Pharmaceutical composition for preventing, alleviating, or treating candidiasis, comprising methoxy-apo-enterobactin-based compound as active ingredient

Abstract

The present invention relates to a pharmaceutical composition for preventing, alleviating, or treating candidiasis, the composition comprising a methoxy-apo-enterobactin-based compound as an active ingredient, wherein the compound is isolated from a strain of the genus Streptomyces (Streptomyces sp.) and was found to have antifungal activity against Candida albicans and an inhibitory effect on ECE1 gene expression as well as the effect of reducing subcutaneous infection in an in vivo candidiasis model, and thus can be effectively used in related industries.

Description

Pharmaceutical composition for the prevention, improvement, or treatment of candidiasis comprising a methoxy-apo-enterobactin-based compound as an active ingredient

[0001] The present invention relates to a pharmaceutical composition for the prevention, improvement, or treatment of candidiasis comprising a methoxy-apo-enterobactin-based compound as an active ingredient.

[0002] Opportunistic fungal pathogens cause more than 300 million serious infections and over 1.5 million deaths worldwide annually, occurring either as a solitary infection or as a complication that exacerbates existing diseases. Fungal infections range from superficial to deeply invasive, and systemic infections can be life-threatening in immunocompromised patients.

[0003] Candidiasis is primarily caused by Candida albicans, and the infection can spread throughout the body beyond the skin and tissues. Candida albicans is classified by the WHO as one of the major priority fungal pathogens. In the absence of disease, Candida albicans exists as part of the normal microflora in the gastrointestinal tract, genitals, mouth, and skin. However, if the immune system is compromised or functions abnormally, Candida albicans, which is generally a harmless commensal, can invade tissues; once it enters the bloodstream, it can spread to various parts of the body, including the cardiovascular system, central nervous system, kidneys, spleen, liver, eyes, and bones. This extensive invasion results in systemic candidiasis.

[0004] One of the key factors in the tissue invasion of Candida albicans is the transition from yeast to hyphae and the subsequent formation of biofilms. This biofilm formation occurs through a series of mechanisms involving Candida cell attachment, hyphae transition, and extracellular matrix secretion.

[0005] Candidalysin is an epithelial damage toxin secreted after hyphal transformation. The ECE1 gene translates the preprotein ECE1, which is secreted after undergoing a two-step post-translational processing step by proteolytic enzymes called Kex2 and Kex1. Through this processing, candidalysin, a peptide composed of 31 amino acids, is secreted.

[0006] Accordingly, the inventors isolated and identified three compounds from Streptomyces ambofaciens CJD34 isolated from soil samples, confirmed their antifungal and ECE1 gene expression inhibitory effects against Candida albicans, and confirmed the effect of reducing subcutaneous infection in vivo in a candidiasis model, thereby completing the present invention.

[0007] The object of the present invention is to provide a compound represented by the following chemical formulas 1 to 3, or a pharmaceutically acceptable salt, hydrate, solvate, derivative, analog, prodrug, or mixture thereof.

[0008] [Chemical Formula 1]

[0009]

[0010] [Chemical Formula 2]

[0011]

[0012] [Chemical Formula 3]

[0013]

[0014] Another objective of the present invention is to provide an antifungal pharmaceutical composition comprising one or more selected from the above compounds as an active ingredient.

[0015] Another objective of the present invention is to provide a pharmaceutical composition for the prevention, improvement, or treatment of candidiasis comprising one or more selected from the above compounds as an active ingredient.

[0016] Another objective of the present invention is to provide a cosmetic composition for preventing or improving candidiasis comprising one or more selected from the above compounds as an active ingredient.

[0017] Another objective of the present invention is to provide a food composition for preventing or improving candidiasis comprising one or more selected from the above compounds as an active ingredient.

[0018] Another object of the present invention is to provide a method for treating candidiasis comprising the step of administering one or more pharmaceutically effective amounts selected from the above compounds to an individual.

[0019] In order to achieve the above objective,

[0020] The present invention provides a compound represented by the following chemical formulas 1 to 3 or a pharmaceutically acceptable salt, hydrate, solvate, derivative, analog, prodrug, or mixture thereof.

[0021] [Chemical Formula 1]

[0022]

[0023] [Chemical Formula 2]

[0024]

[0025] [Chemical Formula 3]

[0026]

[0027] In addition, the present invention provides an antifungal pharmaceutical composition comprising one or more selected from the above compounds as an active ingredient.

[0028] In addition, the present invention provides a pharmaceutical composition for the prevention, improvement, or treatment of candidiasis comprising one or more selected from the above compounds as active ingredients.

[0029] In addition, the present invention provides a cosmetic composition for preventing or improving candidiasis comprising one or more selected from the above compounds as active ingredients.

[0030] In addition, the present invention provides a food composition for preventing or improving candidiasis comprising one or more selected from the above compounds as active ingredients.

[0031] In addition, the present invention provides a method for treating candidiasis comprising the step of administering one or more pharmaceutically effective amounts selected from the above compounds to an individual.

[0032] The methoxy-apo-enterobactin-based compound of the present invention was isolated from a strain of the genus Streptomyces p., and its antifungal and ECE1 gene expression inhibitory effects against Candida albicans were confirmed, as well as its effect of reducing subcutaneous infection in vivo in a candidiasis model, so it can be usefully utilized in related industries.

[0033] Figure 1 shows the stereochemical structure of the compound of the present invention through absolute configuration.

[0034] Figure 2 shows the gene expression of Candida albicans related to the compound of the present invention.

[0035] Figure 3 shows the expression of CDR1 and CDR2 of the compound of the present invention.

[0036] Figure 4 shows the expression of SIT1, SGE13, SGE11 and CR_09830W of the compounds of the present invention.

[0037] Figure 5 shows the predicted molecular docking of a transcription factor regulating ECE1 expression of the compound of the present invention.

[0038] Figure 6 shows the treatment of subcutaneous infection in vivo in a candidiasis model using the compound of the present invention.

[0039] Hereinafter, the present invention will be described in detail with reference to the attached drawings and embodiments thereof. However, the following embodiments are presented as examples of the present invention, and if it is determined that a detailed description of a technology or configuration well known to those skilled in the art may unnecessarily obscure the essence of the present invention, such detailed description may be omitted, and the present invention is not limited by this. The present invention is capable of various modifications and applications within the scope of the claims set forth below and the equivalent scope interpreted therefrom.

[0040] Furthermore, the terminology used in this specification is used to appropriately describe preferred embodiments of the present invention, and may vary depending on the intent of the user or operator, or the conventions of the field to which the present invention belongs. Accordingly, the definitions of these terms should be based on the content throughout this specification. Throughout the specification, when a part is described as “comprising” a certain component, unless specifically stated otherwise, this means that it does not exclude other components but may include additional components.

[0041] The terms used in the present invention are explained below.

[0042] The present invention provides a compound represented by the following chemical formulas 1 to 3 or a pharmaceutically acceptable salt, hydrate, solvate, derivative, analog, prodrug, or mixture thereof.

[0043]

[0044]

[0045]

[0046] The compound represented by Chemical Formula 1 of the present invention may be methoxy-apo-enteriobactin (hereinafter, “Compound 1”).

