A GmLRM3 protein and its application in regulating stem strength

Abstract

The present invention relates to the field of genetic engineering technology, and in particular to a GmLRM3 protein and its application in regulating stem strength. The GmLRM3 protein comprises: an amino acid sequence as shown in SEQ ID NO.1. The GmLRM3 protein is encoded by a nucleotide sequence as shown in SEQ ID NO.2. The present invention studies and obtains a GmLRM3 protein and a gene encoding the same, and the GmLRM3 protein is closely related to the stem strength and plant height of the plant. The stem strength and plant height of the plant can be effectively regulated by overexpressing or knocking out the gene encoding the GmLRM3 protein in the plant. The GmLRM3 protein and the gene encoding the same provided by the present invention can be used for the cultivation of lodging-resistant soybean varieties, and have broad application prospects.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a GmLRM3 protein and an application thereof in regulating stem strength. Background Art

[0002] Lodging is an important factor limiting the high yield and high quality of soybeans. After the crop lodging, the photosynthetic efficiency of the plant leaves is reduced, resulting in the plant being unable to obtain sufficient nutrient supply, affecting normal growth and development. In addition, lodging will also hinder the transportation and storage of photosynthetic products, resulting in a decrease in the fruit set rate, thereby reducing the yield and quality of the crop. Lodging will also reduce the efficiency of mechanical harvesting and increase the risk of crop damage during the harvesting process. Depending on the period and degree of soybean lodging, the yield reduction can range from 10% to 50%. In the case of severe lodging during the flowering period, soybean yield may be reduced by more than 60%; in the case of severe lodging during the pod-setting period, soybean yield may be reduced by more than 50%. In addition, lodging also brings inconvenience to field management and pest and disease control, and is likely to cause the aggravation of pests and diseases, thus affecting the quality of soybeans.

[0003] In response to the serious impact of lodging on soybean yield and quality, experts and scholars have conducted extensive and in-depth research at home and abroad, and have made important progress. Among the many factors that affect soybean lodging, the characteristics of the stem are considered to be one of the most important factors. The amount and composition of storage materials in the stem play a decisive role in its lodging resistance. The fresh weight and dry weight of the stem reflect the size of the plant and the material fullness of the tissues and organs, while the dry matter weight and density of the stem are significantly positively correlated with the lodging resistance. The amount of dry matter stored in the stem is crucial to maintaining the strength of the stem. A reduction in dry matter in the stem sheath will lead to a decrease in the stem's ability to resist bending and a lower lodging resistance index. The study also found that the glucose and xylulose content in the internodes at the base of the stem is correlated with the curvature of the stem, and different varieties show differences in this regard.

[0004] The cell wall can enhance the mechanical strength of the cell and maintain the inherent morphology of organs and plants. Therefore, the composition and content of the cell wall have a significant role in maintaining the mechanical strength of the stem and improving the lodging resistance of the plant. A study analyzed the rice variety BC1 and found that its stem compressive strength was affected by cell wall compounds. At the same time, other studies have shown that the hemicellulose and lignin content of the stems of lodging-resistant varieties are higher than those of non-lodging-resistant varieties. Summary of the invention

[0005] In order to solve the problems existing in the prior art, the present invention provides a GmLRM3 protein and application thereof in regulating stem strength.

[0006] In a first aspect, the present invention provides a GmLRM3 protein, comprising: an amino acid sequence as shown in SEQ ID NO.1.

[0007] Furthermore, the GmLRM3 protein is encoded by the nucleotide sequence as described in SEQ ID NO.2.

[0008] In a second aspect, the present invention provides a nucleic acid for encoding the GmLRM3 protein.

[0009] The nucleic acid includes genomic DNA, cDNA, recombinant DNA, mRNA, hnRNA encoding the GmLRM3 protein; or a nucleic acid molecule that is reverse complementary to the above DNA, cDNA, recombinant DNA or mRNA.

