) - acetonitrile]; acetonitrile %: 35%-65%, 7 min) to obtain compound 16.

[0319] MS m / z (ESI): 544.5 [M+1] + .

[0320] 1H NMR (400MHz, CD3OD) δ=7.60-7.42(m,3H),6.37(s,1H),5.00(br dd,J=3.3,11.8Hz,1H),4.45(br dd,J=3.3,11.8Hz,1H),2.95(br d,J=13.1Hz,1H),2.74(s,3H),2.57(br t,J=10.8Hz,1H),2.46(br d,J=13.3Hz,1H),2.41-2.26(m,3H),2.21(br t,J=11.4Hz,1H),2.07(br d,J=12.3Hz,2H),1.69-1.55(m,2H).

[0321] Example 11

[0322]

[0323] Synthesis route:

[0324]

[0325] Step 1: Synthesis of compound 17-b

[0326] In a round-bottom flask, compounds 17-a (44.25 mg, 270.55 μmol, 1.2 eq), 15-b (100 mg, 225.46 μmol, 1 eq), tri-n-propyl cyclic phosphoric anhydride (215.21 mg, 338.19 μmol, 201.13 μL, 50% concentration, 1.5 eq), and diisopropyl ethylamine (87.42 mg, 676.38 μmol, 117.81 μL, 3 eq) were sequentially added to dichloromethane (5 mL). The reaction mixture was stirred at 25 °C for 2 hours under nitrogen protection. Water (50 mL) was added to the reaction mixture, and the mixture was extracted with dichloromethane (30 mL × 2). The combined organic phases were washed sequentially with water (30 mL) and saturated brine (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 10 / 3) to give compound 17-b.

[0327] MS m / z(ESI): 589.1 [M+1] + .

[0328] Step 2: Synthesis of Compound 17

[0329] Compound 17-b (60 mg, 101.85 μmol, 1 eq) and sodium hydroxide (20.37 mg, 509.27 μmol, 5 eq) were added to methanol (0.5 mL) and water (0.5 mL), and the reaction mixture was stirred at 25 °C for 30 min. The pH of the reaction mixture was adjusted to pH 4–5 with 4 M dilute hydrochloric acid, and water (30 mL) was added. The mixture was extracted with ethyl acetate (30 mL × 2). The combined organic phases were washed successively with water (20 mL) and saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by preparative high performance liquid chromatography (column type: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 35%–65%, 7 min) to obtain compound 17.

[0330] MS m / z(ESI): 561.1 [M+1] + .

[0331] 1 H NMR (400MHz, DMSO-d6) δ = 12.16 (br s, 1H), 10.38 (s, 1H), 7.91 (br d,J=10.0Hz,1H),7.68-7.59(m,1H),7.68-7.59(m,1H),7.41-7.27(m,1H),6.41(s,1H),4.92(brt,J=10.0Hz,1H),4.46(br d,J=10.3Hz,1H),2.83(br d,J=14.1Hz,1H),2.67(s,3H),2.43-2.33(m,3H),2.31-2.21(m,1H),2.17(br d,J=12.8Hz,2H),1.98(br d,J=9.0Hz,2H),1.58-1.36(m,2H).

[0332] Example 12

[0333]

[0334] Synthesis route:

[0335]

[0336] Step 1: Synthesis of compound 18-b

[0337] Under nitrogen protection, compound 15-b (200 mg, 450.92 μmol, 1 eq), compound 18-a (140.69 mg, 676.38 μmol, 1.5 eq), diisopropylethylamine (174.83 mg, 1.35 mmol, 235.62 μL, 3 eq), and tetrahydrofuran (5 mL) were added to a thumb flask, followed by tri-n-propylcyclic phosphoric anhydride (573.90 mg, 901.84 μmol, 536.35 μL, 50% purity, 2 eq). The mixture was stirred at 50 °C for 12 hours. The reaction solution was cooled to room temperature (25 °C), water (15 mL) was added, the pH was adjusted to 1–2 with dilute hydrochloric acid (2 M), and the mixture was extracted with ethyl acetate (20 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 2), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was separated by an automated column chromatography system, COMBI-FLASH (gradient elution: petroleum ether: ethyl acetate = 100:0 to 80:20), to obtain compound 18-b.

[0338] MS m / z(ESI): 632.8 [M+1] + .

[0339] Step 2: Synthesis of Compound 18

[0340] Compound 18-b (250 mg, 394.62 μmol, 1 eq) and methanol (5 mL) were added to a thumb flask, followed by a solution of sodium hydroxide (78.92 mg, 1.97 mmol, 5 eq) in water (1 mL). The mixture was stirred at 25 °C for 1 hour. Water (5 mL) was added to the reaction mixture, and the pH was adjusted to 1–2 with 1 M dilute hydrochloric acid. Extraction was performed with ethyl acetate (15 mL × 3). The combined organic phases were washed with saturated brine (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was separated by preparative high-performance liquid chromatography (HPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 35%–65%, 7 min) to obtain compound 18.

[0341] MS m / z (ESI): 605.1 [M+1] + .

[0342] 1H NMR (400MHz, DMSO-d6) δ = 12.16 (br s, 1H), 10.35 (s, 1H), 7.91 (br d, J = 9.8Hz, 1H), 7.72-7.61 (m, 2H), 7.34-7.26 (m, 1H), 6.41 (s, 1H), 4.92 (br t,J=9.9Hz,1H),4.45(br d,J=10.5Hz,1H),2.83(br d,J=14.1Hz,1H),2.67(s,3H),2.44-2.33(m,3H),2.27(br d,J=11.8Hz,1H),2.22-2.12(m,2H),2.04-1.92(m,2H),1.57-1.37(m,2H).

[0343] Example 13

[0344]

[0345] Synthesis route:

[0346]

[0347] Step 1: Synthesis of compound 19-b

[0348] Compound 15-b (100 mg, 225.46 μmol, 1 eq) and compound 19-a (60.88 mg, 338.19 μmol, 1.5 eq) were dissolved in dichloromethane (5 mL). The reaction solution was cooled to 0 °C, and then tri-n-propylcyclic phosphoric anhydride (215.21 mg, 338.19 μmol, 201.13 μL, 50% concentration, 1.5 eq) and N,N-diisopropylethylamine (87.42 mg, 676.38 μmol, 117.81 μL, 3 eq) were added. The reaction solution was heated to 25 °C and stirred for 12 hours. The reaction solution was then concentrated directly under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 2 / 1) to obtain compound 19-b.

[0349] MS m / z (ESI): 605.1 [M+1] + .

[0350] Step 2: Synthesis of Compound 19

[0351] Compound 19-b (50 mg, 82.57 μmol, 1 eq) was dissolved in methanol (1 mL) and water (1 mL), and sodium hydroxide (16.51 mg, 412.86 μmol, 5 eq) was added. The reaction mixture was stirred at 25 °C for 2 hours. Water (10 mL) was added to the reaction mixture, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. The mixture was then extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by preparative high-performance liquid chromatography (p-column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 40%-70%, 7 min) to obtain compound 19.

[0352] MS m / z(ESI): 577.1 [M+1] + .

[0353] 1 H NMR (400MHz, CD3OD) δ = 7.79 (d, J = 6.0Hz, 2H), 7.56 (s, 1H), 6.36 (s, 1H), 5.00 (br dd, J = 3.4, 11.7Hz, 1H), 4.46 (br dd, J = 3.1, 11.9Hz, 1H), 2.95 (br d,J=14.1Hz,1H),2.74(s,3H),2.57(br t,J=10.8Hz,1H),2.51-2.43(m,1H),2.41-2.27(m,3H),2.20(br t,J=11.4Hz,1H),2.12-2.04(m,2H),1.69-1.55(m,2H).

[0354] Example 14

[0355]

[0356] Synthesis route:

[0357]

[0358] Step 1: Synthesis of compound 20-a

[0359] Compound 15-a (10 g, 28.07 mmol, 1 eq) was separated by SFC (column type: DAICEL CHIRALPAK AD (250 mm * 50 mm, 10 μm); mobile phase: [0.1% NH3H2O, MeOH]%: 45%-45%) to obtain compound 20-a.

[0360] MS m / z (ESI): 357.7 [M+1] + SFC analysis method (column type: Chiralpak AD-3 150*4.6mm I.D., 3μm; mobile phase: carbon dioxide containing 40% methanol (0.05% diethylamine); flow rate: 2.5mL / min); SFC retention time: 3.030 min; ee% = 99.96%.

[0361] 1 H NMR (400MHz, DMSO-d6) δ = 7.84 (s, 1H), 4.76 (dd, J = 2.6, 11.9Hz, 1H), 3.73 (brdd, J = 2.3, 12.3Hz, 1H), 3.17 (s, 1H), 2.61 (s, 3H), 2.30 (br d,J=14.1Hz,1H),1.95-1.86(m,1H).