[0047] The compound represented by Chemical Formula 2 of the present invention may be N-(2,3-dihydroxybenzoyl)-L-serine 3-[2-[(2,3-dihydroxybenzoyl)amino]-2-propenoate] (N-(2,3-dihydroxybenzoyl)-L-serine 3-[2-[(2,3-dihydroxybenzoyl)amino]-2-propenoate]) (hereinafter, “Compound 2”).

[0048] The compound represented by Chemical Formula 3 of the present invention may be N,N',N''-Tris(2,3-dihydroxybenzoyl)-O-(α-aminoacryloyl)-O-serylserine (hereinafter, “Compound 3”).

[0049] The “compound” of the present invention is a pure chemical substance formed by the combination of atoms of two or more types of chemical elements, and can be separated into simpler substances through a chemical reaction.

[0050] Compounds 1 to 3 of the present invention have a structural formula similar to enterobactin, said enterobactin is a highly affinity siderophore that acquires iron for microbial systems, and is represented by the following compounds.

[0051]

[0052] In the present invention, “pharmaceuticalally acceptable” means not significantly stimulating the organism and not inhibiting the biological activity and properties of the administered active substance.

[0053] According to one embodiment of the present invention, the compound may be derived from actinomycetes.

[0054] The “Actinomyces” of the present invention is a general term for bacteria belonging to the phylum Actinobacteria; their bodies are filamentous and branched, and unlike other bacteria, they are similar to fungi because they produce exospores, but their cells are prokaryotic and react positively to Gram staining.

[0055] According to one embodiment of the present invention, the actinomycete may be a strain of the genus Streptomyces sp.

[0056] The genus “Streptomyces p.” of the present invention is the largest genus of actinomycetes and is a type genus of the family Streptomycetaceae. Streptomyces is a Gram-positive bacterium and has a genome with a high GC content. Most streptomyces, which are mainly found in soil and decaying plants, produce spores and are well known for their distinctive earthy smell due to the production of geosmin, a volatile metabolite.

[0057] In addition, the present invention provides an antifungal pharmaceutical composition comprising one or more of the above compounds as active ingredients.

[0058] According to one embodiment of the present invention, the composition may inhibit Candida albicans.

[0059] The “Candida albicans” of the present invention is an opportunistic pathogenic yeast that is a common member of the human gut microbiota and is a type of fungus that grows on the skin, mouth, intestines, and vagina of women as a class of imperfect fungi. It can survive outside the human body and can be found in the gastrointestinal tract and mouth of healthy adults.

[0060] According to one embodiment of the present invention, the composition may inhibit candidalysin.

[0061] The “candidalysin” of the present invention is a protein secreted by Candida fungi that plays a pathological role primarily when causing infection. Candidalysin is a toxin through which Candida fungi interact with host cells or human cells, and it may be involved in inflammatory responses such as the development of candidiasis, cell membrane damage, promotion of inflammatory cytokine secretion, and disruption of the immune system.

[0062] According to one embodiment of the present invention, the composition may inhibit ECE1 gene expression.

[0063] The “ECE1 (Endothelin converting enzyme 1)” of the present invention is an enzyme involved in the production of an important physiological peptide called endothelin, and may be involved in regulating vasoconstriction, blood pressure, inflammatory response, cell growth, etc. ECE1 is an enzyme that converts endothelin precursors (preproendothelin) into active forms of peptides such as endothelin-1 (ET-1), endothelin-2 (ET-2), or endothelin-3 (ET-3), and cleaves endothelin, a large precursor molecule, into small physiologically active peptides.

[0064] Regulating the activity of ECE-1 can be beneficial in the treatment of hypertension and other cardiovascular diseases, and ECE-1 inhibitors can relax vascular tension and regulate blood pressure by reducing excessively high endothelin levels. Some ECE-1 inhibitors are currently under clinical development and may play an important role in the treatment of cardiovascular diseases.

[0065] In addition, the present invention provides a pharmaceutical composition for the prevention, improvement, or treatment of candidiasis comprising one or more of the above compounds as active ingredients.

[0066] The term “prevention” as used in this invention refers to any act of suppressing the symptoms of a specific disease or delaying its progression through the administration of the composition of this invention.

[0067] As used in the present invention, the term “improvement” refers to any action that at least reduces parameters related to the condition being treated, such as the degree of symptoms.

[0068] The term “treatment” as used in this invention refers to any act of improving or beneficially altering the symptoms of a specific disease through the administration of the composition of this invention.

[0069] The "candidiasis" of the present invention is an infectious disease caused by Candida, a type of fungus, infecting one or more parts of the body, exhibiting various symptoms and courses depending on the site of infection. Candida commonly causes infections confined to the superficial layers of the skin or mucous membranes, manifesting symptoms such as thrush, inflammation of the oropharynx or esophagus, vulvitis, vaginitis, and paronychia. If Candida proliferates in the oropharynx or esophagus, it may cause oral discomfort, impaired taste sensation, and pain when chewing or swallowing food. Candidal vulvovaginitis is the most common form of superficial candidiasis, presenting with symptoms such as itching and burning in the vulva, vaginal pain, pain during sexual intercourse, and white, lumpy vaginal discharge. Invasive candidiasis, in which the bacteria spread to various parts of the body via the bloodstream, primarily occurs in patients with neutropenia. In this case, Candida can invade various organs such as the kidneys, heart, liver, brain, and eyes, causing pathological changes, and may be accompanied by general physical symptoms typical of common infectious diseases, such as fever and chills.

[0070] The types of pathogens that cause candidiasis include Candida albicans, Candida tropicalis, and Candida glabrata. Candida is a fungus that normally exists in humans, but it can cause infection when the body's immunity is weakened. Candidiasis commonly occurs in infants, the elderly, users of immunosuppressants, cancer patients undergoing chemotherapy, and patients with acquired immunodeficiency syndrome (AIDS). Oropharyngeal candidiasis is more likely to occur in individuals who have received radiation therapy to the head and neck or who suffer from dry mouth. In adults without pre-existing conditions, the possibility of acquired immunodeficiency syndrome should be considered if severe or recurrent oropharyngeal candidiasis develops.

[0071] The pharmaceutical composition of the present invention may additionally include an adjuvant in addition to the active ingredient. Any adjuvant known in the art may be used without limitation, but, for example, Freund's complete or incomplete adjuvant may be further included to increase the effect.

[0072] The pharmaceutical composition according to the present invention may be prepared in a form in which an active ingredient is incorporated into a pharmaceutically acceptable carrier. Here, the pharmaceutically acceptable carrier includes carriers, excipients, and diluents commonly used in the pharmaceutical field. Pharmaceutically acceptable carriers that can be used in the pharmaceutical composition of the present invention are not limited to these, but may include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0073] The pharmaceutical composition of the present invention may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, external formulations, suppositories, or sterile injectable solutions, each according to conventional methods.