[0010] The above-mentioned nucleic acid molecules can be modified or optimized according to actual needs to make gene expression more efficient; for example, (1) the codons can be changed to conform to the preferences of the recipient plant while maintaining the amino acid sequence encoded by the nucleic acid of the present invention according to the codons preferred by the recipient plant. (2) The gene sequence adjacent to the start methionine is modified to effectively initiate translation; for example, the modification is performed using a sequence known to be effective in plants. (3) It is connected to various plant expression promoters to facilitate its expression in plants; the promoter may include constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred and tissue-specific promoters; the choice of promoter will vary with the expression time and space requirements, and also depends on the target species; (4) Introducing enhancer sequences, such as intron sequences (e.g., derived from Adhl and bronzel) and viral leader sequences (e.g., derived from TMV, MCMV and AMV).

[0011] Furthermore, the vector may be a plasmid, a cosmid, a phage or a virus vector; and the transgenic cell does not have the ability to develop into a complete plant individual.

[0012] For plants that do not contain GmLRM3, the gene fragment of GmLRM3 can be introduced into plant cells by chemical methods, shotgun methods, microinjection, electroporation and other methods. The gene fragment of GmLRM3 can also be introduced into plant cells by homologous recombination, zinc finger nuclease, TALEN, CRISPR and other methods.

[0013] The present invention further provides a GmLRM3 gene mutant, comprising: a nucleotide sequence as shown in SEQ ID NO.3.

[0014] The present invention further provides a biomaterial, which comprises the nucleic acid or the GmLRM3 gene mutant; the biomaterial is an expression cassette, a vector or a transgenic cell.

[0015] In a third aspect, the present invention provides a kit comprising one or more of the GmLRM3 protein, the nucleic acid, the GmLRM3 gene mutant, or the biological material.

[0016] The present invention further provides the use of the GmLRM3 protein, or the nucleic acid, or the GmLRM3 gene mutant, or the biological material, or the kit in regulating the strength of plant stems.

[0017] The present invention further provides the use of the GmLRM3 protein, or the nucleic acid, or the GmLRM3 gene mutant, or the biological material, or the kit in regulating the number of pods per plant, the yield per plant, the plant height or the number of main stem nodes.

[0018] The present invention further provides the use of the GmLRM3 protein, or the nucleic acid, or the GmLRM3 gene mutant, or the biological material, or the kit in dwarfing plants.

[0019] The present invention further provides the use of the GmLRM3 protein, or the nucleic acid, or the GmLRM3 gene mutant, or the biological material, or the kit in regulating the lignin or cellulose content of plants.

[0020] Furthermore, the plant is soybean.

[0021] In a fourth aspect, the present invention provides a gRNA comprising: AAAGTATTACCAG AAGGCAGAGG.

[0022] The present invention has the following beneficial effects:

[0023] The present invention studies and obtains a GmLRM3 protein and its encoding gene that are closely related to plant stem strength. By overexpressing or knocking out the encoding gene of the GmLRM3 protein in plants, plant stem strength, plant height, internode length and other traits can be effectively regulated. The GmLRM3 protein and its encoding gene provided by the present invention can be used for the cultivation of lodging-resistant plant varieties, enriching soybean germplasm resources, and have important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0025] Figure 1 The genome and transcript sequences of part of the soybean GmLRM3 gene provided in Example 1 of the present invention are shown in FIG. 1 , wherein bold indicates exon sequences, and italics indicates intron sequences. Indicates promoter.

[0026] Figure 2 It is the genome and transcription sequence of part of the soybean GmLRM3 gene provided in Example 1 of the present invention; wherein, bold indicates exon sequence, and italic indicates intron sequence.

[0027] Figure 3 The genome and transcript sequences of part of the soybean GmLRM3 gene provided in Example 1 of the present invention are shown in FIG. 1 , wherein bold indicates exon sequences, and italics indicates intron sequences. Indicates terminator.

[0028] Figure 4 It is a schematic diagram of the difference in stem strength phenotype between the wild-type Williams 82 and the gmlrm3 mutant provided in Example 2 of the present invention; wherein A is a plant photo of the wild-type Williams 82, B is a plant photo of the gmlrm3 mutant, C is the result of phloroglucinol staining of a freehand section of the wild-type Williams 82, and D is the result of phloroglucinol staining of a freehand section of the gmlrm3 mutant.