[0362] Step 2: Synthesis of compound 20-b

[0363] Compound 20-a (800.00 mg, 2.25 mmol, 1 eq), compound 10-b (2.08 g, 6.74 mmol, 3 eq), N,N-diisopropylethylamine (1.45 g, 11.23 mmol, 1.96 mL, 5 eq), and dichlorobis(triphenylphosphine)palladium (157.63 mg, 224.58 μmol, 0.1 eq) were dissolved in 1,4-dioxane (10 mL) and water (10 mL) under nitrogen protection. The reaction mixture was then heated to 80 °C and stirred for 4 hours. The pH of the reaction mixture was adjusted to 1–2 by adding 1 M dilute hydrochloric acid, followed by the addition of water (50 mL). The mixture was extracted with ethyl acetate (50 mL × 3). The combined organic phases were washed with saturated brine (50 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by a C18 reversed-phase column (water / acetonitrile = 1 / 0 to 2 / 1) to give compound 20-b.

[0364] MS m / z(ESI): 458.1 [M+1] + .

[0365] 1H NMR (400MHz, CD3OD) δ = 7.54 (s, 1H), 6.33 (s, 1H), 4.97 (br dd, J = 2.9, 11.9Hz, 1H), 4.39 (dd, J = 2.8, 12.4Hz, 1H), 4.16-4.10 (m, 2H), 2.99 (br d,J=12.0Hz,1H),2.76(s,3H),2.48-2.39(m,2H),2.35-2.20(m,4H),2.15-2.03(m,2H),1.94(br d,J=12.5Hz,2H),1.28-1.24(m,3H),1.21-1.09(m,2H).

[0366] Step 3: Synthesis of compound 20-d

[0367] Under nitrogen protection, compound 20-b (75 mg, 163.91 μmol, 1 eq), compound 20-c (40.21 mg, 245.87 μmol, 1.5 eq), diisopropylethylamine (63.55 mg, 491.74 μmol, 85.65 μL, 3 eq), and tetrahydrofuran (3 mL) were added to a thumb flask, followed by tri-n-propylcyclic phosphoric anhydride (208.61 mg, 327.82 μmol, 50% concentration, 2 eq). The mixture was stirred at 50 °C for 12 hours. The reaction solution was concentrated under reduced pressure. The residue was separated by an automated COMBI-FLASH column chromatography system (gradient elution: petroleum ether: ethyl acetate = 100:0 to 70:30) to give compound 20-d.

[0368] MS m / z (ESI): 603.1 [M+1] + .

[0369] Step 4: Synthesis of Compound 20

[0370] Compound 20-d (80 mg, 132.65 μmol, 1 eq) and methanol (1 mL) were added to a thumb flask, followed by an aqueous solution of sodium hydroxide (2 M, 331.62 μL, 5 eq). The mixture was stirred at 25 °C for 1 hour. Water (5 mL) was added to the reaction mixture, and the pH was adjusted to 1–2 with 1 M dilute hydrochloric acid. Extraction was performed with ethyl acetate (15 mL × 2). The combined organic phases were washed with saturated brine (30 mL) and concentrated under reduced pressure. The residue was purified by preparative high-performance liquid chromatography (HPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 40%–70%, 7 min) to give compound 20.

[0371] MS m / z(ESI): 575.0 [M+1] + .

[0372] 1 H NMR (400MHz, CD3OD) δ = 8.00 (t, J = 7.8Hz, 1H), 7.56 (s, 1H), 7.37-7.24 (m, 1H), 6.35 (s, 1H), 5.03 (dd, J = 3.1, 11.9Hz, 1H), 4.52 (dd, J = 3. 0,12.0Hz,1H),3.08-2.94(m,1H),2.80(s,3H),2.52-2.40(m,2H),2.38-2.28(m,2H),2.24(d,J=7.0Hz,2H),2.18-2.02(m,2H),1.98(br d,J=12.3Hz,2H),1.27-1.08(m,2H).

[0373] Example 15

[0374]

[0375] Synthesis route:

[0376]

[0377] Step 1: Synthesis of compound 21-b

[0378] Compound 20-b (75.00 mg, 163.91 μmol, 1 eq) and compound 21-a (40.21 mg, 245.87 μmol, 1.5 eq) were dissolved in tetrahydrofuran (3 mL). The reaction solution was cooled to 0 °C, and then tri-n-propyl cyclic phosphoric anhydride (208.61 mg, 327.82 μmol, 50% concentration, 2 eq) and N,N-diisopropylethylamine (63.55 mg, 491.74 μmol, 85.65 μL, 3 eq) were added. The reaction solution was heated to 50 °C and stirred for 12 hours. The reaction solution was then concentrated directly under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 2 / 1) to obtain compound 21-b.

[0379] MS m / z (ESI): 603.1 [M+1] + .

[0380] Step 2: Synthesis of Compound 21

[0381] Compound 21-b (50 mg, 82.90 μmol, 1 eq) was dissolved in methanol (1 mL) and water (1 mL), and sodium hydroxide (16.58 mg, 414.52 μmol, 5 eq) was added. The reaction mixture was stirred at 25 °C for 2 hours. Water (10 mL) was added to the reaction mixture, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. The mixture was then extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by preparative high-performance liquid chromatography (pHPLC) (column type: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 40%-70%, 7 min) to obtain compound 21.

[0382] MS m / z(ESI): 575.1 [M+1] + .

[0383] 1 H NMR (400MHz, CD3OD) δ = 7.68 (dt, J = 5.6, 8.7Hz, 1H), 7.55 (s, 1H), 7.15 (dt, J = 2.0, 8.9Hz ,1H),6.33(s,1H),5.02(dd,J=3.1,12.2Hz,1H),4.51(dd,J=3.1,11.9Hz,1H),3.00(br d,J=13.8Hz,1H),2.80(s,3H),2.49-2.39(m,2H),2.37-2.26(m,2H),2.22(d,J=7.0Hz,2H),2.16-2.00(m,2H),1.97(br d,J=11.5Hz,2H),1.25-1.09(m,2H).

[0384] Example 16

[0385]

[0386] Synthesis route:

[0387]

[0388] Step 1: Synthesis of compound 22-b

[0389] Compound 20-b (75 mg, 163.91 μmol, 1 eq) and compound 22-a (40.21 mg, 245.87 μmol, 1.5 eq) were dissolved in tetrahydrofuran (3 mL) under nitrogen protection. The reaction solution was cooled to 0 °C, and then tri-n-propylcyclic phosphoric anhydride (208.61 mg, 327.82 μmol, 194.97 μL, concentration: 50%, 2 eq) and N,N-diisopropylethylamine (63.55 mg, 491.74 μmol, 85.65 μL, 3 eq) were added. The reaction solution was heated to 50 °C and stirred for 12 hours. The reaction solution was then concentrated directly under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 2 / 1) to obtain compound 22-b.

[0390] MS m / z (ESI): 603.1 [M+1] + .

[0391] Step 2: Synthesis of Compound 22

[0392] Compound 22-b (10 mg, 16.58 μmol, 1 eq) was dissolved in methanol (1 mL) and water (1 mL), and sodium hydroxide (3.32 mg, 82.90 μmol, 5 eq) was added. The mixture was stirred at 25 °C for 2 hours. Water (10 mL) was added to the reaction solution, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. The solution was then extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by preparative high-performance liquid chromatography (p-column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 40%-70%, 7 min) to obtain compound 22.

[0393] MS m / z(ESI): 575.1 [M+1] + .

[0394] 1H NMR (400MHz, CD3OD) δ=7.84(dd,J=8.0,11.8Hz,1H),7.58-7.50(m,2H),6.33(s,1H),5.02(dd,J=3.0,12.0Hz,1H),4.52(dd,J=3.3,12.0Hz,1H),3.00(br d,J=14.1Hz,1H),2.82(s,3H),2.54-2.40(m,2H),2.37-2.27(m,2H),2.23(d,J=7.0Hz,2H),2.16-2.00(m,2H),1.97(br d,J=11.8Hz,2H),1.23-1.09(m,2H).

[0395] Example 17

[0396]

[0397] Synthesis route:

[0398]

[0399] Step 1: Synthesis of compound 23-b

[0400] In a round-bottom flask under nitrogen protection, 23-a (500 mg, 3.12 mmol, 1 eq) and wet palladium on carbon (67.47 mg, 31.23 μmol, 5% purity, 0.01 eq) were added to methanol (50 mL), followed by three purgings with hydrogen. The reaction mixture was stirred at 40 °C for 1 hour under a H2 (25 psi) atmosphere. The reaction mixture was filtered and concentrated under reduced pressure to give compound 23-b.

[0401] MS m / z (ESI): 130.8 [M+1] + .

[0402] 1 H NMR (400MHz, DMSO-d6) δ = 7.28 (t, J = 2.6Hz, 1H), 7.06 (ddd, J = 2.4, 8.6, 11.9Hz, 1H), 5.54 (br s, 2H).

[0403] Step 2: Synthesis of compound 23-c

[0404] 20-b (50 mg, 109.27 μmol, 1 eq), 23-b (17.06 mg, 131.13 μmol, 1.2 eq), tri-n-propyl cyclic phosphoric anhydride (139.08 mg, 218.55 μmol, 50% concentration, 2 eq), and diisopropylethylamine (42.37 mg, 327.82 μmol, 57.10 μL, 3 eq) were added to tetrahydrofuran (5 mL). Under nitrogen protection, the reaction mixture was stirred at 50 °C for 0.5 h. Water (50 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate (30 mL × 2). The combined organic phases were washed successively with water (30 mL) and saturated brine (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 10 / 3) to give compound 23-c.

[0405] MS m / z(ESI): 570.0 [M+1] + .