[0074] When formulating, the product may be prepared using diluents or excipients such as commonly used fillers, volume expanders, binders, wetting agents, disintegrants, and surfactants. Solid dosage forms for oral administration include tablets, pills, powders, granules, and capsules, and such solid dosage forms may be prepared by mixing at least one excipient, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc., with the active ingredient. In addition, lubricants such as magnesium stearate and talc may also be used in addition to simple excipients. Liquid dosage forms for oral administration include suspensions, liquid formulations, emulsions, and syrups, and may contain various excipients, such as wetting agents, sweeteners, flavoring agents, and preservatives, in addition to commonly used diluents such as water and liquid paraffin. Preparations for parenteral administration include sterile aqueous solutions, water-insoluble solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Water-insoluble solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Bases for suppositories may include Witepsol, Tween 61, cocoa paste, laurin paste, glycerogelatin, etc.

[0075] The pharmaceutical composition according to the present invention may be administered to an individual by various routes. Any mode of administration may be anticipated, for example, by oral, intravenous, intramuscular, subcutaneous, or intraperitoneal injection.

[0076] The dosage of the pharmaceutical composition according to the present invention is selected by taking into consideration the age, weight, gender, physical condition, etc. of the individual. It is obvious that the concentration of the active ingredient included in the pharmaceutical composition can be selected in various ways depending on the subject, and preferably, it is included in the pharmaceutical composition at a concentration of 0.01 to 5,000 μg / ml. If the concentration is less than 0.01 μg / ml, pharmaceutical activity may not appear, and if it exceeds 5,000 μg / ml, it may exhibit toxicity to the human body.

[0077] According to one embodiment of the present invention, the candidiasis may be one or more selected from cutaneous candidiasis, oral candidiasis, vaginal candidiasis, esophageal candidiasis, invasive candidiasis, candidal meningitis, and pulmonary candidiasis, and preferably may be cutaneous candidiasis.

[0078] According to one embodiment of the present invention, the composition may reduce the number of fungal cells or the expression of pathogenic factors in vivo.

[0079] According to one embodiment of the present invention, the composition may reduce the size or weight of an in vivo abscess.

[0080] In addition, the present invention provides a method for preparing a compound represented by the chemical formulas 1 to 3, comprising the steps of: first culturing an aqueous solution of a soil sample in a medium; isolating a strain from the medium; secondarily culturing and purifying the strain to obtain a solid material; and fractionating the solid material.

[0081] According to one embodiment of the present invention, the medium may be one or more selected from A1 medium, chitin medium, SIM medium, TWYE medium, Kuster medium and YEME medium, and preferably may be a chitin medium or a YEME medium.

[0082] According to one embodiment of the present invention, the medium may further comprise agar, cycloheximide, or nalidixic acid.

[0083] According to one embodiment of the present invention, the strain may be of the genus Streptomyces.

[0084] According to one embodiment of the present invention, the secondary culture may be cultured at 30°C and 190 rpm for 3 days.

[0085] In addition, the present invention provides a cosmetic composition for preventing or improving candidiasis comprising one or more of the above compounds as active ingredients.

[0086] A cosmetic composition containing the active ingredient of the present invention can be used in various ways for preventing or improving skin aging. Products to which the present composition can be added include, for example, cosmetics such as various creams, lotions, skin toners, essences, etc., as well as shampoos, rinses, cleansers, facial cleansers, soaps, treatments, packs, beauty solutions, etc.

[0087] The cosmetic composition of the present invention comprises a composition selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high molecular weight peptides, high molecular weight polysaccharides, sphingolipids, and seaweed extracts.

[0088] As for water-soluble vitamins, any that can be incorporated into cosmetics may be used, but preferably, examples include vitamin B1, vitamin B2, vitamin B6, pyridoxine, pyridoxine hydrochloride, vitamin B12, pantothenic acid, nicotinic acid, nicotinamide, folic acid, vitamin C, vitamin H, etc., and their salts (thiamine hydrochloride, sodium ascorbate, etc.) or derivatives (sodium ascorbate-2-phosphate, magnesium ascorbate-2-phosphate, etc.) are also included in the water-soluble vitamins that can be used in the present invention. Water-soluble vitamins can be obtained by conventional methods such as microbial conversion methods, purification methods from microbial cultures, enzymatic methods, or chemical synthesis methods.

[0089] As for the useful vitamin, any that can be incorporated into cosmetics may be used, but preferably, examples include vitamin A, carotene, vitamin D2, vitamin D3, vitamin E (d1-alpha tocopherol, d-alpha tocopherol, d-alpha tocopherol), and their derivatives (ascorbin palmitate, ascorbin stearate, ascorbin dipalmitate, dl-alpha tocopherol acetate, dl-alpha tocopherol nicotinate, vitamin E, DL-pantotenyl alcohol, D-pantotenyl alcohol, pantotenyl ethyl ether, etc.) are also included in the useful vitamin used in the present invention. The useful vitamin can be obtained by conventional methods such as microbial conversion, purification from microbial cultures, enzymes, or chemical synthesis.

[0090] As for the high molecular weight peptide, any material that can be incorporated into cosmetics may be used, but preferably, collagen, hydrolyzed collagen, gelatin, elastin, hydrolyzed elastin, keratin, etc. The high molecular weight peptide can be obtained by purification through conventional methods such as purification from a microbial culture medium, enzymatic methods, or chemical synthesis methods, or it can be used by purifying it from natural materials such as the dermis of pigs or cattle, or silk fibers of silkworms.

[0091] As for the high molecular weight polysaccharide, any that can be incorporated into cosmetics may be used, but preferably, hydroxyethylcellulose, xanthan gum, sodium hyaluronate, chondroitin sulfate or its salt (sodium salt, etc.) may be used. For example, chondroitin sulfate or its salt, etc., can be used after purifying it from mammals or fish.

[0092] As for sphingolipids, any that can be incorporated into cosmetics may be used, but preferably, ceramides, phytosphingosines, sphingoglycolipids, etc. Sphingolipids can be obtained by purifying them by conventional methods or by chemical synthesis from mammals, fish, shellfish, yeast, or plants.

[0093] Any seaweed extract that can be incorporated into cosmetics may be used, but preferably, brown algae extract, red algae extract, green algae extract, etc., may be used. Additionally, calagenan, arginic acid, sodium alginate, potassium alginate, etc., purified from these seaweed extracts are also included in the seaweed extract used in the present invention. The seaweed extract can be obtained by purifying seaweed by conventional methods.

[0094] In addition to the essential ingredients mentioned above, the cosmetic composition of the present invention may also include other ingredients that are conventionally incorporated into cosmetic compositions as needed. Other ingredients that may be added include oil components, moisturizers, emollients, surfactants, organic and inorganic pigments, organic powders, UV absorbers, preservatives, disinfectants, antioxidants, plant extracts, pH adjusters, alcohols, colorants, fragrances, blood circulation promoters, cooling agents, antiperspirants, purified water, etc. Examples of oil components include ester-based oils, hydrocarbon-based oils, silicone-based oils, fluorinated-based oils, animal oils, plant oils, etc.

