Acinetobacter sp. and application thereof
The isolation and identification of a new Acinetobacter chuandaensis strain, WCHAc060042, has solved the problems of bacterial resistance and environmental pollution, and provided a new resource for the research and development of antimicrobial drugs, which has important application value.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- WEST CHINA HOSPITAL SICHUAN UNIV
- Filing Date
- 2023-10-27
- Publication Date
- 2026-06-19
AI Technical Summary
The problem of bacterial resistance is serious in the current technology. There is a lack of microbial strains that do not contain resistance genes and virulence genes. Resources for studying antibiotic sensitivity and developing new antibacterial drugs are scarce. The problem of environmental pollution treatment has not been effectively solved.
A novel Acinetobacter chuandaensis strain, WCHAc060042, was isolated and identified from a hospital wastewater treatment plant. It exhibits strong environmental adaptability, can process various organic substances, and does not contain drug resistance or virulence genes, making it suitable for the preparation of antibacterial drugs.
It provides a reliable experimental model for studying bacterial resistance and virulence mechanisms, and can produce antibacterial substances that can be applied to ecological restoration and wastewater treatment, with broad prospects for medical, health and industrial applications.
Smart Images

Figure CN117417865B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, and more specifically, to a novel strain of Acinetobacter and its applications. Background Technology
[0002] The genus *Acinetobacter*, first proposed by Brisou and Prévot, is a highly diverse group. Members of this genus are widely distributed in soil, rivers, feces, and other environments, possessing rich metabolic capabilities and actively participating in ecosystem nutrient cycling. Some *Acinetobacter* bacteria also act as opportunistic pathogens, potentially causing various infections. Common characteristics of these bacteria include Gram-negative, strictly aerobic, catalase-positive, oxidase-negative, non-motile, and the ability to grow on basal media utilizing carbon sources.
[0003] In recent years, with the widespread use of antibiotics, bacterial resistance has become an increasingly serious problem, leading to a decline in the clinical efficacy of many antibiotics and posing a serious threat to public health. To address this issue, scientists have been searching for microorganisms with novel antibiotic activity, as well as microbial strains lacking resistance and virulence genes, to study and evaluate antibiotic susceptibility and safety. Furthermore, studying bacterial virulence mechanisms is crucial for understanding bacterial pathogenicity and developing novel vaccines and antimicrobial treatments. In the process of studying resistance and virulence mechanisms, finding a reference strain that is both non-toxic and sensitive to commonly used clinical antibiotics is essential for establishing reliable experimental models and optimizing experimental conditions.
[0004] With environmental pollution becoming increasingly prominent, the treatment of organic pollutants has become an important issue in the field of environmental protection. The ability of bacterial strains to utilize organic matter in wastewater is of great significance for ecological restoration and wastewater treatment.
[0005] Therefore, strains lacking both resistance and virulence genes can serve as a foundation for studying antibiotic susceptibility and developing novel antibacterial drugs. Discovering strains with novel biological activities, strong environmental adaptability, and the ability to utilize various organic substances in wastewater is of great significance in the development of new antibacterial drugs, ecological restoration, and wastewater treatment. This will provide broad application prospects for medicine, healthcare, and industry. Summary of the Invention
[0006] The purpose of this invention is to provide a new strain of Acinetobacter and its application. The Acinetobacter strain isolated from a hospital wastewater treatment plant is free of drug resistance genes and virulence genes. It is temperature-sensitive, highly adaptable to the environment, can treat various organic substances in wastewater, and secretes bioactive metabolites. It has been identified as a new strain of Acinetobacter, namely Acinetobacter chuandaensis WCHAc060042, filling a gap in my country's research in this field.
[0007] The above-mentioned technical objective of the present invention is achieved through the following technical solution: a new strain of Acinetobacter with excellent biological characteristics, belonging to the genus Acinetobacter, is deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 9, 2023, with accession number GDMCC NO: 63863.
[0008] This invention also provides the application of a novel Acinetobacter strain with excellent biological characteristics in the preparation of antibacterial drugs.
[0009] In summary, the beneficial effects of this invention are as follows: The *Acinetobacter chuanxiong* strain, model strain WCHAc060042, enriches the available microbial resources for practical application. This new strain is temperature-sensitive, and its regulated growth and reproduction have significant application value in molecular biology, expression regulation, functional studies, and biosafety. This new strain does not contain drug resistance or virulence genes, making it a valuable reference strain for establishing reliable experimental models and optimizing experimental conditions, serving as a tool for studying bacterial drug resistance and virulence mechanisms. This new strain can grow and reproduce using a single carbon source and can utilize various organic substances, which is significant for ecological restoration and wastewater treatment. This new strain can produce antibacterial substances, providing a new strain resource for the development and production of new antibacterial drugs and offering promising lead compounds for the development of novel antibacterial drugs. This will provide broad application prospects in medicine, health, and industry. Attached Figure Description
[0010] Figure 1 This describes the morphology of the novel Acinetobacter species, Acinetobacter chuanxiong WCHAc060042, on LB agar plates in this embodiment of the invention.