[0406] Step 3: Synthesis of Compound 23

[0407] Compound 23-c (40 mg, 70.22 μmol, 1 eq) and sodium hydroxide (28.09 mg, 702.19 μmol, 10 eq) were added to methanol (1 mL) and water (1 mL), and the reaction mixture was stirred at 25 °C for 1 hour. The pH of the reaction mixture was adjusted to pH 4–5 with 4 M dilute hydrochloric acid, and water (30 mL) and ethyl acetate (30 mL × 2) were added for extraction. The combined organic phases were washed successively with water (20 mL) and saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by preparative high-performance liquid chromatography (pHPLC) (column type: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 35%–55%, 7 min) to obtain compound 23.

[0408] MS m / z(ESI): 541.9 [M+1] + .

[0409] 1H NMR (400MHz, CD3OD) δ = 8.29 (ddd, J = 2.3, 8.7, 11.2Hz, 1H), 8.21 (t, J = 2.0Hz, 1H), 7.57 (s, 1H), 6.35 (s, 1H), 5.02 (br dd,J=3.0,11.8Hz,1H),4.54(dd,J=3.1,11.7Hz,1H),3.09-2.94(m,1H),2.77(s,3H),2.49-2.20(m,6H),2.19-1.92(m,4H),1.29-1.04(m,2H).

[0410] Example 18

[0411]

[0412] Synthesis route:

[0413]

[0414] Step 1: Synthesis of compound 24-b

[0415] Under nitrogen protection, compound 20-b (75 mg, 163.91 μmol, 1 eq), compound 24-a (31.61 mg, 245.87 μmol, 1.5 eq), diisopropylethylamine (63.55 mg, 491.73 μmol, 85.65 μL, 3 eq), and tetrahydrofuran (3 mL) were added to a thumb flask, followed by tri-n-propylcyclic phosphoric anhydride (208.61 mg, 327.82 μmol, 194.97 μL, 50% concentration, 2 eq). The mixture was stirred at 50 °C for 12 hours. The reaction solution was concentrated under reduced pressure. The residue was separated by an automated COMBI-FLASH column chromatography system (gradient elution: petroleum ether: ethyl acetate = 100:0 to 50:50) to give compound 24-b.

[0416] MS m / z(ESI): 568.0 [M+1] + .

[0417] Step 2: Synthesis of Compound 24

[0418] Compound 24-b (40 mg, 70.41 μmol, 1 eq) and methanol (1 mL) were added to a thumb flask, followed by sodium hydroxide (2 M, 0.5 mL, 14.20 eq). The mixture was stirred at 25 °C for 1 hour. Water (5 mL) was added to the reaction mixture, and the pH was adjusted to 5–6 with 1 M dilute hydrochloric acid. Extraction was performed with ethyl acetate (15 mL × 3). The combined organic phases were washed with saturated brine (30 mL) and concentrated under reduced pressure. The residue was purified by preparative high-performance liquid chromatography (p-column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 40%–70%, 7 min) to obtain compound 24.

[0419] MS m / z(ESI): 540.1 [M+1] + .

[0420] 1 H NMR (400MHz, CD3OD) δ = 8.72 (br s, 1H), 8.41-8.23 (m, 2H), 7.57 (s, 1H), 6.35 (s, 1H), 5.02 (br d,J=8.8Hz,1H),4.56(dd,J=3.0,11.8Hz,1H),3.11-2.94(m,1H),2.78(s,3H),2.50-2.3 8(m,2H),2.37-2.28(m,2H),2.25(d,J=7.0Hz,2H),2.17-1.95(m,4H),1.27-1.06(m,2H).

[0421] Example 19

[0422]

[0423] Synthesis route:

[0424]

[0425] Step 1: Synthesis of compound 25-b

[0426] Under nitrogen protection, compound 20-b (50 mg, 109.27 μmol, 1 eq), compound 25-a (21.07 mg, 163.91 μmol, 1.5 eq), and dichloromethane (1.5 mL) were added to a thumb flask, followed by pyridine (43.22 mg, 546.37 μmol, 44.10 μL, 5 eq) and phosphorus oxychloride (20.11 mg, 131.13 μmol, 12.19 μL, 1.2 eq). The mixture was stirred at 20 °C for 1 hour. The reaction solution was concentrated under reduced pressure to obtain crude compound 25-b.

[0427] MS m / z(ESI): 568.1 [M+1] + .

[0428] Step 2: Synthesis of Compound 25

[0429] Compound 25-b (100 mg, 176.02 μmol, 1 eq) and methanol (2 mL) were added to a thumb flask, followed by sodium hydroxide aqueous solution (2 M, 1 mL, 11.36 eq). The mixture was stirred at 25 °C for 1 hour. Water (5 mL) was added to the reaction mixture, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. Extraction was performed with ethyl acetate (15 mL × 3). The combined organic phases were washed with saturated brine (30 mL) and concentrated under reduced pressure. The residue was separated by preparative high-performance liquid chromatography (HPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 30%-60%, 7 min) to obtain compound 25.

[0430] MS m / z (ESI): 540.2 [M+1] + .

[0431] 1 H NMR (400MHz, CD3OD) δ = 8.26 (d, J = 5.5Hz, 1H), 7.89 (d, J = 1.8Hz, 1H), 7.63 (dd, J = 1.8, 5.8Hz, 1H) ,7.57(s,1H),6.35(s,1H),5.01(dd,J=3.8,11.5Hz,1H),4.58(dd,J=3.5,11.5Hz,1H),3.02(br d,J=13.6Hz,1H),2.75(s,3H),2.47-2.29(m,4H),2.25(d,J=6.8Hz,2H),2.17-2.02(m,2H),1.98(br d,J=12.0Hz,2H),1.31-1.02(m,2H).

[0432] Example 20

[0433]

[0434] Synthesis route:

[0435]

[0436] Step 1: Synthesis of compound 26-b

[0437] Compound 20-b (50 mg, 109.27 μmol, 1 eq) and compound 26-a (22.31 mg, 163.91 μmol, 1.5 eq) were dissolved in tetrahydrofuran (2 mL) under nitrogen protection. The reaction solution was cooled to 0 °C, and then tri-n-propyl cyclic phosphoric anhydride (139.08 mg, 218.55 μmol, 129.98 μL, 50% purity, 2 eq) and N,N-diisopropylethylamine (42.37 mg, 327.82 μmol, 57.10 μL, 3 eq) were slowly added. The reaction solution was then heated to 50 °C and stirred for 12 hours. The reaction solution was directly concentrated under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 2 / 1) to obtain compound 26-b.

[0438] MS m / z(ESI): 576.1 [M+1] + .

[0439] Step 2: Synthesis of Compound 26

[0440] Compound 26-b (20 mg, 34.74 μmol, 1 eq) was dissolved in methanol (1 mL) and water (1 mL), and sodium hydroxide (6.95 mg, 173.71 μmol, 5 eq) was added. The reaction mixture was stirred at 25 °C for 2 hours. Water (10 mL) was added to the reaction mixture, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. The mixture was then extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was separated by preparative high-performance liquid chromatography (pHPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 35%-65%, 7 min) to obtain compound 26.

[0441] MS m / z (ESI): 548.2 [M+1] + .

[0442] 1H NMR (400MHz, CD3OD) δ = 7.89-7.83 (m, 2H), 7.55 (s, 1H), 7.34-7.28 (m, 1H), 6.3 3(s,1H),5.00(dd,J=3.6,11.7Hz,1H),4.52(dd,J=3.4,11.7Hz,1H),3.00(br d,J=14.6Hz,1H),2.75(s,3H),2.44-2.36(m,2H),2.34-2.25(m,2H),2.22(d,J=7.0Hz,2H),2.15-2.03(m,2H),1.97(br d,J=12.5Hz,2H),1.21-1.10(m,2H).

[0443] Example 21

[0444]

[0445] Synthesis route:

[0446]

[0447] Step 1: Synthesis of compound 27-b

[0448] In a round-bottom flask, compounds 20-b (60 mg, 131.13 μmol, 1 eq), 27-a (24.01 mg, 157.36 μmol, 1.2 eq), tri-n-propyl cyclic phosphoric anhydride (166.89 mg, 262.26 μmol, 50% purity, 2 eq), and diisopropylethylamine (50.84 mg, 393.39 μmol, 68.52 μL, 3 eq) were added to tetrahydrofuran (6 mL). The reaction mixture was stirred at 50 °C for 0.5 h. Water (50 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate (30 mL × 2). The organic phases were combined and washed successively with water (30 mL) and saturated brine (30 mL). The mixture was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 10 / 3) to give compound 27-b.

[0449] MS m / z(ESI): 591.9 [M+1] + .

[0450] Step 2: Synthesis of Compound 27

[0451] Compound 27-b (40 mg, 67.55 μmol, 1 eq) and sodium hydroxide (27.02 mg, 675.53 μmol, 10 eq) were added to methanol (1 mL) and water (1 mL), and the reaction mixture was stirred at 25 °C for 1 hour. The pH of the reaction mixture was adjusted to 4–5 with 4 M hydrochloric acid, and water (30 mL) was added. The mixture was extracted with ethyl acetate (30 mL × 2). The combined organic phases were washed successively with water (20 mL) and saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by preparative high-performance liquid chromatography (pHPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 45%–65%, 7 min) to obtain compound 27.

[0452] MS m / z(ESI): 564.0 [M+1] + .