[0095] As ester-based oils, tri-2-ethylhexanoate glyceryl, 2-ethylhexanoate cetyl, isopropyl myristate, butyl myristate, isopropyl palmitate, ethyl stearate, octyl palmitate, isocetyl isostearate, butyl stearate, ethyl linoleate, isopropyl linoleate, ethyl oleate, isocetyl myristate, isostearyl myristate, isostearyl palmitate, octyldodecyl myristate, isocetyl isostearate, diethyl sebacate, diisopropyl adipice, isoalkyl neopentanoate, tri(capryl, capric acid)glyceryl, tri-2-ethylhexanoate trimethylolpropane, triisostearate trimethylolpropane, tetra-2-ethylhexanoate pentaelislitol, cetyl caprylate, decyl lauricate, Hexyl laurate, Decyl myristate, Myristyl myristate, Cetyl myristate, Stearyl stearate, Decyl oleate, Cetyl lisinooleate, Isostearyl laurate, Isotridecyl myristate, Isocetyl palmitate, Octyl stearate, Isocetyl stearate, Isodecyl oleate, Octyldodecyl oleate, Octyldodecyl linoleate, Isopropyl isostearate, Cetostearyl 2-ethylhexanoate, Stearyl 2-ethylhexanoate, Hexyl isostearate, Ethylene glycol dioctanoate, Ethylene glycol dioleate, Propylene glycol dicaprine, Di(Capryl, Capric acid)propylene glycol, Propylene glycol dicaprylate, Neopentyl glycol dicaprine, Neopentyl glycol dioctanoate, Glyceryl tricaprylate, Glyceryl triundecylate, Glyceryl triisopalmitate, Glyceryl triisostearate, Octyldodecyl neopentanoate, Isostearyl octanoate, Octyl isononanoate, Hexyldecyl neodecanoate, Octyldodecyl neodecanoate, Isocetyl isostearate, Isostearyl isostearate, Octyldecyl isostearate, Polyglycerin oleic acid ester, Polyglycerin isostearic acid ester, Triisocetyl citrate, Triisoalkyl citrate, Triisooctyl citrate, Lauryl lactate, Myristyl lactate, Cetyl lactate, Octyldecyl lactate, Triethyl citrate, Acetyltriethyl citrate, Acetyltributyl citrate, Trioctyl citrate, Diisostearyl malate, Hydroxystearic acid 2-ethylhexyl, di2-ethylhexyl succinate, diisobutyl adipicate, diisopropyl sebacicate,Examples include ester systems such as dioctyl sebacate, cholesteryl stearate, cholesteryl isostearate, cholesteryl hydroxystearate, cholesteryl oleate, dihydrocholesteryl oleate, pitsteryl isostearate, pitsteryl oleate, isocetyl 12-stealloylhydroxystearate, stearyl 12-stealloylhydroxystearate, and isostearyl 12-stealloylhydroxystearate.

[0096] Examples of hydrocarbon oils include squalene, liquid paraffin, alpha-olefin oligomer, isoparaffin, ceresin, paraffin, liquid isoparaffin, polybutene, microcrystalline wax, and Vaseline.

[0097] Examples of silicone-based oils include polymethylsilicon, methylphenylsilicon, methylcyclopolysiloxane, octamethylpolysiloxane, decamethylpolysiloxane, dodecamethylcyclosiloxane, dimethylsiloxane and methylcetyloxysiloxane copolymer, dimethylsiloxane and methylstealoxysiloxane copolymer, alkyl-modified silicone oil, amino-modified silicone oil, etc.

[0098] Examples of fluorinated oils include perfluoropolyethers.

[0099] Examples of animal or plant oils include avocado oil, almond oil, olive oil, sesame oil, rice bran oil, safflower oil, soybean oil, corn oil, rapeseed oil, apricot kernel oil, palm kernel oil, palm oil, castor oil, sunflower oil, grapeseed oil, cottonseed oil, coconut oil, cucurbit oil, wheat germ oil, rice germ oil, shea butter, laurel oil, macadamia nut oil, meadowsweet oil, egg yolk oil, beef tallow, horse oil, mink oil, orange raffia oil, jojoba oil, candelilla wax, carnaba wax, liquid lanolin, hydrogenated castor oil, etc.

[0100] Examples of moisturizers include water-soluble low-molecular-weight moisturizers, oil-soluble molecular moisturizers, water-soluble polymers, and oil-soluble polymers.

[0101] Examples of water-soluble low molecular weight moisturizers include serine, glutamine, sorbitol, mannitol, pyrrolidone-sodium carboxylate, glycerin, propylene glycol, 1,3-butylene glycol, ethylene glycol, polyethylene glycol B (degree of polymerization n = 2 or more), polypropylene glycol (degree of polymerization n = 2 or more), polyglycerin B (degree of polymerization n = 2 or more), lactic acid, lactate, etc.

[0102] Examples of fat-soluble low-molecular-weight moisturizers include cholesterol and cholesterol esters.

[0103] Examples of water-soluble polymers include carboxyvinyl polymer, polyaspartate, tragacanth, xanthan gum, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, carboxymethylcellulose, water-soluble chitin, chitosan, dextrin, etc.

[0104] Examples of fat-soluble polymers include polyvinylpyrrolidone and eicocene copolymers, polyvinylpyrrolidone and hexadecene copolymers, nitrocellulose, dextrin fatty acid esters, and polymeric silicones. Examples of emollients include long-chain acylglutamic acid cholesteryl esters, hydroxystearate cholesteryl, 12-hydroxystearate, stearic acid, rosin acid, and lanolin fatty acid cholesteryl esters.

[0105] Examples of surfactants include nonionic surfactants, anionic surfactants, cationic surfactants, and amphoteric surfactants.

[0106] Examples of nonionic surfactants include self-emulsifying monostearate glycerin, propylene glycol fatty acid ester, glycerin fatty acid ester, polyglycerin fatty acid ester, sorbitan fatty acid ester, POE (polyoxyethylene) sorbitan fatty acid ester, POE sorbitan fatty acid ester, POE glycerin fatty acid ester, POE alkyl ether, POE fatty acid ester, POE hydrogenated castor oil, POE castor oil, POE and POP (polyoxyethylene and polyoxypropylene) copolymer, POE and POP alkyl ether, polyether-modified silicone, alkanolamide lauric acid, alkylamine oxide, hydrogenated soybean phospholipid, etc.

[0107] Examples of anionic surfactants include fatty acid soaps, alpha-acylsulfonates, alkylsulfonates, alkylallylsulfonates, alkylnaphthalenesulfonates, alkyl sulfates, POE alkyl ether sulfates, alkylamide sulfates, alkyl phosphates, POE alkyl phosphates, alkylamide phosphates, alkylloylalkyl taurine salts, N-acyl amino acids, POE alkyl ether carboxylates, alkyl sulfosuccinates, sodium alkyl sulfoacetate, acylated hydrolyzed collagen peptide salts, perfluoroalkyl phosphate esters, etc.

[0108] Examples of cationic surfactants include alkyltrimethylammonium chloride, stearyltrimethylammonium chloride, stearyltrimethylammonium bromide, cetostearyltrimethylammonium chloride, distearyldimethylammonium chloride, stearyldimethylbenzylammonium chloride, behenyltrimethylammonium bromide, benzalkonium chloride, diethylaminoethylamide stearate, dimethylaminopropylamide stearate, and quaternary ammonium salts of lanolin derivatives. Examples of amphoteric surfactants include carboxybetaine type, amidebetaine type, sulfobetaine type, hydroxysulfobetaine type, amidesulfobetaine type, phosphobetaine type, aminocarboxylate type, imidazoline derivative type, amideamine type, etc.