[0011] Figure 2 This describes the morphology of the novel Acinetobacter species, Acinetobacter chuanxiong WCHAc060042, in this embodiment of the invention on MacConkey medium.
[0012] Figure 3 This is the morphology of the novel Acinetobacter species, Acinetobacter chuanxiong WCHAc060042, in this embodiment of the invention, under an electron microscope;
[0013] Figure 4 This is a phylogenetic tree of the novel Acinetobacter species Acinetobacter schwannulata WCHAc060042 and the Acinetobacter genus model strain 16S rRNA in the embodiments of the present invention.
[0014] Figure 5 This is a phylogenetic tree of the novel Acinetobacter species Acinetobacter schwannulata WCHAc060042 and the Acinetobacter genus type strain rpoB in this embodiment of the invention.
[0015] Figure 6 This is the phylogenetic tree of the core genome of the novel Acinetobacter species Acinetobacter schwannulata WCHAc060042 and the Acinetobacter genus model strain in this invention.
[0016] Figure 7 The toxicity test of the new Acinetobacter species Acinetobacter chuanxiong WCHAc060042 in the larvae of the large wax moth in this embodiment of the invention;
[0017] Figure 8 This is an example of the growth of the novel Acinetobacter species Acinetobacter schwannii WCHAc060042 in the embodiments of the present invention at different temperatures;
[0018] Figure 9 This describes the growth of the novel Acinetobacter species, Acinetobacter chuanxiong WCHAc060042, under different pH values in this embodiment of the invention.
[0019] Figure 10 This describes the growth of the novel Acinetobacter species, Acinetobacter chuanxiong WCHAc060042, under different NaCl concentrations in this embodiment of the invention.
[0020] Figure 11 This invention relates to the inhibition of pathogens by secretions from the novel Acinetobacter species, Acinetobacter chuanxiong WCHAc060042, in an embodiment of the present invention. Detailed Implementation
[0021] The following is in conjunction with the appendix Figure 1-11 The present invention will be described in further detail below.
[0022] Example: A new strain of Acinetobacter with excellent biological characteristics, named *Acinetobacter chuandaensis* in English and Chinese, with the type strain WCHAc060042; this strain is deposited at the Guangdong Microbial Culture Collection Center (GDMCC), Guangdong, China; the deposit date is October 9, 2023; the accession number is GDMCC NO: 63863.
[0023] I. Isolation of the new bacterial strain WCHAc060042
[0024] Weigh out 20g peptone, 10g lactose, 5g bile salts, 5g sodium chloride, 0.075g neutral red, 0.001g crystal violet, and 12g agar. Add 1000ml distilled water and stir well. Autoclave at 121℃ for 15 minutes, then equilibrate at 55℃ in a water bath for half an hour to prepare MacConkey agar plates. Wastewater samples were collected from the inlet of the hospital's wastewater treatment plant. 100 μL of wastewater was taken into MacConkey agar plates using a micropipette. The sample was spread evenly on the plates using an L-shaped glass rod. The plates were incubated overnight in a 30°C aerobic incubator. Colony morphology was observed. Light reddish-brown, round, raised, and moist colonies growing in the culture medium could be preliminarily identified as Acinetobacter spp. strain WCHAc060042 was isolated and recovered. Using a disposable inoculation loop, strain WCHAc060042 was picked and inoculated onto MacConkey agar plates. The strain WCHAc060042 was amplified and purified by streaking.
[0025] II. Identification and evolutionary position of the new strain WCHAc060042
[0026] A single colony of WCHAc060042 was picked and inoculated into 5 ml of LB broth medium and incubated at 30°C with shaking at 180 rpm for 12 h. 100 μL of the bacterial culture was transferred to a 1.5 ml EP tube using a micropipette, and an equal volume of ddH2O was added. After mixing, the mixture was heated in a dry bath at 100°C for 12 minutes. After cooling, it was centrifuged at 10,000 rpm at 4°C for 5 minutes. The supernatant was the crude DNA extract of strain WCHAc060042. The nearly complete 16S rRNA gene sequence of strain WCHAc060042 was obtained by PCR using primers 27F / 1492R, and the PCR amplicon was sequenced using Sanger sequencing. The rpoB gene sequence of strain WCHAc060042 was obtained and sequenced using the same method using primers rpoBF / rpoBR.