[0453] 1 H NMR (400MHz, CD3OD) δ=8.18-7.87(m,2H),7.69-7.40(m,2H),6.35(s,1H),5.02(dd,J=3.4,11.7Hz,1H),4.54(d d,J=3.4,11.7Hz,1H),3.15-2.90(m,1H),2.77(s,3H),2.55-2.20(m,6H),2.15-1.88(m,4H),1.26-1.06(m,2H).

[0454] Example 22

[0455]

[0456] Synthesis route:

[0457]

[0458] Step 1: Synthesis of compound 28-b

[0459] Compound 28-a (500.00 mg, 2.37 mmol, 1 eq) was dissolved in tert-butanol (10 mL), followed by the addition of diphenyl azidophosphate (784.28 mg, 2.85 mmol, 617.54 μL, 1.2 eq) and triethylamine (288.37 mg, 2.85 mmol, 396.66 μL, 1.2 eq). The reaction mixture was then heated to 90 °C and stirred for 6 hours. Water (15 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate (15 mL × 3). The combined organic phases were washed with saturated brine (15 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 2 / 1) to give compound 28-b.

[0460] 1 H NMR (400MHz, CDCl3) δ = 8.04 (br d, J = 11.5Hz, 1H), 6.73-6.56 (m, 1H), 1.54 (s, 9H)

[0461] Step 2: Synthesis of compound 28-c

[0462] Compound 28-b (400.00 mg, 1.42 mmol, 1 eq) was dissolved in dichloromethane (2 mL), and then trifluoroacetic acid (2 mL) was added. The reaction mixture was stirred at 25 °C for 0.5 hours. The reaction mixture was then concentrated under reduced pressure to obtain crude compound 28-c.

[0463] 1 H NMR (400MHz, CDCl3) δ = 6.54 (td, J = 7.6, 11.2Hz, 1H), 3.75 (br s, 2H).

[0464] Step 3: Synthesis of compound 28-d

[0465] Under nitrogen protection, compound 20-b (50 mg, 109.27 μmol, 1 eq) and compound 28-c (29.76 mg, 163.91 μmol, 1.5 eq) were dissolved in tetrahydrofuran (2 mL). The reaction solution was cooled to 0 °C, and then tri-n-propyl cyclic phosphoric anhydride (139.08 mg, 218.54 μmol, 50% purity, 2 eq) and N,N-diisopropylethylamine (42.37 mg, 327.81 μmol, 57.10 μL, 3 eq) were slowly added. The reaction solution was heated to 50 °C and stirred for 12 hours. The reaction solution was then concentrated directly under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 2 / 1) to give compound 28-d. MS m / z (ESI): 621.1 [M+1] + .

[0466] Step 4: Synthesis of Compound 28

[0467] Compound 28-d (20.00 mg, 32.20 μmol, 1 eq) was dissolved in methanol (1 mL) and water (1 mL), and sodium hydroxide (6.44 mg, 161.01 μmol, 5 eq) was added. The reaction mixture was stirred at 25 °C for 2 hours. Water (10 mL) was added to the reaction mixture, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. The mixture was then extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was separated by preparative high-performance liquid chromatography (pHPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 40%-70%, 7 min) to obtain compound 28.

[0468] MS m / z(ESI): 593.1 [M+1] + .

[0469] 1 H NMR (400MHz, CD3OD) δ=7.92-7.85(m,1H),7.55(s,1H),6.33(s,1H),5.01(brd,J=8.5Hz,1H),4.55-4.50(m,1H),3.00(br d,J=13.3Hz,1H),2.78(s,3H),2.45-2.39(m,2H),2.35-2.26(m,2H),2.22(d,J=7.0Hz,2H),2.15-2.03(m,2H),1.96(br d,J=12.0Hz,2H),1.15(br d,J=12.5Hz,2H).

[0470] Example 23

[0471]

[0472] Synthesis route:

[0473]

[0474] Step 1: Synthesis of compound 29-a

[0475] In a round-bottom flask, 20-b (70 mg, 152.98 μmol, 1 eq), 3-chloro-4-fluoroaniline (26.72 mg, 183.58 μmol, 1.2 eq), tri-n-propylcyclophosphine (194.71 mg, 305.97 μmol, 181.97 μL, 50% concentration, 2 eq), and diisopropylethylamine (79.09 mg, 611.94 μmol, 106.59 μL, 4 eq) were added to tetrahydrofuran (5 mL). The reaction mixture was stirred at 50 °C for 1 hour under nitrogen protection. Water (50 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate (30 mL × 2). The combined organic phases were washed successively with water (30 mL) and saturated brine (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 10 / 3) to give compound 29-a.

[0476] MS m / z(ESI): 585.1 [M+1] + .

[0477] Step 2: Synthesis of Compound 29

[0478] Compound 29-a (50 mg, 85.45 μmol, 1 eq) and sodium hydroxide (17.09 mg, 427.27 μmol, 5 eq) were added to methanol (0.5 mL) and water (0.5 mL), and the reaction mixture was stirred at 25 °C for 60 min. The pH of the reaction mixture was adjusted to 4–5 with 4 M dilute hydrochloric acid, and water (30 mL) was added, followed by extraction with ethyl acetate (30 mL × 2). The combined organic phases were washed successively with water (20 mL) and saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by preparative high-performance liquid chromatography (pHPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 40%–70%, 7 min) to obtain compound 29.

[0479] MS m / z(ESI): 556.8 [M+1] + .

[0480] 1H NMR (400MHz, CD3OD) δ=7.91(dd,J=2.6,6.7Hz,1H),7.58-7.49(m,2H),7.23(t,J=8.9Hz,1H),6.35(s,1H),5.02(dd,J=3.3,11.8 Hz,1H),4.44(dd,J=3.3,11.8Hz,1H),3.11-2.91(m,1H),2.77(s,3H),2.51-2.19(m,6H),2.19-1.92(m,4H),1.29-1.01(m,2H).

[0481] Step 3: Synthesis of compounds 30 and 31

[0482] Compound 29 (20 mg, 35.90 μmol) was separated by SFC (column type: DAICEL CHIRALCEL OJ (250 mm * 30 mm, 10 μm); mobile phase: [0.1% NH3H2O, MeOH]%: 40%-40%) to obtain compounds 30 and 31.

[0483] SFC analysis method: Column type: ChiralCel OJ-H 150×4.6mm ID, 5μm; Mobile phase: Methanol (0.05% diethylamine); Flow rate: 2.5mL / min.

[0484] Compound 30: MS m / z (ESI): 556.9 [M+1] + SFC retention time: 7.427 minutes.

[0485] 1H NMR (400MHz, CD3OD) δ = 7.91 (dd, J = 2.6, 6.7Hz, 1H), 7.68-7.44 (m, 2H), 7.24 (t, J = 8.9Hz, 1H), 6.35 (s, 1H), 5.02 (dd, J = 3.4, 11.7Hz, 1H), 4. 44(dd,J=3.3,11.8Hz,1H),3.07-2.93(m,1H),2.77(s,3H),2.51-2.26(m,4H),2.22(d,J=7.0Hz,2H),2.16-1.93(m,4H),1.28-1.08(m,2H).

[0486] Compound 31: MS m / z (ESI): 556.9 [M+1] + SFC retention time: 7.808 minutes.

[0487] 1H NMR (400MHz, CD3OD) δ = 7.91 (dd, J = 2.6, 6.7Hz, 1H), 7.69-7.47 (m, 2H), 7.24 (t, J = 9.0Hz, 1H), 6.35 (s, 1H), 5.10 -4.95(m,1H),4.44(dd,J=3.0,11.5Hz,1H),3.02(brd,J=14.1Hz,1H),2.77(s,3H),2.52-2.26(m,4H),2.22(br d,J=6.8Hz,2H),2.17-1.93(m,4H),1.27-1.08(m,2H).

[0488] Example 24

[0489]

[0490] Synthesis route:

[0491]

[0492] Step 1: Synthesis of compound 32-a

[0493] Compound 20-b (50 mg, 109.27 μmol, 1 eq) and compound 15-c (22.73 mg, 109.27 μmol, 1 eq) were dissolved in tetrahydrofuran (2 mL) under nitrogen protection. The reaction solution was cooled to 0 °C, and then tri-n-propyl cyclic phosphoric anhydride (139.08 mg, 218.55 μmol, 129.98 μL, concentration: 50%, 2 eq) and N,N-diisopropylethylamine (42.37 mg, 327.82 μmol, 57.10 μL, 3 eq) were slowly added. The reaction solution was then heated to 50 °C and stirred for 12 hours. The reaction solution was directly concentrated under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 2 / 1) to give compound 32-a.

[0494] MS m / z(ESI): 647.0 [M+1] + .

[0495] Step 2: Synthesis of Compound 32

[0496] Compound 32-a (40 mg, 61.77 μmol, 1 eq) was dissolved in methanol (1 mL) and water (1 mL), and sodium hydroxide (12.35 mg, 308.86 μmol, 5 eq) was added. The reaction mixture was stirred at 25 °C for 2 hours. Water (10 mL) was added to the reaction mixture, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. The mixture was then extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was separated by preparative high-performance liquid chromatography (pHPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 40%-70%, 7 min) to obtain compound 32.

[0497] MS m / z(ESI): 618.9 [M+1] + .