[0109] Organic and inorganic pigments include inorganic pigments such as silica, anhydrous silica, magnesium silicate, talc, sericite, mica, kaolin, bengala, clay, bentonite, titanium-coated mica, bismuth oxychloride, zirconium oxide, magnesium oxide, zinc oxide, titanium oxide, aluminum oxide, calcium sulfate, barium sulfate, magnesium sulfate, calcium carbonate, magnesium carbonate, iron oxide, ultramarine, chromium oxide, chromium hydroxide, calamine, and complexes thereof; Examples include polyamide, polyester, polypropylene, polystyrene, polyurethane, vinyl resin, urea resin, phenolic resin, fluoropolymer, silicone resin, acrylic resin, melamine resin, epoxy resin, polycarbonate resin, divinylbenzene and styrene copolymer, silk powder, cellulose, CI pigment yellow, CI pigment orange, and other organic pigments, as well as composite pigments of inorganic pigments and organic pigments.

[0110] As organic powders, metal soaps such as calcium stearate; metal alkyl phosphate salts such as sodium zinc cetylphosphate, zinc laurylphosphate, and calcium laurylphosphate; polyvalent metal salts of acyl amino acids such as calcium lauroyl-beta-alanine, zinc lauroyl-beta-alanine, and calcium lauroylglycine; polyvalent metal salts of amide sulfonic acids such as calcium lauroyl-taurine and calcium palmitoyl-taurine; N-acyl basic amino acids such as N-epsilon-lauroyl-L-lysine, N-epsilon-palmitoyllysine, N-alpha-palitoylolnitine, N-alpha-lauroylarginine, and N-alpha-hydrogenated beef tallow fatty acid acylarginine; and N-acyl polypeptides such as N-lauroylglycylglycine. Alpha-amino fatty acids such as alpha-aminocaprilic acid and alpha-aminolauric acid; polyethylene, polypropylene, nylon, polymethyl methacrylate, polystyrene, divinylbenzene and styrene copolymers, tetrafluoroethylene, etc. are examples.

[0111] As ultraviolet absorbers, para-aminobenzoic acid, ethyl para-aminobenzoate, amyl para-aminobenzoate, octyl para-aminobenzoate, ethylene glycol salicylate, phenyl salicylate, octyl salicylate, benzyl salicylate, butylphenyl salicylate, homomentyl salicylate, benzyl cinnamonate, paramethoxycinnamonate-2-ethoxyethyl paramethoxycinnamonate, octyl paramethoxycinnamonate, mono-2-ethylhexaneglyceryl diparamethoxycinnamonate, isopropyl paramethoxycinnamonate, a mixture of diisopropyl and diisopropyl cinnamonate esters, urocanic acid, ethyl urocanic acid, hydroxymethoxybenzophenone, hydroxymethoxybenzophenonesulfonic acid and its salts, dihydroxymethoxybenzophenone, sodium dihydroxymethoxybenzophenonedisulfonate, dihydroxybenzophenone, tetrahydroxybenzophenone, Examples include 4-tert-butyl-4'-methoxydibenzoylmethane, 2,4,6-trianilino-p-(carbo-2'-ethylhexyl-1'-oxy)-1,3,5-triazine, 2-(2-hydroxy-5-methylphenyl)benzotriazole, etc.

[0112] Examples of disinfectants include hinokitiol, triclosan, trichlorohydroxydiphenyl ether, chlorhexidine gluconate, phenoxyethanol, resorcinol, isopropylmethylphenol, azulene, salicylic acid, zincphyllithion, benzalkonium chloride, photosensitive element 301, mononitroguaiacol sodium, undecylenic acid, etc.

[0113] Examples of antioxidants include butylhydroxyanisole, propyl gallic acid, and elisorbic acid.

[0114] Examples of pH adjusters include citric acid, sodium citrate, malic acid, sodium malate, fumaric acid, sodium fumarate, succinic acid, sodium succinate, sodium hydroxide, sodium monohydrogen phosphate, etc.

[0115] Examples of alcohols include higher alcohols such as cetyl alcohol.

[0116] In addition, the ingredients that may be added are not limited to those mentioned above, and any of the above ingredients may be combined within a range that does not impair the purpose and effects of the present invention.

[0117] The cosmetic composition of the present invention may take the form of a solution, an emulsion, a viscous mixture, etc.

[0118] The ingredients included in the cosmetic composition of the present invention may include ingredients commonly used in cosmetic compositions as active ingredients, and include, for example, conventional auxiliary agents and carriers such as stabilizers, solubilizers, vitamins, pigments, and fragrances.

[0119] The cosmetic composition for preventing or improving skin aging according to the present invention can be prepared in any formulation commonly manufactured in the art, such as a lotion, cream, lotion, pack, foundation, lotion, beauty serum, hair cosmetic, etc.

[0120] Specifically, the cosmetic composition of the present invention includes formulations of skin lotion, skin softener, skin toner, milk lotion, astringent, lotion, moisture lotion, nourishing lotion, massage cream, nourishing cream, moisture cream, hand cream, foundation, essence, nourishing essence, pack, soap, cleansing foam, cleansing lotion, cleansing cream, hair lotion, hair tonic, hair essence, hair shampoo, hair rinse, hair treatment, body lotion, and body cleanser.

[0121] In the case where the formulation of the present invention is a paste, cream, or gel, animal fibers, plant fibers, wax, paraffin, starch, tracanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide may be used as carrier components.

[0122] In the case where the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, it may additionally include a propellant such as chlorofluorohydrocarbon, propane / butane, or dimethyl ether.

[0123] In the case where the formulation of the present invention is a solution or emulsion, a solvent, a solvating agent, or an emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, or fatty acid ester of sorbitan.

[0124] In the case where the formulation of the present invention is a suspension, liquid diluents such as water, ethanol, or propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used as carrier components.

[0125] In the case where the formulation of the present invention is a surfactant-containing cleansing agent, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, linolin derivative, or ethoxylated glycerol fatty acid ester, etc. may be used as a carrier component.

[0126] In addition, the present invention provides a food composition for preventing or improving candidiasis comprising one or more of the above compounds as active ingredients.

[0127] In addition to containing the active ingredient of the present invention, the food composition of the present invention may contain various flavoring agents or natural carbohydrates, etc., as additional ingredients, as in conventional food compositions.

[0128] Examples of the natural carbohydrates described above include monosaccharides, e.g., glucose, fructose, etc.; disaccharides, e.g., maltose, sucrose, etc.; polysaccharides, e.g., dextrin, cyclodextrin, etc., and conventional sugars, and sugar alcohols such as xylitol, sorbitol, erythritol, etc. The flavoring agents described above may advantageously use natural flavoring agents (taumatin), stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agents (saccharin, aspartame, etc.). The food composition of the present invention may be formulated in the same manner as the pharmaceutical composition described above and used as a functional food or added to various foods. Foods to which the composition of the present invention may be added include, for example, beverages, meat, chocolate, food products, confectionery, pizza, ramen, other noodles, chewing gum, candy, ice cream, alcoholic beverages, vitamin complexes, and health supplements.