[0027] The primer sequences for 27F / 1492R and rpoBF / rpoBR are as follows:
[0028] 27F, primer sequence 5'-3', AGAGTTTGATCCTGGCTCAG
[0029] 1492R, primer sequence 5'-3', GGTTACCTTGTTACGACTT
[0030] rpoBF, primer sequence 5'-3', TAYCGYAAAGAYTTGAAAGAAG
[0031] rpoBR, primer sequence 5'-3', CGBGCRTGCATYTTGTCRT
[0032] The PCR amplification system (25 μL) is as follows:
[0033]
[0034] 1:TaKaRa Max DNA Polymerase
[0035] The PCR reaction conditions are as follows:
[0036]
[0037] The 16S rRNA and rpoB gene sequences of standard / type strains of Acinetobacter species were downloaded from the NCBI gene bank. These two sets of gene sequences were aligned using Unipro UGENE software, removing redundant base sequences to achieve the same sequence length (16S rRNA gene sequence length: 1405 bp, rpoB gene sequence length: 861 bp). Using RAxML v8.2.11 and the maximum likelihood method, a phylogenetic tree of the 16S rRNA and rpoB genes was constructed with *Moraxella conjunctivitis* ATCC 17967 as the outgroup strain. The phylogenetic tree shows that the novel strain WCHAc060042 of this invention forms a unique evolutionary branch, separating it from the evolutionary branches of currently known Acinetobacter species.
[0038] Single colonies of WCHAc060042 were picked and inoculated into LB broth for overnight culture. The bacterial pellet was collected by centrifugation, and genomic DNA was extracted using the QIAGEN QIAamp DNA Mini Kit. A library preparation kit was also used. Library construction was performed using the Ultra DNA Library Prep Kit for Illumina, followed by 150bp bidirectional sequencing on the Illumina HiSeq X10 sequencing platform. The raw reads were first screened using Trimmomatic v0.39, including adapter contamination removal, removal of low-quality end bases (>Q15), and discarding reads shorter than 100bp after quality control. The filtered reads were then assembled into contigs using SPAdes v3.13.0 to obtain the draft genome of the strain. Sequencing yielded 5,644,111 clean reads and 1.69Gb clean bases. The draft genome of strain WCHAc060042 consists of 157 contigs (N50, 80, 550bp), containing 3,822,055bp. The complete genome sequences of standard / type strains of all known Acinetobacter species were downloaded from the NCBI gene bank. The whole genome sequences of these strains were functionally annotated using Prokka to obtain their amino acid sequences. A core genome phylogenetic tree was constructed using bcgTree v1.1.0 with the software's default settings and recommended parameters. The bacterial core genome phylogenetic tree incorporates more bacterial genetic information, plays an important role in bacterial taxonomy, and exhibits high evolutionary differentiation. The core genome phylogenetic tree shows that the novel strain WCHAc060042 of this invention forms a unique evolutionary branch, clearly separated from the evolutionary branches of currently known Acinetobacter species.
[0039] The 16S rRNA gene sequence, rpoB gene sequence, and whole genome sequence of Acinetobacter chuanxiong WCHAc060042 were uploaded to the NCBI GenBank database. The 16S rRNA gene sequence number is MH428811.1, the rpoB gene sequence number is MH431558.1, and the whole genome sequence number is QKVN00000000.1.
[0040] III. ANI and isDDH analysis of the new bacterial strain WCHAc060042
[0041] The complete genome sequence of WCHAc060042 and the complete genome sequences of standard / type strains of Acinetobacter were uploaded to the JSpecies website (www.imedea.uib.es / jspecies). Using the new species WCHAc060042 as the query genome, the complete genome sequences were compared with those of the standard / type strains of Acinetobacter. ANI calculation was performed using the BLASTn method. Simultaneously, the complete genome sequences were uploaded to the GGDC 2.1 website (http: / / ggdc.dsmz.de / distcalc2.php). Using the new species WCHAc060042 as the query genome and the standard / type strains of Acinetobacter as reference genomes, isDDH calculation was performed using the website's recommended parameters and default settings. As shown in Table 1, the ANI value between Acinetobacter chuanxiong WCHAc060042 and any standard / type strain of Acinetobacter spp. was <90%, with the highest value being 89.55% (A. johnsonii CIP 64.6). The isDDH value between Acinetobacter chuanxiong WCHAc060042 and any standard / type strain of Acinetobacter spp. ranged from 19.8% (A. baylyi CIP 107474) to 36.2% (A. johnsonii CIP 64.6). Currently, an ANI value ≥95% and an isDDH value ≥70% are generally accepted as thresholds for identifying the same bacterial species. Analysis of ANI and isDDH showed that the ANI and isDDH values of Acinetobacter chuanxiong WCHAc060042 were significantly lower than the thresholds of any standard / type strain of Acinetobacter genus bacteria. Therefore, Acinetobacter chuanxiong WCHAc060042 is a new Acinetobacter genus bacteria.