[0498] Step 3: Synthesis of compounds 33 and 34

[0499] Compound 32 (25 mg, 40.36 μmol, 1 eq) was purified by SFC (column type: DAICEL CHIRALPAK AS (250 mm * 30 mm, 10 μm); mobile phase: [0.1% NH3H2O, EtOH]%: 35%-35%) to obtain compounds 33 and 34.

[0500] SFC analysis method: Column type: ChiralPak AS-3 150×4.6mm ID, 3μm; Mobile phase: Isopropanol (0.05% diethylamine); Flow rate:

[0501] 2.5 mL / min.

[0502] Compound 33: MS m / z (ESI): 619.0 [M+1] + SFC retention time: 5.872 minutes, ee% = 92.5%.

[0503] 1H NMR (400MHz, CD3OD) δ=7.80-7.66(m,2H),7.55(s,1H),6.33(s,1H),4.99(dd,J=3.4,11.7Hz,1H),4.46(dd,J=3.5,11.8Hz,1H),3.00(br d,J=13.1Hz,1H),2.74(s,3H),2.45-2.27(m,4H),2.26-2.18(m,2H),2.15-2.00(m,2H),1.97(br d,J=11.5Hz,2H),1.22-1.10(m,2H).

[0504] Compound 34: MS m / z (ESI): 619.0 [M+1] + SFC analysis method (column type: Chiralpak AD-3 150*4.6mm ID, 3μm; mobile phase: isopropanol (0.05% diethylamine); flow rate: 2.5mL / min), retention time: 6.150 min, ee% = 84.8%.

[0505] 1 H NMR (400MHz, CD3OD) δ=7.79-7.65(m,2H),7.55(s,1H),6.33(s,1H),4.99(dd,J=3.4,11.7Hz,1H),4.46(dd,J=3.5,11.8Hz,1H),3.00(br d,J=13.8Hz,1H),2.74(s,3H),2.45-2.27(m,4H),2.22(d,J=6.8Hz,2H),2.15-2.00(m,2H),1.99-1.93(m,2H),1.21-1.09(m,2H).

[0506] Example 25

[0507]

[0508] Synthesis route:

[0509]

[0510] Step 1: Synthesis of compound 35-a

[0511] Compound 20-b (325 mg, 710.28 μmol, 1 eq) and compound 17-a (174.25 mg, 1.07 mmol, 1.5 eq) were dissolved in dichloromethane (15 mL) under nitrogen protection. The reaction solution was cooled to 0 °C, and then phosphorus oxychloride (163.36 mg, 1.07 mmol, 99.01 μL, 1.5 eq) and pyridine (280.92 mg, 3.55 mmol, 286.65 μL, 5 eq) were slowly added. The reaction solution was stirred at 0 °C for 1 hour. The reaction solution was then concentrated directly under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 2 / 1) to give compound 35-a.

[0512] MS m / z (ESI): 603.1 [M+1] + .

[0513] Step 2: Synthesis of compounds 35-b and 35-c

[0514] Compound 35-a (220 mg, 364.78 μmol, 1 eq) was separated by SFC (column type: DAICEL CHIRALCEL OJ (250 mm * 30 mm, 10 μm); mobile phase: [0.1% NH3H2O, EtOH]% = 40%-40%) to obtain compounds 35-b and 35-c.

[0515] Compound 35-b: SFC analysis (column: ChiralCel OJ-H 150×4.6mm ID, 5µm; mobile phase: ethanol (0.05% diethylamine); flow rate: 2.5mL / min); MS m / z (ESI): 603.1 [M+1] + SFC retention time: 5.635 minutes, ee% = 100%.

[0516] Compound 35-b: MS m / z (ESI): 603.1 [M+1] + SFC retention time: 6.192 minutes, ee% = 98.8%.

[0517] Step 3: Synthesis of Compound 35

[0518] Compound 35-b (90 mg, 149.23 μmol, 1 eq) was dissolved in methanol (3 mL) and water (3 mL), and sodium hydroxide (29.84 mg, 746.14 μmol, 5 eq) was added. The reaction mixture was stirred at 25 °C for 2 hours. Water (10 mL) was added to the reaction mixture, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. The mixture was then extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by preparative high-performance liquid chromatography (pHPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 40%-70%, 7 min) to obtain compound 35.

[0519] SFC analysis method: Column type: ChiralCel OJ-H 150×4.6mm ID, 5μm; Mobile phase: Ethanol (0.05% diethylamine); Flow rate: 2.5mL / min; MS m / z (ESI): 575.1 [M+1] + SFC retention time: 5.950 minutes, ee% = 98.3%.

[0520] 1 H NMR (400MHz, CD3OD) δ = 7.68 (dt, J = 5.8, 8.7Hz, 1H), 7.55 (s, 1H), 7.15 (dt, J = 2.3, 8.9Hz ,1H),6.34(s,1H),5.02(dd,J=3.1,12.2Hz,1H),4.51(dd,J=3.0,12.0Hz,1H),3.00(br d,J=13.6Hz,1H),2.80(s,3H),2.47-2.40(m,2H),2.37-2.27(m,2H),2.22(d,J=7.0Hz,2H),2.16-2.01(m,2H),1.97(br d,J=12.3Hz,2H),1.23-1.09(m,2H).

[0521] Step 4: Synthesis of Compound 36

[0522] Compound 35-c (100 mg, 165.81 μmol, 1 eq) and methanol (2 mL) were added to a thumb flask, followed by 2 M sodium hydroxide aqueous solution (1 mL, 12.06 eq). The mixture was stirred at 25 °C for 30 min. The reaction solution was adjusted to pH 1–2 with 1 M dilute hydrochloric acid and extracted with ethyl acetate (15 mL × 3). The combined organic phases were washed with saturated brine (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was separated by preparative high-performance liquid chromatography (HPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 35%–65%, 7 min). Compound 36 was obtained.

[0523] MS m / z(ESI): 575.1 [M+1] + SFC retention time: 6.251 minutes, ee% = 100%.

[0524] 1 H NMR (400MHz, CD3OD) δ = 7.74-7.65 (m, 1H), 7.57 (s, 1H), 7.17 (dt, J = 2.0, 8.9Hz, 1H) ,6.35(s,1H),5.04(dd,J=3.3,12.0Hz,1H),4.53(dd,J=3.0,12.0Hz,1H),3.02(br d,J=14.8Hz,1H),2.82(s,3H),2.51-2.40(m,2H),2.39-2.29(m,2H),2.24(d,J=6.8Hz,2H),2.18-1.94(m,4H),1.28-1.04(m,2H).

[0525] Example 26

[0526]

[0527] Synthesis route:

[0528]

[0529] Step 1: Synthesis of compound 37-a

[0530] Compound 20-b (45 mg, 98.35 μmol, 1 eq) and compound 18-a (30.68 mg, 147.52 μmol, 1.5 eq) were dissolved in tetrahydrofuran (2 mL) under nitrogen protection. The reaction solution was cooled to 0 °C, and then tri-n-propyl cyclic phosphoric anhydride (125.17 mg, 196.69 μmol, 116.98 μL, concentration: 50%, 2 eq) and N,N-diisopropylethylamine (38.13 mg, 295.04 μmol, 51.39 μL, 3 eq) were added. The reaction solution was heated to 50 °C and stirred for 12 hours. The reaction solution was then concentrated directly under reduced pressure. The crude product was purified by rapid column chromatography (petroleum ether / ethyl acetate = 1 / 0 to 2 / 1) to give compound 37-a.

[0531] MS m / z (ESI): 647.1 [M+1] + .

[0532] Step 2: Synthesis of Compound 37

[0533] Compound 37-a (20 mg, 30.89 μmol, 1 eq) was dissolved in methanol (1 mL) and water (1 mL), and sodium hydroxide (6.18 mg, 154.43 μmol, 5 eq) was added. The reaction mixture was stirred at 25 °C for 2 hours. Water (10 mL) was added to the reaction mixture, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. The mixture was then extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by preparative high-performance liquid chromatography (pHPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 40%-70%, 7 min) to obtain compound 37.

[0534] MS m / z(ESI): 618.8 [M+1] + .

[0535] 1 H NMR (400MHz, DMSO-d6) δ=7.71-7.60(m,2H),7.37-7.23(m,1H),6.37(s,1H),4.91(br d,J=10.0Hz,1H),4.44(dd,J=2.5,12.0Hz,1H),2.87(br d,J=14.1Hz,1H),2.66(s,3H),2.42-2.33(m,2H),2.26-2.12(m,4H),2.09-1.84(m,4H),1.17-1.05(m,1H).

[0536] Example 27

[0537]

[0538] Synthesis route:

[0539]

[0540] Step 1: Synthesis of compound 38-a

[0541] Compound 20-a (0.3 g, 842.18 μmol, 1 eq), compound 1-o (371.65 mg, 1.26 mmol, 1.5 eq), N,N-diisopropylethylamine (544.22 mg, 4.21 mmol, 733.45 μL, 5 eq), and dichlorobis(triphenylphosphine)palladium (59.11 mg, 84.22 μmol, 0.1 eq) were dissolved in 1,4-dioxane (4 mL) and water (4 mL) under nitrogen protection. The mixture was heated to 80 °C and stirred for 12 hours. Water (10 mL) was added to the reaction mixture, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. The mixture was then extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain compound 38-a. The crude product was used directly in the next reaction.