[0129] In addition, the above food composition may contain, in addition to the extract which is an active ingredient, various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. Furthermore, the food composition of the present invention may contain fruit pulp for the production of natural fruit juice, fruit juice beverages, and vegetable beverages.

[0130] In addition, the present invention provides a method for treating candidiasis comprising the step of administering one or more pharmaceutically effective amounts selected from the above compounds to an individual.

[0131] The therapeutic method of the present invention comprises administering the recombinant peptide or the recombinant vector to an individual in a therapeutically effective amount. It is preferable to apply a specific therapeutically effective amount for a specific individual differently depending on various factors, including the specific composition (such as the type and degree of the response to be achieved and whether other agents are used in some cases), the individual's age, body weight, general health status, gender and diet, time of administration, route of administration and secretion rate of the composition, duration of treatment, and drugs used together or concurrently with the specific composition, as well as similar factors well known in the pharmaceutical field. The daily dosage is 0.0001 to 100 mg / kg based on the amount of the pharmaceutical composition of the present invention, preferably 0.01 to 100 mg / kg, and may be administered 1 to 6 times a day. However, it is obvious to those skilled in the art that the dosage or administration amount of each active ingredient must be such that it does not contain an excessively high content of each active ingredient to cause side effects. Therefore, it is preferable to determine the effective amount of the composition suitable for the purpose of the present invention by considering the aforementioned matters.

[0132] The above-mentioned individual is applicable to any mammal, and said mammal includes not only humans and primates, but also livestock such as cattle, pigs, sheep, horses, dogs, and cats.

[0133] The compounds of the present invention may be administered to mammals, such as rats, mice, livestock, and humans, by various routes. All modes of administration are expected, for example, orally, rectally or intravenously, intramuscularly, subcutaneously, intrathecally, or intracerebroventricularly.

[0134] The present invention will be explained in more detail below through the following examples. However, these examples are merely illustrative of the invention, and the scope of the invention is not limited by these examples.

[0135] <Example 1> Separation and Purification of Compounds

[0136] A mixture of 2 g of dried soil sample (Gotjawal, Jeju Island, South Korea) and 4 mL of distilled water for injection was heated to 55 ℃ and ultrasonically treated. The mixture consists of A1 medium (agar 18 g, distilled water 1 L), chitin medium (chitin 4 g, K2HPO4 0.75 g, MgSO4·7H2O 0.5 g, KH2PO4 3.5 g, FeSO4·7H2O 10 mg, MnCl2·7H2O 10 mg, ZnSO4·7H2O 10 mg, agar 18 g, distilled water 1 L), SIM medium (casein 0.4 g, starch 1 g, KNO3 0.5 g, K2HPO4 0.2 g, MgSO4·7H2O 0.1 g, CaCO3 0.1 g, agar 18 g, distilled water 1 L), TWYE medium (K2HPO4 0.5 g, yeast extract 0.25 g, agar 18 g, distilled water 1 L), and Kuster medium (glycerol 10 mL, casein Each was plated on 0.3 g of KNO3, 3 g of K2HPO4, 2 g of NaCl, 0.05 g of MgSO4·7H2O, 20 mg of CaCO3, 10 mg of FeSO4, 18 g of agar, and 1 L of distilled water. 50 mg / L of cycloheximide and 20 mg / L of nalidixic acid were added to each medium. The CJD34 strain was isolated from chitin agar medium and identified as a Streptomyces sp. with 98.5% similarity to Streptomyces ambofaciens through 16S rDNA gene sequencing analysis, and the GenBank access number is CP012382.1.

[0137] The CJD34 strain was cultured for 3 days at 30°C and 190 rpm using a rotary shaker in 50 mL of YEME medium containing 10 g of glucose, 3 g of yeast extract, 3 g of malt extract, 5 g of Pefton, 2 g of soybean extract, and 1 L of distilled water. 3.5 mL of the above culture solution was added to 150 mL of YEME medium and cultured under the same conditions. Subsequently, 20 mL of the above culture solution was added to each of 10 1 L culture solutions and cultured under the same fermentation conditions for 5 days, and the solid material was purified to obtain the solid material. The solid material was fractionated in 60% MeOH / H2O using a C18 reverse-phase column (YMC ODS-A C18, 50 μm silica gel) to obtain three compounds of Chemical Formulas 1 to 3 below.

[0138] [Chemical Formula 1]

[0139]

[0140] Name: Methoxy-apo-enteriobactin (Compound 1).

[0141] Yield: 4.8 mg (brown oil, 0.53%).

[0142] 1 H NMR (DMSO-d6): δH 7.37, 7.32, 7.30, 6.94 [3H], 6.69 [3H], 4.88 [2H], 4.58, 4.59, 4.57, 4.46, 4.43, 3.82, 3.76, 3.62 [3H].

[0143] 13 C NMR (DMSO-d6): δC 169.5, 169.4, 169.1 [2C], 168.6, 168.4, 149.0 [2C], 148.3, 146.3 [2C], 146.0, 119.1, 118.9, 118.8, 118.6, 118.3 [2C], 118.2 [3C], 116.0, 115.4 [2C], 51.5, 51.4, 55.2, 63.6, 63.1, 60.8, 52.4.

[0144] ESI-MS (m / z): [M+H] + =Calc. 702.1783, Exp. 702.1769.

[0145] [α] 20D (c 0.1, MeOH): +5.54.

[0146] UV (MeOH) λmax (log ε): 225 (4.80), 250 (4.41), 315 (3.90) nm.

[0147] IR (neat) νmax: 3350, 2957, 1738, 1536, 1275, 1186, 1077 cm-1.

[0148] [Chemical Formula 2]

[0149]

[0150] Name: N-(2,3-dihydroxybenzoyl)-L-serine 3-[2-[(2,3-dihydroxybenzoyl)amino]-2-propenoate] (N-(2,3-dihydroxybenzoyl)-L-serine 3-[2-[(2,3-dihydroxybenzoyl)amino]-2-propenoate]) (Compound 2).

[0151] Yield: 7 mg (brown oil, 0.78%).

[0152] 1 H NMR (DMSO-d6): δH 4.88, 4.63, 4.59, 5.81, 6.54, 6.71, 6.75, 6.94, 6.99, 7.35, 7.38, 9.21, 10.7.

[0153] 13 C NMR (DMSO-d6): δC 170.3, 51.5, 64.5, 168.7, 115.7, 148.6, 146.2, 118.9, 118.3, 118.2, 163.2, 132.1, 109.3, 164.7, 118.5, 145.8, 146.1, 118.6, 118.9, 120.2.

[0154] ESI-MS (m / z): [M+H] + =Calc. 447.1040, Exp. 447.1016.

[0155] [α] 20D (c 0.1, MeOH): +6.14.

[0156] UV (MeOH) λmax (log ε): 225 (4.54), 250 (4.14), 315 (3.73) nm.