[0042] Table 1. ANI and isDDH values of Acinetobacter wCHAc060042 and Acinetobacter spp. model strains from Sichuan University.
[0043]
[0044]
[0045]
[0046] IV. Basic characteristics and morphology under an electron microscope of the new bacterial strain WCHAc060042
[0047] Strain WCHAc060042 was inoculated onto LB, TSB, BHI, and MacConkey agar plates and incubated overnight at 30°C under aerobic conditions. The strain grew on all three media. On LB agar plates, WCHAc060042 formed pale yellow, round, opaque, smooth, raised colonies with intact edges, approximately 2.0-4.0 mm in diameter. On MacConkey agar plates, WCHAc060042 formed light chrysanthemum-red, round, raised, moist colonies, approximately 2.0-4.0 mm in diameter. Gram staining of *Acinetobacter chuanxiong* strain WCHAc060042 was performed using a Gram staining kit, and the results showed that strain WCHAc060042 was Gram-negative. Motility of strain WCHAc060042 was tested in LB broth containing 0.4% agar, and the results showed that strain WCHAc060042 was immobile and grew in situ.
[0048] Strain WCHAc060042 was inoculated onto BHI agar plates and placed in an anaerobic bag (bioMérieux) for 7 days at 30°C. No growth was observed, indicating that strain WCHAc060042 does not grow under anaerobic conditions. The ability of strain WCHAc060042 to produce acid using D-glucose and hydrolyze gelatin was tested using API 20NE (bioMérieux) test strips. The WCHAc060042 bacterial suspension was inoculated onto the corresponding API 20NE test strips and incubated at 30°C for 48 hours. The results showed that strain WCHAc060042 could not produce acid using D-glucose and had no ability to hydrolyze gelatin. The hemolytic activity of strain WCHAc060042 was determined using TSB plates containing 5% sheep defibrinated blood. The strain grew on TSB plates containing sheep blood without producing a hemolytic zone, indicating that *Acinetobacter chuanxiong* strain WCHAc060042 does not possess hemolytic activity.
[0049] The size and morphology of strain WCHAc060042 were observed using an H-7650 transmission electron microscope. Strain WCHAc060042 was inoculated onto LB agar plates and cultured overnight at 30°C under aerobic conditions. A small amount of colony was scraped, resuspended in distilled water, mixed thoroughly, and dropped onto a sealing film. The sample was then covered with a copper mesh for adsorption, stained negatively, and imaged using the microscope. Under the electron microscope, strain WCHAc060042 was non-flagellated, approximately 0.5–1.0 × 2.0–2.5 μm in size, with abundant exosomes secreted from the cell membrane, and a large amount of secreted products were expelled around the strain.
[0050] V. Growth characteristics and physiological and biochemical characteristics of the new strain WCHAc060042
[0051] Take the WCHAc060042 bacterial culture stored at -80℃, streak it on LB agar plates, and incubate at 30℃ inverted position for 16-20 hours to form single colonies. Pick a single colony and transfer it to 3 ml of LB broth medium, incubate at 30℃ with shaking at 180 rpm for 12 hours, and then adjust the turbidity to 0.5 McFarland concentration with physiological saline for later use.
[0052] Temperature gradient growth status:
[0053] Using a pipette, aspirate the prepared bacterial suspension and transfer it to fresh, sterile LB broth at a 1% (v / v) inoculation rate. Mix thoroughly, and include a negative control. Place the culture tubes in incubators at 4°C, 16°C, 24°C, 30°C, 32°C, 35°C, 37°C, and 40°C, respectively, and incubate with shaking at 180 rpm. Samples are taken every 0.5 hours to measure the OD. 600 The growth curve was plotted to determine the growth status. The results showed that Acinetobacter chuanxiong WCHAc060042 could grow at 16-35℃, but did not grow at 37℃, exhibiting temperature sensitivity.