[0029] Figure 5 It is a schematic diagram of the phenotypic differences in plant height and internode length between the wild-type Williams 82 and the gmlrm3 mutant provided in Example 2 of the present invention; from left to right are schematic diagrams comparing the number of pods per plant, yield per plant, plant height, and number of main stem nodes of the wild-type Williams 82 and the gmlrm3 mutant.

[0030] Figure 6 It is a schematic diagram of the GmLRM3 knockout vector VK005-04-GmLRM3 provided in Example 3 of the present invention.

[0031] Figure 7 It is a schematic diagram showing that the phenotype of the transgenic plant expressing the GmLRM3 gene knockout provided in Example 3 of the present invention is consistent with the mutant phenotype; wherein A is a photo of the wild-type Williams 82 plant, B is a photo of the gmlrm3 mutant plant, and CE are photos of the plants GmLRM3 crispr#1, 6, and 13 obtained by transferring the GmLRM3 knockout vector into the wild-type soybean Williams 82.

[0032] Figure 8It is a graph showing the results of measuring the contents of lignin, cellulose and hemicellulose in wild type, mutant and knockout transgenic materials provided in Example 3 of the present invention; wherein A is the result of measuring the content of lignin, B is the result of measuring the content of cellulose, and C is the result of measuring the content of hemicellulose. DETAILED DESCRIPTION

[0033] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] Unless otherwise specified, the test materials used in the present invention are all common commercial products and can be purchased commercially.

[0035] Example 1

[0036] This embodiment provides a method for isolating the GmLRM3 gene in soybean and performing structural analysis thereof, which specifically includes the following process:

[0037] 1. Isolation of GmLRM3 gene

[0038] The present invention extracts total RNA from soybean variety Williams 82, uses the total RNA as a template, and uses Oligo (T) 17 as a primer to synthesize the first chain of cDNA. Using the first chain of cDNA as a template, PCR amplification is performed using a forward primer (5'-ATGGGTGTTATGGAGATATCATTGTT-3') and a reverse primer (5'-GCCCCTCCCAGAACTCCCATGTCT-3'). A GmLRM3 gene cDNA fragment with a length of 2526 bp is obtained, and the fragment is connected to a pEasy-Blunt vector (Quanshijin Company), and is named Blunt-GmLRM3.

[0039] The obtained GmLRM3 gene has a gene sequence as shown in SEQ ID NO.2, and the full length of the CDS of the GmLRM3 gene is 2526 bp; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.1, which has 841 amino acids in total.

[0040] 2. Analysis of GmLRM3 gene structure

[0041] DNA was extracted from young leaves of soybean variety Williams 82, and the genomic DNA was used as a template to amplify the GmLRM3 genomic fragment. The GmLRM3 genomic sequence is shown in SEQ ID NO: 3, with a total length of 7826 bp, including 5 exons and 4 introns (such as Figure 1-Figure 3 shown).

[0042] Example 2

[0043] This example provides a method for isolating and screening soybean GmLRM3 gene mutants, as well as phenotypic identification. The specific process is as follows:

[0044] The present invention uses Williams 82 as the background to construct a soybean mutant library. Using this platform, a strain of GmLRM3 protein with non-synonymous mutation was screened and named gmlrm3. In the gmlrm3 mutant, a base G was deleted in the third exon of GmLRM3, resulting in a significant change in the encoded protein, so we first selected gmlrm3 for subsequent experiments. The stem strength was evaluated by growing upright and bent plants; the number of nodes, internode length, and stem thickness (n>30) were measured by testing mature plants.

[0045] (1) GmLRM3 gene regulates stem strength

[0046] The results are as follows Figure 4 As shown, the gmlrm3 mutant has a reduced stalk strength compared to the wild-type Williams 82. The present invention further conducted a phenotypic investigation on the wild-type Williams 82 and the gmlrm3 mutant planted in the field for 35 days. Compared with Williams82, the gmlrm3 mutant has a reduced stalk strength and a broken lodging phenotype.

[0047] (2) GmLRM3 gene regulates soybean internode elongation and stem thickness

[0048] The results are as follows Figure 5 As shown, compared with the wild type Williams 82, the soybean gmlrm3 mutant had fewer pods per plant, less yield per plant, less plant height, and fewer main stem nodes than the wild type.