[0542] MS m / z(ESI): 444.1 [M+1] + .

[0543] Step 2: Synthesis of compound 38-b

[0544] Compound 38-a (100 mg, 225.46 μmol, 1 eq) and compound 17-a (55.31 mg, 338.19 μmol, 1.5 eq) were dissolved in dichloromethane (3 mL). The reaction solution was cooled to 0 °C, and phosphorus oxychloride (69.14 mg, 450.92 μmol, 41.90 μL, 2 eq) and pyridine (89.17 mg, 1.13 mmol, 90.99 μL, 5 eq) were slowly added. The mixture was stirred at 0 °C for 1 hour. The reaction solution was concentrated under reduced pressure to obtain crude compound 38-b.

[0545] MS m / z(ESI): 589.1 [M+1] + .

[0546] Step 3: Synthesis of Compound 38

[0547] Compound 38-b (30 mg, 50.93 μmol, 1 eq) was dissolved in methanol (1 mL) and water (1 mL), and sodium hydroxide (10.19 mg, 254.65 μmol, 5 eq) was added. The mixture was stirred at 25 °C for 2 hours. Water (10 mL) was added to the reaction solution, and the pH was adjusted to 1-2 with 1 M dilute hydrochloric acid. The solution was then extracted with ethyl acetate (10 mL × 3). The combined organic phases were washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was separated by preparative high-performance liquid chromatography (pHPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 40%-70%, 7 min) to obtain compound 38.

[0548] MS m / z(ESI): 561.1 [M+1] + .

[0549] 1H NMR (400MHz, CD3OD) δ = 7.68 (ddd, J = 5.6, 8.2, 9.2Hz, 1H), 7.57 (s, 1H), 7.15 (dt, J = 2.0, 8. 9Hz,1H),6.37(s,1H),5.02(dd,J=3.0,12.0Hz,1H),4.51(dd,J=3.0,12.0Hz,1H),2.96(br d,J=13.8Hz,1H),2.83-2.76(m,3H),2.63-2.52(m,1H),2.45(td,J=3.4 ,13.9Hz,2H),2.37-2.17(m,3H),2.12-2.04(m,2H),1.70-1.54(m,2H).

[0550] Example 28

[0551]

[0552] Synthesis route:

[0553]

[0554] Step 1: Synthesis of compound 39-a

[0555] Under nitrogen protection, compounds 20-b (50 mg, 109.27 μmol, 1 eq), 16-a (24.11 mg, 163.91 μmol, 17.35 μL, 1.5 eq), and dichloromethane (1.5 mL) were added to a thumb flask, followed by pyridine (43.22 mg, 546.37 μmol, 44.10 μL, 5 eq) and phosphorus oxychloride (20.11 mg, 131.13 μmol, 12.19 μL, 1.2 eq). The mixture was stirred at 0 °C for 1 hour. The reaction solution was concentrated under reduced pressure to give crude compound 39-a.

[0556] MS m / z(ESI): 587.1 [M+1] + .

[0557] Step 2: Synthesis of Compound 39

[0558] Compound 39-a (60 mg, 102.28 μmol, 1 eq) and methanol (1 mL) were added to a thumb flask, followed by sodium hydroxide (2 M, 0.5 mL, 9.78 eq). The mixture was stirred at 25 °C for 1 hour. The reaction solution was adjusted to pH 1–2 with 1 M dilute hydrochloric acid and extracted with ethyl acetate (15 mL × 3). The combined organic phases were washed with saturated brine (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was separated by preparative high-performance liquid chromatography (pHPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 35%–65%, 7 min) to obtain compound 39.

[0559] MS m / z(ESI): 559.1 [M+1] + .

[0560] 1 H NMR (400MHz, CD3OD) δ = 7.56 (s, 1H), 7.54-7.47 (m, 1H), 7.22-7.09 (m, 1H), 6.3 5(s,1H),5.03(dd,J=3.1,11.9Hz,1H),4.53(dd,J=3.0,12.0Hz,1H),3.02(br d,J=14.1Hz,1H),2.81(s,3H),2.51-2.40(m,2H),2.38-2.28(m,2H),2.24(d,J=7.0Hz,2H),2.17-1.95(m,4H),1.29-1.07(m,2H).

[0561] Step 3: Synthesis of compounds 40 and 41

[0562] Compound 39 (25 mg, 44.76 μmol, 1 eq) was separated by a chiral SFC (column type: DAICEL CHIRALCEL OJ-H (250 mm * 30 mm, 5 μm); mobile phase: [0.1% NH3H2O, MeOH]%: 40%-40%) to obtain compounds 40 and 41.

[0563] SFC analysis method: Column type: Chiralcel OJ-3 150*4.6mm ID, 3μm; Mobile phase: Methanol (0.05% diethylamine); Flow rate: 2.5mL / min.

[0564] Compound 40: MS m / z (ESI): 558.9 [M+1] + SFC retention time: 1.864 minutes, ee% = 96.2%.

[0565] 1 H NMR (400MHz, CD3OD) δ = 7.57 (s, 1H), 7.54-7.47 (m, 1H), 7.21-7.12 (m, 1H), 6.3 5(s,1H),5.04(dd,J=3.1,11.9Hz,1H),4.53(dd,J=3.0,12.0Hz,1H),3.02(br d,J=13.8Hz,1H),2.81(s,3H),2.49-2.41(m,2H),2.39-2.27(m,2H),2.24(d,J=7.0Hz,2H),2.18-2.03(m,2H),1.99(br d,J=12.8Hz,2H),1.27-1.07(m,2H).

[0566] Compound 41: MS m / z (ESI): 558.9 [M+1] + SFC retention time: 2.307 minutes, ee% = 80.5%.

[0567] 1H NMR (400MHz, CD3OD) δ = 7.56 (s, 1H), 7.55-7.47 (m, 1H), 7.22-7.12 (m, 1H), 6.3 5(s,1H),5.04(dd,J=3.1,11.9Hz,1H),4.53(dd,J=3.0,12.0Hz,1H),3.02(br d,J=13.3Hz,1H),2.81(s,3H),2.50-2.40(m,2H),2.39-2.27(m,2H),2.22(br d,J=7.0Hz,2H),2.17-2.02(m,2H),1.99(br d,J=11.8Hz,2H),1.24-1.10(m,2H)

[0568] Example 29

[0569]

[0570] Synthesis route:

[0571]

[0572] Step 1: Synthesis of compound 42-a

[0573] Under nitrogen protection, compound 20-b (50 mg, 109.27 μmol, 1 eq), 2-fluoro-3-chloroaniline (23.86 mg, 163.91 μmol, 26.02 μL, 1.5 eq), and dichloromethane (1.5 mL) were added to a thumb flask, followed by pyridine (43.22 mg, 546.37 μmol, 44.10 μL, 5 eq) and phosphorus oxychloride (20.11 mg, 131.13 μmol, 12.19 μL, 1.2 eq). The mixture was stirred at 0 °C for 1 hour. The reaction solution was concentrated under reduced pressure to give compound 42-a.

[0574] MS m / z(ESI): 585.1 [M+1] + .

[0575] Step 2: Synthesis of Compound 42

[0576] Compound 42-a (60 mg, 102.54 μmol, 1 eq) and methanol (1 mL) were added to a thumb flask, followed by sodium hydroxide (2 M, 0.5 mL, 9.75 eq). The mixture was stirred at 25 °C for 1 hour. The reaction solution was adjusted to pH 1–2 with 1 M dilute hydrochloric acid and extracted with ethyl acetate (15 mL × 3). The combined organic phases were washed with saturated brine (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was separated by preparative high-performance liquid chromatography (pHPLC) (column: Phenomenex Gemini-NX C18 75*30 mm*3 μm; mobile phase: [water (0.225% formic acid)-acetonitrile]; acetonitrile %: 35%–65%, 7 min) to obtain compound 42.

[0577] MS m / z(ESI): 557.0 [M+1] + .

[0578] 1 H NMR (400MHz, CD3OD) δ = 7.75 (ddd, J = 1.6, 6.8, 8.2Hz, 1H), 7.57 (s, 1H), 7.35 (ddd, J = 1.5, 6.8, 8.3Hz, 1H), 7. 19(dt,J=1.6,8.2Hz,1H),6.35(s,1H),5.04(dd,J=3.0,12.0Hz,1H),4.53(dd,J=3.0,12.0Hz,1H),3.02(br d,J=13.6Hz,1H),2.82(s,3H),2.53-2.29(m,4H),2.25(d,J=6.8Hz,2H),2.18-1.96(m,4H),1.27-1.07(m,2H).

[0579] Step 3: Synthesis of compounds 43 and 44

[0580] Compound 42 (25 mg, 44.88 μmol, 1 eq) was separated by SFC (column type: DAICEL CHIRALCEL OJ (250 mm * 30 mm, 10 μm); mobile phase: [0.1% NH3H2O, MeOH]%: 40%-40%) to obtain compounds 43 and 44.

[0581] SFC analysis method: Column type: Chiralcel OJ-3 150*4.6mm ID, 3μm; Mobile phase: Methanol (0.05% diethylamine); Flow rate: 2.5mL / min.

[0582] Compound 43: MS m / z (ESI): 556.9 [M+1] +SFC retention time: 3.996 minutes, ee% = 98.3%.