[0054] pH gradient growth status:
[0055] Prepare 500ml of LB broth. Take eight sterile 100ml glass volumetric flasks and pipette 50ml of LB broth into each flask. Calibrate the LB broth in each flask using a pH calibrator to pH values of 4, 5, 6, 7, 8, 9, and 11 respectively. Filter the calibrated LB broth through a 0.22μm sterile filter for sterilization. Transfer the prepared bacterial suspension to the sterile LB broth at different pH values at a 1% (v / v) inoculation rate, mixing thoroughly. Include a negative control. Place the culture flasks in a 30℃ incubator and incubate with shaking at 180rpm. Sample every 0.5 hours to measure OD. 600 The growth curve was plotted to determine the growth status. The results showed that Acinetobacter chuanxiong WCHAc060042 could grow well in pH 6-9, and Acinetobacter chuanxiong WCHAc060042 had good pH tolerance.
[0056] NaCl tolerance growth status:
[0057] Prepare 500ml of LB broth. Take five sterile 100ml glass volumetric flasks and pipette 50ml of LB broth into each flask. Weigh unequal amounts of sodium chloride powder and add them to the LB broth to prepare LB broths with final sodium chloride concentrations of 1%, 2%, 3%, 4%, and 5% (w / v). Filter the prepared sodium chloride LB broths of different concentrations through a 0.22μm sterile filter for sterilization. Pipette the prepared bacterial suspension and transfer it to the sterile LB broths of different sodium chloride concentrations at an inoculation rate of 1% (v / v), mixing thoroughly. A negative control is also included. Place the culture flasks in a 30℃ incubator and incubate with shaking at 180rpm. Samples are taken every 0.5 hours to measure OD. 600 The growth curve was plotted to determine the growth status. The results showed that Acinetobacter chuanxiong WCHAc060042 could grow well in 0-2% (w / v) NaCl, and Acinetobacter chuanxiong WCHAc060042 had good tolerance to NaCl.
[0058] Physiological and biochemical characteristics:
[0059] API20NE is a non-enteric Gram-negative bacillus identification system that can be used to identify Acinetobacter spp. Take WCHAc060042 bacterial suspension stored at -80℃, streak it on LB agar plates, and incubate at 30℃ upside down for 16-20 hours to form single colonies. Pick 1-4 purified single colonies and add them to the 0.85% NaCl solvent prepared in the API20NE kit, carefully mixing until a homogeneous bacterial suspension is obtained. Adjust the turbidity to 0.5 McFarland concentration with physiological saline. Take an API20NE test strip and inoculate the prepared bacterial suspension from NO3 to PNPG using the same sterile pipette, avoiding the formation of air bubbles. For GLU to PAC tubes, the injected bacterial suspension must make the tube surface flat or slightly convex; for GLU, ADH, and CIRE tubes, cover with mineral oil until a convex crescent forms. Cover with the incubation box and incubate at 30℃ for 24 hours. Refer to the API20NE instructions to interpret the test results.
[0060] The assimilation capacity of Acinetobacter chuanxiong WCHAc060042 for other carbon sources was determined. According to the references, 10.0 g KH2PO4, 5.0 g Na2HPO4, 2.0 g (NH4)2SO4, 0.2 g MgSO4·7H2O, 0.001 g CaCl2·2H2O, and 0.001 g FeSO4·7H2O were dissolved in 1000 ml distilled water, and the pH was adjusted to 7.0 to prepare a basic solution. The prepared basic solution was aliquoted into 50 ml centrifuge tubes. Appropriate amounts of carbon source powder (β-alanine, L-arginine, D-ribose, trigonelline, L-arabinose, etc.) were weighed and added to the aliquoted basic solution to ensure a final carbon source concentration of 0.1% (w / v). The prepared carbon source powder was filtered through a 0.22 μm sterile filter. Different carbon source culture media were filtered and sterilized; single colonies of Acinetobacter schwanniferum WCHAc060042 after resuscitation were picked and turbidized with physiological saline to a concentration of 0.5 McFarland; the bacterial suspension was pipetted into glass test tubes containing sterile culture media of different carbon sources, mixed thoroughly, and a negative control was set up at the same time; all test tubes were placed in a 30°C constant temperature incubator and incubated for 48 hours, and the assimilation capacity of Acinetobacter schwanniferum WCHAc060042 for various carbon sources was determined by observing whether the bacterial solution became turbid.