[0157] IR (neat) νmax: 3412, 2887, 1756, 1673, 1464, 1366, 1275 cm-1.

[0158] [Chemical Formula 3]

[0159]

[0160] Name: N,N',N''-Tris(2,3-dihydroxybenzoyl)-O-(α-aminoacryloyl)-O-serylserine (Compound 3).

[0161] Yield: 22 mg (brown oil, 2.44%).

[0162] 1 H NMR (DMSO-d6): δH 4.44, 4.62, 4.65, 4.99, 5.75, 6.54, 6.61, 6.67, 6.92, 7.30, 7.33, 7.37, 7.85.

[0163] 13 C NMR (DMSO-d6): δC 171.6, 52.3, 64.6, 168.5, 116.0, 147.7, 146.1, 118.4, 117.8, 120.3, 162.9, 132.3, 108.8, 168.9, 119.1, 148.6, 147.1, 118.4, 117.8, 118.1, 168.7, 51.5, 64.2, 164.9, 115.5, 149.6, 146.6, 118.4, 117.4, 118.1.

[0164] ESI-MS (m / z): [M+H] + =Calc. 670.1520, Exp. 670.1494.

[0165] [α] 20D (c 0.1, MeOH): +1.54.

[0166] UV (MeOH) λmax (log ε): 225 (4.79), 250 (4.31), 315 (3.84) nm.

[0167] IR (neat) νmax: 3443, 2950, ​​1739, 1646, 1460, 1342, 1236 cm-1.

[0168] <Example 2> Structural Analysis

[0169] The absolute configurations of compounds 1 to 3 of the present invention were confirmed using Advanced Marfey's method.

[0170] Specifically, 1 mg of each compound was added to 0.5 mL of 6 N HCl and hydrolyzed at 120 °C for 30 minutes, immersed in cold water for 10 minutes, concentrated under reduced pressure and neutralized, and the hydrolysate was freeze-dried for 2 hours. 0.5 mg of each hydrolysate was dissolved by adding 100 μL of 1 N sodium hydroxide solution, after which 50 μL of 10 mg / mL L-FDLA (1-fluoro-2,4-dinitrophenyl-5-L-leucine amide) or 50 μL of D-FDLA (1-fluoro-2,4-dinitrophenyl-5-D-leucine amide) solution was added, respectively. After incubation at 80 °C, the reaction was stopped by adding an aqueous solution containing 50 μL of 2 N HCl solution and 300 μL of 50% CH3CN, and then LC-MS analysis was performed.

[0171] As a result, as shown in Figure 1, it was confirmed that the L-FDLA derivative was desorbed before the D-FDLA derivative in the hydrolysate of compound 1. Therefore, the absolute configuration of compounds 1 to 3 was all determined to be L-type.

[0172] <Example 3> Antifungal Evaluation

[0173] To evaluate the antifungal efficacy of compounds 1 to 3 and the control enterobactin, the minimum inhibitory concentration (MIC) of the compounds was analyzed against major invasive fungal pathogens, Candida albicans, Candida auris, and Cryptococcus neoformans.

[0174] Specifically, Candida albicans, Candida auris, or Cryptococcus neoformans cells were cultured for 24 hours, centrifuged, and washed three times with PBS buffer to prepare fungal cell stock solutions by synchronizing the cell concentration to an OD600 value of 1.0. RPMI 1640 medium (Sigma-Aldrich #R6504), diluted to 1% of the total culture volume, was dispensed into 96-well plates, incubated in a 35°C incubator for 48 hours, and the OD600 value was measured using a microplate reader. 5 μL of drug stock solution, prepared by dissolving each compound in DMSO to a final concentration of 5.12 mg / mL, was inoculated into 295 μL of the fungal cell stock solution for dilution. IC 20 , IC 50 and IC 90 represents 20%, 50%, and 90% inhibition concentrations (μg / mL), respectively, in the MIC (Minimum Inhibitory Concentration) test.

[0175] Compound C. albicans C. auris C. neoformans C 20 IC 50 IC 90 IC 20 IC 50 IC 90 IC 20 IC 50 IC 90 Compound 18 16>128>128>128>128 128>128 128>128 2>128 128 128 128 128 128 128 128 128 3 3 2>128>128>128>128>128

[0176] As a result, as shown in Table 1 above, the IC50 value of compound 1 against Candida albicans was measured to be 16 μg / mL, confirming that it exhibited an excellent antifungal effect compared to compound 2, compound 3, and the control group.

[0177] <Example 4> Candidalysin Inhibition Analysis

[0178] 4-1. Repression of ECE1-specific expression

[0179] Candida albicans cells were cultured in yeast-extracted Pefton medium during the early exponential growth stage, and then compounds were applied to Candida albicans IC 50After treatment at a specific concentration for 3 hours, total RNA was extracted using RNAiso PLUS (TaKaRa #9108) and bead beating following cell centrifugation. The extracted RNA was used as a template for cDNA synthesis, and the expression of genes EFG1, TEC1, BCR1, ALS1, ALS3, HWP1, ECE1, PMA1, or EFB1—which are major pathogenic factors associated with yeast-mycelial conversion and biofilm formation—was measured using real-time quantitative PCR (TaKaRa, CronoSTAR 96 Real-Time PCR System). The primers used to detect gene expression are shown in Table 2 below.

[0180] 번호이름타겟서열 (5’-3’)1P00074CDR1 qLPCCAATTATTTGGCTGGTGCT2P00075CDR1 qRPGCCAAAAAGAATACGGCAAA3P00076CDR2 qLPCAATTTTGTCGCAATTGGTG4P00077CDR2 qRPGTGCTCCACCTCGGAAATAA5P00078EFG1 qLPCCCCCATACCTTCCAATTCT6P00079EFG1 qRPTTGGTTGTTGCATTGTCGAT7P00080TEC1 qLPAAATATTGCTCCCGCAGTTG8P00081TEC1 qRPTATGTGTGGGTGATGCGTTT9P00082BCR1 qLPCAGCACGCATCTATGGCTTA10P00083BCR1 qRPAGGTATTGGTGGCAATGGAG11P00084ALS1 qLPCCTGCTGGTTATCGTCCATT12P00085ALS1 qRPGACGACTGCCAGCACAAGTA13P00086ALS3 qLPTTGCGACTGCAAAGACAATC14P00087ALS3 qRPCCCAAAACAGCATTCCAAGT15P00088HWP1 qLPTCAGTTCCACTCATGCAACC16P00089HWP1 qRPGCAGCACCGAAAGTCAATCT17P00090ECE1 qLPAGCTGTTGACACAGCCATGA18P00091ECE1 qRPCTTGGCATTTTCGATGGATT19P00092PMA1 qLPTCCAACCTTTCGATCCTGTC20P00093PMA1 qRPTTGGGTGGTCATCTTCAACA21P00094EFB1 qLPTCACCTTGGATGTCAAACCA22P00095EFB1 qRPACTGGAATCCATTGGTGAGC23P00096ACT1 qLPCAGTTTTGTTGACCGAAGCT24P00097ACT1 qRPGAAACGTAGAAAGCTGGAAC25P00192CMP1 qLPGGAGCAACACCAGTATCACC26P00193CMP1 qRPGACTTCTCTTCTTCGTTGGCTC27P00194CNB1 qLPGGAAGCTGATTTGGACGGTG28P00195CNB1qRPTGTTGGCAATTGTATCGGTGT29P00196CRZ1 qLPTGTGAGTACTGCAGCTACGA30P00197CRZ1 qRPACCTTGCTCTGTCCGTTGTA31P00198RBP1 qLPTGCTAAGGCCAGGTGATACAGT32P00199RBP1 qRPACTTGACCAACACCAACAGT33P00373SIT1 qLPTGTCAGGTGCCCAAAGTTGTG34P00374SIT1 qRPACCTGCTACTGACGAACCAA35P00375SGE13 qLPTTCATGGTGCCGATGTTGTC36P00376SGE13 qRPGGCCACCCATTTCTGAAGTT37P00377SGE11 qLPACCATCGACGCCTCAAAATG38P00378SGE11 qRPTCCCTTTTGTTCTGCCGTTG39P00379CR_09830W qLPAACAATGGTGGCTGCACAAA40P00380CR_09830W qRPCTAAACCAACAGCACCACCC