[0583] 1 H NMR (400MHz, CD3OD) δ=7.69-7.60(m,1H),7.45(s,1H),7.23(dt,J=1.5,7.4Hz,1H),7.07(dt,J=1 .6,8.2Hz,1H),6.23(s,1H),4.92(dd,J=3.3,12.0Hz,1H),4.41(dd,J=3.0,12.0Hz,1H),2.90(br d,J=13.8Hz,1H),2.82(s,3H),2.38-2.16(m,4H),2.12(d,J=7.0Hz,2H),2.05-1.83(m,4H),1.14-0.92(m,2H).

[0584] Compound 44: MS m / z (ESI): 557.0 [M+1] + SFC retention time: 5.221 minutes, ee% = 98.4%.

[0585] 1 H NMR (400MHz, CD3OD) δ=7.75(t,J=7.4Hz,1H),7.56(s,1H),7.35(dt,J=1.4,7.5Hz,1H),7.19(dt,J=1.5,8.2Hz,1H),6.35(s,1H),5.04(br d,J=9.3Hz,1H),4.53(dd,J=2.8,12.0Hz,1H),3.02(br d,J=14.3Hz,1H),2.82(s,3H),2.51-2.39(m,2H),2.39-2.28(m,2H),2.24 (d,J=7.0Hz,2H),2.18-2.08(m,1H),2.05(dt,J=3.5,7.3Hz,1H),1.98(br d,J=12.3Hz,2H),1.26-1.06(m,2H).

[0586] Bioactivity test

[0587] Experimental Example 1: Quantitative qPCR assay for HBV in vitro

[0588] 1. Experimental Objective:

[0589] The HBV DNA content in HepG2.2.15 cells was detected by real-time quantitative qPCR, and the compound's EC50 was used as the basis for determination. 50The value is used as an indicator to evaluate the inhibitory effect of compounds on HBV.

[0590] 2. Experimental Materials:

[0591] 2.1 Cell line: HepG2.2.15 cells

[0592] HepG2.2.15 cell culture medium (DMEM / F12, Invitrogen-11330057; 10% serum, Invitrogen-10099141; 100 units / ml penicillin and 10 μg / ml streptomycin, Invitrogen-15140122; 1% non-essential amino acids, Invitrogen-11140076; 2 mM L-glutamine, Invitrogen-25030081; 300 μg / ml genistein, Invitrogen-10131027).

[0593] 2.2 Reagents:

[0594] Pancreatic enzyme (Invitrogen-25300062)

[0595] DPBS (Hyclone-SH30028.01B)

[0596] DMSO (Sigma-D2650-100ML)

[0597] High-throughput DNA purification kit (QIAamp 96DNA Blood Kit, Qiagen-51162)

[0598] Quantitative FastStart Universal Probe Master (Roche-04914058001)

[0599] 2.3 Consumables and Instruments:

[0600] 96-well cell culture plate (Corning-3599)

[0601] CO2 Incubator (HERA-CELL-240)

[0602] Optical sealing film (ABI-4311971)

[0603] Quantitative PCR 96-well plate (Applied Biosystems-4306737)

[0604] Real-time PCR system (Applied Biosystems-7500)

[0605] 3. Experimental steps and methods:

[0606] 3.1 HepG2.2.15 cells (4 x 10⁻⁶) 4 Cells / well) were transferred to 96-well plates and incubated overnight at 37°C with 5% CO2.

[0607] 3.2 On the second day, the compound was diluted to a total of 8 concentrations, using a 3-fold serial dilution. Different concentrations of the compound were added to the culture wells in duplicate. The final concentration of DMSO in the culture medium was 1%. 1 μM GLS4 was used as a 100% inhibition control; 1% DMSO was used as a 0% inhibition control.

[0608] 3.3 On the fifth day, replace the culture medium with fresh medium containing the compound.

[0609] 3.4 On the eighth day, collect the culture medium from the culture wells and extract DNA using a high-throughput DNA purification kit (Qiagen-51162). Refer to the product instructions for specific steps.

[0610] 3.5 The preparation of the PCR reaction solution is shown in Table 1:

[0611] Table 1. Preparation of PCR reaction solution

[0612]

[0613] Upstream primer sequence: GTGTCTGCGGCGTTTTATCA

[0614] Downstream primer sequence: GACAAACGGGCAACATACCTT

[0615] Probe sequence: 5'+FAM+CCTCTKCATCCTGCTGCTATGCCTCATC+TAMRA-3'

[0616] 3.6 Add 15 μL of reaction mixture to each well of a 96-well PCR plate, and then add 10 μL of sample DNA or HBV DNA standard to each well.

[0617] 3.7 The PCR reaction conditions were: heating at 95°C for 10 minutes; followed by denaturation at 95°C for 15 seconds and extension at 60°C for 1 minute, for a total of 40 cycles.

[0618] 3.8 Data Analysis:

[0619] 3.8.1 Calculate the inhibition percentage: %Inh. = [1 - (DNA copy number in sample - DNA copy number in 1μM GLS4) / (DNA copy number in DMSO control - DNA copy number in 1μM GLS4)] x 100.

[0620] 3.8.2 Calculate EC 50 The 50% inhibitory concentration (EC50) of the compound against HBV was calculated using GraphPad Prism software. 50 )value.

[0621] 4. The experimental results are shown in Table 2:

[0622] Table 2. qPCR detection of EC 50 Test Results

[0623]

[0624]

[0625] Conclusion: The compounds of this invention have a significant inhibitory effect on HBV.

[0626] Experiment Example 2: Hepatotoxicity Test Experiment

[0627] 2.1: PHH Cytotoxicity Assay

[0628] 1. Dilute the compound with DMSO (dimethyl sulfoxide) at 8 wells in a 3-fold serial dilution, double-dilution, and add to a 96-well plate. The compound concentration is 200 times the final test concentration.

[0629] 2. Resuscitate cryopreserved human primary hepatocytes (PHH), count cell density using a cell counter, and adjust cell density to the required level using culture medium.

[0630] 3. Add cells to 96-well plates containing the pre-added compound, with a final DMSO concentration of 0.5% in each well. Wells containing 0.5% DMSO serve as a negative control for non-toxicity, while wells containing cell culture medium serve as a 100% cytotoxicity control. Then, incubate the cell plates at 37°C in a 5% CO2 incubator for 3 days.

[0631] 4. Using the CellTiter-Glo cell viability assay kit, and following the kit instructions, use a Synegy2-BioTek microplate reader to detect the chemiluminescence signal (RLU, relative chemiluminescence unit) in each well of the cell plate.

[0632] 5. Substitute the raw data (RLU) into the formula below to calculate the cell viability (cell viability %) for each well:

[0633] Cell viability % = (RLU) Sample -AverageRLU Mediumcontrol / (AverageRLU Cellcontrol -AverageRLU Mediumcontrol )×100%

[0634] RLU Sample The signal value of the sample well; AverageRLU Cellcontrol Average signal value for cell control wells; AverageRLU Mediumcontrol This represents the average signal value of the control wells in the culture medium.

[0635] 6. Using GraphPad Prism software, nonlinearly fit the cell viability data to plot the dose-response curve and determine the half-maximal cytotoxic concentration (CMC) of the compound. 50 The values ​​are shown in Table 3.

[0636] Table 3. Median cytotoxic concentration (CC) 50 Value test results

[0637] compound <![CDATA[CC 50 (μM)]]> Compound 11 >100

[0638] Conclusion: The cytotoxicity of the compounds of this invention in primary hepatocytes (CC) 50 The value is relatively high.

[0639] 2.2: Huh7 Cytotoxicity Assay

[0640] 1. Dilute the compound with DMSO (dimethyl sulfoxide) at 8 wells in a 3-fold serial dilution, double-dilution, and add to a 96-well plate. The compound concentration is 200 times the final test concentration.

[0641] 2. Rinse the cells once with PBS (phosphate buffer), add 0.25% trypsin and digest in a 37°C, 5% CO2 incubator for about 2-5 minutes. Stop the digestion with cell culture medium and disperse the cells into single cells by pipetting.

[0642] 3. Count the cell density using a cell counter and adjust the cell density to the required level using culture medium.

[0643] 4. Add cells to 96-well plates containing the pre-added compounds, with a final DMSO concentration of 0.5% in each well. Wells containing 0.5% DMSO serve as a negative control for non-toxicity, while wells containing cell culture medium serve as a 100% cytotoxicity control. Then, incubate the cell plates at 37°C in a 5% CO2 incubator for 3 days.

[0644] 5. Using the CellTiter-Glo cell viability assay kit, and following the kit instructions, use a Synegy2-BioTek microplate reader to detect the chemiluminescence signal (RLU, relative chemiluminescence unit) in each well of the cell plate.

[0645] 6. Substitute the raw data (RLU) into the formula below to calculate the cell viability (cell viability %) for each well:

[0646] Cell viability % = (RLU) Sample -AverageRLU Mediumcontrol / (AverageRLU Cellcontrol -AverageRLU Mediumcontrol )×100%

[0647] RLU Sample The signal value of the sample well; AverageRLU Cellcontrol Average signal value for cell control wells; AverageRLU Mediumcontrol This represents the average signal value of the control wells in the culture medium.