[0061] As shown in Table 2, *Acinetobacter chuanxiong* strain WCHAc060042 can grow on basal media with acetate, 4-aminobutyrate, L-arginine, benzoate, 2,3-butanediol, citrate ethanol, L-glutamate, D,L-lactate, and malonate as the sole carbon source. It cannot grow on basal media with gentianic acid, L-histidine, adipic acid, trans-aconitine, azelaic acid, citrile acid, acetylpropionic acid, β-alanine, L-arabinose, glutaric acid, 4-hydroxybenzoic acid, D-malic acid, L-ornithine, phenylacetic acid, histamine, L-leucine, L-phenylalanine, D-ribose, L-tartaric acid, and trigonelline as the sole carbon source. This strain can grow and reproduce using a single carbon source, demonstrating strong environmental adaptability. The strain can utilize various organic substances and has the ability to treat wastewater. The strain's utilization of organic matter in wastewater is of great significance for ecological restoration and wastewater treatment.
[0062] Table 2. Material utilization of Acinetobacter chuanxiong WCHAc060042.
[0063]
[0064]
[0065] VI. Analysis of drug resistance and virulence genes in the new strain WCHAc060042
[0066] ResFinder (https: / / cge.food.dtu.dk / services / ResFinder / ) is an online software that can identify acquired drug resistance genes and genes caused by chromosomal mutations leading to drug resistance. VirulenceFinder (https: / / cge.food.dtu.dk / services / VirulenceFinder / ) is also an online software that can identify acquired virulence genes in bacterial genomes. The complete genome sequence of *Acinetobacter chuanxiong* WCHAc060042 was uploaded to ResFinder and VirulenceFinder to search for drug resistance and virulence genes carried in the genome. As shown in Table 3, the *Acinetobacter chuanxiong* WCHAc060042 isolated in this example does not contain drug resistance or virulence genes. *Acinetobacter chuanxiong* WCHAc060042 can be used as an engineered strain to study bacterial drug resistance and virulence mechanisms.
[0067] Table 3. Drug resistance and virulence genes carried by Acinetobacter chuanxiensis WCHAc060042.
[0068]
[0069]
[0070] VII. In vivo toxicity and susceptibility testing of the new bacterial strain WCHAc060042 to commonly used clinical antibiotics:
[0071] Preparation of wax moths: Select healthy, vigorous wax moth larvae with a body length of approximately 3cm and a weight of 300mg±20mg. Healthy larvae are uniformly creamy in color with no blackening on their bodies; larvae that can quickly flip over when inverted indicate good activity. Place the selected wax moth larvae in groups of 12 into petri dishes and incubate overnight at 37℃ for revival.
[0072] Strains Preparation: Single colonies of *Acinetobacter chuanxiong* WCHAc060042, *Escherichia coli* 25922, and *Klebsiella pneumoniae* hvKP6987 were picked and added to 1 ml of LB broth. The cultures were incubated at 30°C with shaking at 180 rpm until the logarithmic growth phase. The bacterial suspension was transferred to 2 ml EP tubes and centrifuged at 12000 rpm for 1 min at room temperature. The suspension was resuspended in PBS buffer and centrifuged at 12000 rpm for 1 min at room temperature. This process was repeated three times, and the suspension was resuspended again in 1 ml of PBS buffer. The bacterial suspension was turbidified to 0.5 McFarland concentration with PBS, at which point the bacterial concentration was equivalent to 1 × 10⁻⁶. 8 CFU / ml, further diluted 100-fold with PBS for later use. At this point, the bacterial concentration is equivalent to 1×10⁻⁶. 6 CFU / ml.
[0073] Injection of large wax moth larvae: Using a 25μl microsyringe, draw 10μl of the prepared bacterial suspension and PBS buffer (PBS buffer serves as a blank control). Each bacterial suspension and PBS buffer is prepared in 12 replicates. During the extraction process, repeatedly aspirate to expel air from the syringe. Hold the larvae still with your left hand, and with your right hand, hold the syringe and aim it at the corresponding marked point on the second-to-last hind leg on the left side of the larvae. Slowly insert the needle; only after feeling a slight drop should you ensure the needle tip is in the larva's hemocoel. Slowly inject 10μl of the bacterial suspension. After injection, place the larvae in a 30℃ constant temperature incubator in a dark environment for 72 hours. Observe the survival status of the large wax moth larvae every 12 hours. Wax moths that turn black and show no activity are considered dead.
[0074] Commonly used antibiotic susceptibility tests in clinical practice:
[0075] Preparation of CAMHB broth: Weigh the CAMHB broth powder according to the instructions and add it to an Erlenmeyer flask. Dissolve it in distilled water, mix with a glass rod, and sterilize at 121℃ for 15 minutes to prepare CAMHB broth.