[0181] As a result, as shown in Figure 2, compound 1 did not regulate EFG1, TEC1, BCR1, and HWP1 of the calcineurin pathway, which are one of the major pathogenicity regulators, induced the expression of ALS1, which is one of the biofilm regulators, and specifically inhibited the expression of ECE1, which encodes candida lysine.

[0182] 4-2. Drug Target Evaluation

[0183] To identify the drug targets of the compounds, the expression of CDR1 and CDR2 for compound 1 was checked, and the expression of iron transporters related to iron absorption or the biosynthesis of iron exchangers in fungi was measured.

[0184] As a result, as shown in Figures 3 and 4, it was confirmed that the expression of CDR1 and CDR2 increased by more than twofold. Therefore, it can be confirmed that Compound 1 induces transcriptional activation of CDR1 and CDR2, leading to an increase in expression in response to the drug. Furthermore, no change in the expression of iron transporters was observed following treatment with the compound.

[0185] 4-3. Molecular Docking Analysis

[0186] The ability of compound 1 to bind to transcription factors Ahr1, Bcr1, Brg1, Efg1, Fkh2, Mcm1, Ndt80, Nrg1, or Ume6 that regulate ECE1 expression was analyzed by predictive molecular docking.

[0187] As a result, as shown in Figure 5, the binding affinities of compounds 1 to 3 were found to have no significant difference or were very weak. Therefore, it can be confirmed that ECE1 expression is indirectly inhibited without directly inhibiting ECE1 transcription by the inhibition of transcription factors.

[0188] <Example 5> Evaluation of in vivo candidiasis

[0189] 100 μL of Candida albicans cell solution at a concentration of 108 cells / mL was subcutaneously injected into 6-week-old female BALB / cAnNCrlOri mice (ORIENT BIO INC., Korea) and acclimatized to the environment for one week. Each compound was dissolved in a 1% aqueous ethanol solution and injected daily into the same site. The size of abscesses formed on the buttocks of the sacrificed mice was compared, and the area of ​​abscesses formed at the infection site was quantitatively measured. Statistical significance was determined using one-way analysis of variance (ANOVA) and Tukey's multiple comparison test, and all statistical analyses were performed using GraphPad Prism 9.5.1.

[0190] The management and research of animals were approved after deliberation by the Animal Ethics Committee of the Laboratory Animal Center at Jeonbuk National University (Approval No. JBNU 2023-131). All experiments were conducted in compliance with experimental ethics guidelines.

[0191] As a result, as shown in Figure 6, there was no significant change in the size of the infected area after drug treatment, but it was confirmed that the volume and weight of the extracted abscess decreased. In addition, in the fungal burden analysis of the extracted abscess, it was confirmed that the number of fungal cells in the compound 1 treatment group decreased compared to the control group.

[0192] Accordingly, the methoxy-apo-enterobactin-based compound of the present invention was isolated from a strain of the genus Streptomyces p., and its antifungal and ECE1 gene expression inhibitory effects against Candida albicans were confirmed, and its effect of reducing subcutaneous infection in vivo in a candidiasis model was confirmed.

[0193] As described above, specific embodiments of the present invention have been described in detail; however, those skilled in the art who understand the spirit of the present invention will be able to easily propose other inventions that are inferior or other embodiments included within the scope of the spirit of the present invention by adding, changing, or deleting other components within the same spirit. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of the present invention is defined by the claims set forth below rather than by the detailed description above, and all modifications or variations derived from the meaning and scope of the claims and equivalent concepts should be interpreted as being included within the scope of the present invention.

Claims

1. Compounds represented by the following chemical formulas 1 to 3, or pharmaceutically acceptable salts, hydrates, solvates, derivatives, analogs, prodrugs, or mixtures thereof: [Chemical Formula 1] [Chemical Formula 2] [Chemical Formula 3] 2. In Paragraph 1, The above compound is a compound or a pharmaceutically acceptable salt thereof derived from actinomycetes.

3. In Paragraph 2, A compound or a pharmaceutically acceptable salt thereof in which the above actinomycete is a strain of the genus Streptomyces p.

4. An antifungal pharmaceutical composition comprising one or more compounds selected from the compounds represented by the following chemical formulas 1 to 3 as an active ingredient: [Chemical Formula 1] [Chemical Formula 2] [Chemical Formula 3] 5. In Paragraph 4, The above composition is a composition that inhibits Candida albicans.

6. In Paragraph 4, The above composition is a composition that inhibits the expression or activity of candidalysin.

7. In Paragraph 4, The above composition is a composition that inhibits ECE1 gene expression.

8. A pharmaceutical composition for the prevention, improvement, or treatment of candidiasis comprising one or more compounds selected from the compounds of claim 1 as active ingredients.

9. In Paragraph 8, A composition wherein the above-mentioned candidiasis is one or more selected from cutaneous candidiasis, oral candidiasis, vaginal candidiasis, esophageal candidiasis, invasive candidiasis, candidal meningitis, and pulmonary candidiasis.

10. In Paragraph 9, A composition in which the above-mentioned candidiasis is cutaneous candidiasis.

11. In Paragraph 8, The above composition is a composition that reduces the number of fungal cells or the expression of pathogenic factors in vivo.

12. In Paragraph 8, The above composition is a composition that reduces the size or weight of an in vivo abscess.

13. A cosmetic composition for preventing or improving candidiasis, comprising one or more active ingredients selected from compounds represented by the following chemical formulas 1 to 3: [Chemical Formula 1] [Chemical Formula 2] [Chemical Formula 3] 14. A food composition for preventing or improving candidiasis, comprising one or more active ingredients selected from compounds represented by the following chemical formulas 1 to 3: [Chemical Formula 1] [Chemical Formula 2] [Chemical Formula 3] 15. A method for treating candidiasis comprising the step of administering to an individual one or more pharmaceutically effective amounts selected from compounds represented by the following chemical formulas 1 to 3: [Chemical Formula 1] [Chemical Formula 2] [Chemical Formula 3]

Images