[0648] 7. Using GraphPad Prism software, nonlinearly fit the cell viability data to plot the dose-response curve and determine the half-maximal cytotoxic concentration (CMC) of the compound. 50 The values ​​are shown in Table 4.

[0649] Table 4. Median cytotoxic concentration (CC) 50 Value test results

[0650] compound <![CDATA[CC 50 (μM)]]> Compound 11 86.71

[0651] Conclusion: The compound of this invention exhibits cytotoxicity (CC) in Huh7 liver cancer cells. 50 The value is relatively high.

[0652] 2.3: HepG2 Cytotoxicity Assay

[0653] 1. Dilute the compound with DMSO (dimethyl sulfoxide) at 8 wells in a 3-fold serial dilution, double-dilution, and add to a 96-well plate. The compound concentration is 200 times the final test concentration.

[0654] 2. Rinse the cells once with PBS (phosphate buffer), add 0.25% trypsin and digest in a 37°C, 5% CO2 incubator for about 2-5 minutes. Stop the digestion with cell culture medium and disperse the cells into single cells by pipetting.

[0655] 3. Count the cell density using a cell counter and adjust the cell density to the required level using culture medium.

[0656] 4. Add cells to 96-well plates containing the pre-added compounds, with a final DMSO concentration of 0.5% in each well. Wells containing 0.5% DMSO serve as a negative control for non-toxicity, while wells containing cell culture medium serve as a 100% cytotoxicity control. Then, incubate the cell plates at 37°C in a 5% CO2 incubator for 3 days.

[0657] 5. Using the CellTiter-Glo cell viability assay kit, and following the kit instructions, use a Synegy2-BioTek microplate reader to detect the chemiluminescence signal (RLU, relative chemiluminescence unit) in each well of the cell plate.

[0658] 6. Substitute the raw data (RLU) into the formula below to calculate the cell viability (cell viability %) for each well:

[0659] Cell viability % = (RLU) Sample -AverageRLU Mediumcontrol / (AverageRLU Cellcontrol -AverageRLU Mediumcontrol )×100%

[0660] RLU Sample The signal value of the sample well; AverageRLU Cellcontrol Average signal value for cell control wells; AverageRLU Mediumcontrol This represents the average signal value of the control wells in the culture medium.

[0661] 7. Using GraphPad Prism software, nonlinearly fit the cell viability data to plot the dose-response curve and determine the half-maximal cytotoxic concentration (CMC) of the compound. 50 The values ​​are shown in Table 5.

[0662] Table 5. Median cytotoxic concentration (CC) 50 Value test results

[0663] compound <![CDATA[CC 50 (μM)]]> Compound 11 79.35

[0664] Conclusion: The compounds of this invention exhibit cytotoxicity (CC) in HepG2 liver cancer cells. 50 The value is relatively high.

[0665] Experimental Example 3: Pharmacokinetic Study

[0666] Pharmacokinetic studies of the test compounds administered orally and intravenously to Balb / c mice:

[0667] Test compound 11 was mixed with a 10% polyethylene glycol-15-hydroxystearate / 20% polyethylene glycol 400 / 70% aqueous solution, vortexed and sonicated to prepare a clear solution of 0.2 mg / mL, which was then filtered through a microporous membrane for later use. Seven to ten-week-old female Balb / c mice were intravenously administered the candidate compound solution at a dose of 1 mg / kg.

[0668] Test compound 30 was mixed with 10% dimethyl sulfoxide / 10% polyethylene glycol-15-hydroxystearate / 80% aqueous solution, vortexed and sonicated to prepare a clear solution of 0.2 mg / mL, which was then filtered through a microporous membrane for later use. Balb / c female mice aged 7 to 10 weeks were selected and administered the candidate compound solution intravenously at a dose of 1 mg / kg.

[0669] Test compound 36 was mixed with 10% dimethyl sulfoxide / 10% polyethylene glycol-15-hydroxystearate / 80% aqueous solution, vortexed and sonicated to prepare a clear solution of 0.2 mg / mL, which was then filtered through a microporous membrane for later use. Balb / c female mice aged 7 to 10 weeks were selected and administered the candidate compound solution intravenously at a dose of 1 mg / kg.

[0670] Test compounds 11, 30, and 36 were mixed with a 10% aqueous solution of polyethylene glycol-15-hydroxystearate, vortexed, and sonicated to prepare homogeneous suspensions of 1 mg / mL for later use. Seven- to ten-week-old female Balb / c mice were orally administered the candidate compound solutions at a dose of 10 mg / kg.

[0671] Whole blood was collected for a certain period of time to prepare plasma. Drug concentration was analyzed by LC-MS / MS and pharmacokinetic parameters were calculated using Phoenix WinNonlin software (Pharsight, Inc., USA). The results are shown in Table 6.

[0672] Table 6. Pharmacokinetic Results of the Test Compounds

[0673]

[0674]

[0675] Conclusion: The compounds of this invention have high oral bioavailability.

[0676] Experiment Example 4: Study on the liver-to-blood ratio in mice

[0677] Hepatic-to-blood ratio study in Balb / c mice after oral administration of the test compound

[0678] The compound was mixed with a 10% aqueous solution of polyethylene glycol-15-hydroxystearate, vortexed, and sonicated to prepare a homogeneous suspension of 1 mg / mL for later use. Balb / c female mice aged 7 to 10 weeks were orally administered the candidate compound solution at a dose of 10 mg / kg.

[0679] Whole blood was collected over a certain period of time to prepare plasma, and liver tissue was collected over the same period of time to prepare tissue homogenate. Drug concentration was analyzed by LC-MS / MS, and pharmacokinetic parameters were calculated using Phoenix WinNonlin software (Pharsight Pharmaceuticals, USA). The results are shown in Table 7.

[0680] Table 7. Liver-to-blood ratio results of the tested compounds.

[0681]

[0682] Conclusion: The compound of this invention has a relatively high ratio in liver and plasma.

[0683] Experimental Example 5: In vivo drug efficacy study

[0684] HDI / HBV model

[0685] Experimental objective: To detect the efficacy of the compound against hepatitis B virus in mice using an HDI / HBV mouse model.

[0686] Compound preparation: The solvent is 10% polyethylene glycol-15-hydroxystearate; a certain amount of test compounds 11, 30 and 36 are dissolved in 10% polyethylene glycol-15-hydroxystearate aqueous solution, vortexed and sonicated to prepare a homogeneous suspension, which is stored at 4°C for later use.

[0687] High-pressure injection of HBV plasmid DNA solution into the tail vein of mice: Day 0 was designated as the day of plasmid injection, Day 1 as the day after injection, and so on. On Day 0, all animals were injected via the tail vein with a saline solution containing 10 μg of plasmid DNA at 8% of their body weight, and the injection was completed within 5 seconds.

[0688] Administration: All animals were administered the drug twice daily by gavage from day 1 to day 6 (with an interval of 8 / 16 hours), and once daily on day 7. All animals were euthanized on the afternoon of day 7. The weight of the mice was monitored daily, and the weight remained stable throughout the experiment.

[0689] Sample Collection: Plasma was collected from the submandibular vein of all animals four hours after the first administration on the morning of day 5. All blood samples were collected in K2-EDTA anticoagulant tubes and centrifuged at 7000g for 10 minutes at 4°C to prepare approximately 40 μL of plasma. On day 7, all animals were euthanized by CO2 four hours after the morning administration, and blood was collected from the heart using the same method as above. Two liver tissue samples, 70-100 mg each, were collected and flash-frozen in liquid nitrogen. After all samples were collected, they were stored at -80°C until they were sent to the in vitro laboratory of WuXi AppTec Biotechnology Division under dry ice conditions for HBV DNA content detection.

[0690] Sample analysis: All plasma and liver samples were tested for HBV DNA using qPCR.

[0691] Experimental results: The experimental results are shown in Table 8.

[0692] Table 8. Results of HDI efficacy experiments

[0693]

[0694] Note: ΔLog10 copies represents the difference between the viral load in the drug administration group and the viral load in the vehicle group.

[0695] Conclusion: The compounds of this invention significantly reduce HBV DNA in the HDI model.

Claims

1. The compound of formula I-1 or a pharmaceutically acceptable salt thereof: ， in, R1 is selected from halogens; R2 is selected from H, methyl, and F; m is selected from 2, 3, and 4; L2 is selected from methylene.

2. The compound of formula I-1-1 or a pharmaceutically acceptable salt thereof: ， in, R1, R2, L2, and m are as defined in claim 1.

3. The compound described in II-1-1 or a pharmaceutically acceptable salt thereof: ， in, R1, R2, L2, and m are as defined in claim 1.

4. The compound according to any one of claims 1-3 or a pharmaceutically acceptable salt thereof, wherein, Structural unit 。 5. The following compound or its pharmaceutically acceptable salt: 。 6. The compound according to claim 5 or a pharmaceutically acceptable salt thereof, wherein, The compounds are selected from: 。 7. The compound according to claim 6 or a pharmaceutically acceptable salt thereof, wherein, The compounds are selected from: 。 8. The compound according to claim 7 or a pharmaceutically acceptable salt thereof, wherein, The compounds are selected from: 。 9. The use of the compound according to any one of claims 1-8 or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating diseases related to hepatitis B virus infection.

10. The application according to claim 9, wherein the hepatitis B virus infection-related disease is chronic hepatitis B.

Images