[0076] Preparation of antibacterial drugs: Weigh out the dry powders of amikacin, gentamicin, tobramycin, ceftazidime, meropenem, imipenem, ciprofloxacin, polymyxin, tigecycline, cefepime, piperacillin / tazobactam, and trimethoprim / sulfamethoxazole (1:19), ensuring aseptic technique during weighing. The required dosage of the drug powder is calculated using the following formula: Drug mass (mg) = Solvent (ml) × Stock solution concentration (μg / ml) / Analytical potency (μg / mg). Dissolve the weighed antibacterial drug powders in their respective solvents to prepare antibacterial drug stock solutions.
[0077] Preparation of 96-well microplates containing antimicrobial agents: The prepared antimicrobial stock solution was diluted to the required concentration using CAMHB broth, and then serially diluted in a sterile loading vessel to obtain a concentration gradient (unit: μg / ml) for each antimicrobial agent. Under aseptic conditions, 100 μl of each concentration of the above-mentioned antimicrobial agent was added to the 96-well plate in ascending order of concentration. In addition, 100 μl of bacterial suspension (containing approximately 10... 6 100 μl of antimicrobial drug dilution (CFU / ml) and 100 μl of antimicrobial drug dilution were used as positive and negative controls, respectively. Based on the quality control range of the control strain, the above antimicrobial drug dilution was further diluted, with the dilution range covering the quality control range and expanding to both sides of the range using two concentration gradients.
[0078] Bacterial culture preparation: Quality control strains 25922 and *Acinetobacter chuanxiong* WCHAc060042 were removed from the -80℃ freezer and inoculated onto LB agar plates, then incubated overnight at 30℃. Single colonies of 25922 and WCHAc060042 were picked and inoculated into 1 ml of CAMHB broth, and incubated at 30℃ with shaking at 180 rpm for 4-6 hours. The bacterial culture was then diluted with CAMHB broth to 0.5 McFarland units (approximately equivalent to 10^6). 8 CFU / ml). Take 100 μl of 0.5 McFarland and dilute it 100 times with CAMHB broth for later use (at this point, the bacterial count is approximately 10). 6 (CFU / ml).
[0079] Inoculation: Add 100 μl of the bacterial suspension prepared in the previous step (containing approximately 10... 6 (CFU / ml) was added sequentially to a 96-well plate. Each concentration of antimicrobial agent and each type of bacteria were tested in triplicate to ensure the stability and reliability of the results.
[0080] Culture: Place the inoculated 96-well plate in a 30°C incubator for 18-24 hours and then read the MIC results.
[0081] Results Interpretation: Observe whether each well of the 96-well plate becomes turbid to determine whether bacteria are growing. The lowest drug concentration that can completely inhibit bacterial growth is the MIC value of the antibacterial drug against bacteria, as shown in Table 4. Observe whether the results of three replicates of the test bacteria are consistent. If two of the three results are consistent and there are no skipped wells, the experiment is considered successful. If skipped wells occur, the experiment is repeated. Preferably refer to the CLSI (The Clinical & Laboratories Standards Institute) guidelines for result interpretation. If the CLSI guidelines are not available, the standards established by EUCAST (The European Committee on Antimicrobial Susceptibility Testing) can be used as an alternative.
[0082] Table 4. MIC values of commonly used antibiotics in clinical practice for Acinetobacter chuanxiong WCHAc060042.
[0083]
[0084]
[0085] The highly toxic hvKP6987 strain can kill large wax borer larvae in a short time (75% kill within 48 hours), while the low-toxicity 25922 strain cannot kill them. Acinetobacter baumannii WCHAc060042 does not contain virulence genes, and its virulence test showed low virulence (100% larval survival rate after 72 hours). Furthermore, Acinetobacter baumannii WCHAc060042 is sensitive to commonly used clinical antibiotics such as amikacin, gentamicin, tobramycin, ceftazidime, meropenem, imipenem, ciprofloxacin, polymyxin, tigecycline, cefepime, piperacillin / tazobactam, and trimethoprim / sulfamethoxazole (1:19), and does not contain drug resistance genes. This patented strain WCHAc060042 is both non-toxic and sensitive to commonly used clinical antibiotics. It will not cause the model to die due to virulence when constructing infection models, and can be used for clinical evaluation of antibiotic efficacy. The strain does not contain drug resistance genes or virulence genes, and can be used as a tool strain in the field of studying bacterial drug resistance and virulence mechanisms, which is of great value.
[0086] VIII. Analysis of the antibacterial ability of secretions from the new bacterial strain WCHAc060042
[0087] Take the WCHAc060042 bacterial culture stored at -80℃, streak it on LB agar plates, and incubate it upside down at 30℃ for 24 hours to form single colonies. Pick a single colony and transfer it to 3 ml of LB broth medium, and incubate at 30℃ with shaking at 180 rpm for 6 hours. Transfer it to 200 ml of LB broth medium at a 1% volume ratio, and incubate at 30℃ with shaking at 180 rpm for 12 hours. Centrifuge at 4℃ and 10,000 rpm for 5 minutes, collect the supernatant, filter it through a 0.22 μm filter to remove bacteria, and then store it at 4℃ for later use.
[0088] Collect clinically common pathogens such as Klebsiella pneumoniae, Escherichia coli, Enterobacter cloacae, Staphylococcus aureus, Enterococcus faecalis, Pseudomonas aeruginosa, Acinetobacter baumannii, Serratia marcescens, and Burkholderia cepacia, which were frozen at -80℃. Streak the cultures onto LB agar plates and incubate at 30℃ (inverted) for 24 hours until single colonies form. Pick a single colony and transfer it to 3 ml of LB broth. Incubate at 30℃ with shaking at 180 rpm until the logarithmic growth phase. Dilute the culture with LB broth to 0.5 McFarland units (approximately equivalent to 10^6). 8 (CFU / ml), for later use.
[0089] Collect the culture supernatant of WCHAc060042 and add it to LB broth medium to make the supernatant content 50% (WCHAc060042 culture supernatant: LB broth medium ratio 1:1), mix well and set aside. Take a 96-well culture plate, add 200 μl of LB broth medium containing 50% WCHAc060042 culture supernatant to each well, and add 1% of the prepared 0.5 McFarland's turbidity suspension of common clinical pathogens to the LB broth medium containing 50% WCHAc060042 culture supernatant in the 96-well plate. Each test strain is performed in 3 replicates. At the same time, a control group is set up. In the control group, add 200 μl of LB broth medium to each well of the 96-well culture plate, and add 1% of the prepared 0.5 McFarland's turbidity suspension of common clinical pathogens to the LB broth medium in the 96-well plate. Each test strain is performed in 3 replicates. The 96-well culture plate was placed in an automated microbial growth curve analyzer, the culture temperature was set to 30℃, and the plate was shaken at 750 rpm for 24 hours under aerobic conditions. OD was measured every half hour. 600 The absorbance value was compared with that of the control group to determine the antibacterial effect.
[0090] The results show that *Acinetobacter chuanxiong* WCHAc060042 can produce substances with broad-spectrum antibacterial effects against clinically important pathogens such as *Klebsiella pneumoniae*, *Escherichia coli*, and *Enterobacter cloacae*. The aforementioned electron microscopy imaging results of *Acinetobacter chuanxiong* WCHAc060042 showed a large amount of secreted material around the bacterial cells and exosomes on the cell membrane, which corroborates the results of this study. The overnight culture medium of *Acinetobacter chuanxiong* WCHAc060042 contained bacterial secretions, which have inhibitory effects on *Klebsiella pneumoniae*, *Escherichia coli*, and *Enterobacter cloacae*, providing a reference for subsequent purification and development of antibacterial drugs.
[0091] As can be seen from the above embodiments, this invention provides a new strain of Acinetobacter: *Acinetobacter chuanxiong*, with the model strain being WCHAc060042. The discovery and utilization of this new strain enriches the available microbial resources for practical application. This new strain is temperature-sensitive, and its regulated growth and reproduction have significant application value in molecular biology, expression regulation, functional studies, and biosafety. This new strain does not contain drug resistance genes or virulence genes, making it a good reference strain for establishing reliable experimental models and optimizing experimental conditions, and serving as a tool for studying bacterial drug resistance and virulence mechanisms. This new strain can grow and reproduce using a single carbon source and can utilize various organic substances, which is of great significance for ecological restoration and wastewater treatment. This new strain can produce antibacterial substances, providing a new strain resource for the development and production of new antibacterial drugs and offering good lead compounds for the development of novel antibacterial drugs. This will provide broad application prospects in medicine, health, and industry.
[0092] This specific embodiment is merely an explanation of the present invention and is not intended to limit the invention. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they are within the scope of the claims of the present invention.
Claims
1. A new strain of Acinetobacter ( Acinetobacter chuandaensis Its characteristics are: It belongs to the genus Acinetobacter and is deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 9, 2023, with accession number GDMCCNO: 63863.
2. The novel Acinetobacter strain according to claim 1 ( Acinetobacter chuandaensis Application of this technology in the preparation of antibacterial drugs for Klebsiella pneumoniae, Escherichia coli, and Enterobacter cloacae.