[0049] Example 3

[0050] The present invention knocks out the soybean GmLRM3 gene in soybean and detects its application to soybean. The specific process is as follows:

[0051] 1. Construction of soybean GmLRM3 gene knockout vector

[0052] The CRISPR / Cas9 vector with GmU6 promoter driving gRNA and GmUbi3 promoter driving Cas9 protein was constructed. The recombinant plasmid (GmLRM3 gene knockout vector) was introduced into the wild-type soybean Williams 82 through the Agrobacterium-mediated genetic transformation system to knock out the target gene GmLRM3. The knockout vector of GmLRM3 gene was constructed and transformed into the wild-type soybean Williams 82. The knockout phenotype was observed and the candidate genes (such as Figure 6 shown).

[0053] The specific primer sequences of the GmLRM3 gene knockout vector are shown in SEQ ID NO.7 and SEQ ID NO.8.

[0054] The upstream primer shown in SEQ ID NO7: CTCAGAATTCGAGCTCGTATTT TGCATACGACGTTTAAG;

[0055] The downstream primer shown in SEQ ID NO.8: GTCTAGAGGATCCCGGGACAA AGAGACCCAATTTAGCC.

[0056] gRNA used: AAAGTATTACCAGAAGGCAGAGG.

[0057] 2. Agrobacterium-mediated transformation of leguminous plants

[0058] In this example, the soybean cotyledonary node was transformed by Agrobacterium-mediated method to obtain the wild-type soybean Williams 82 explant containing the GmLRM3 knockout vector. The specific process is as follows:

[0059] (1) Obtaining soybean explants

[0060] Select mature soybean seeds of wild-type soybean Williams82 with smooth surface, no damage, no disease spots, and no cracks, and sterilize them with chlorine for 14 hours. Ventilate the sterilized seeds on a clean bench to completely volatilize the chlorine, and germinate them in germination medium for 6 hours. Remove 1 / 2 hypocotyl of soybean, cut soybean longitudinally along the hypocotyl, and use the remaining hypocotyl as the receptor material for Agrobacterium-mediated transformation.

[0061] (2) Soybean transformation

[0062] Agrobacterium-mediated method uses secondary Agrobacterium infection to transform the GmLRM3 gene knockout vector into soybean. Cultivate in the dark at 22℃ in the co-culture medium for 5 days; culture in SI-I medium under strong light for 7 days; cut off the large buds of the explant (wild-type soybean Williams 82) and culture in SI-II medium under strong light for 14 days; cut off the cotyledons and hypocotyls of the explants and subculture every 14 days in SE medium; cut off the clustered buds of about 3cm and put them into the rooting medium for rooting; transfer the plants with well-developed roots in the RM rooting medium to the soil for planting. Through the Bar resistance test, 30 resistant plants were screened. After 5 months of cultivation in the greenhouse, the fruit pods began to mature and the harvest was completed after 6 months.

[0063] (3) Genetically modified plants that can be inherited

[0064] The results are as follows Figure 7 As shown, the present invention planted the harvested T2 generation seeds in the field (named GmLRM3 crispr#1,6,13). It can be observed that when the GmLRM3 knockout vector was transferred into the wild-type soybean Williams 82, the stem strength and plant height of the transgenic plants were reduced, which was consistent with the Gmlrm3 mutant.

[0065] The present invention further tested the lignin, cellulose and hemicellulose of soybean gmlrm3 mutant, wild type Williams 82 and GmLRM3 crispr#1,6,13. Figure 8 As shown, compared with the wild-type Williams 82, the lignin content of soybean gmlrm3 mutant and GmLRM3 crispr#1,6,13 was significantly decreased, the cellulose content was significantly increased, and there was no significant difference in hemicellulose content.

[0066] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of GmLRM3 protein or nucleic acid in regulating soybean plant growth; The amino acid sequence of the GmLRM3 protein is shown in SEQ ID NO.1; The nucleotide sequence of the nucleic acid is shown in SEQ ID NO.3; The application is: reducing the plant height of soybean by knocking out the coding gene of the GmLRM3 protein or the nucleic acid in soybean.

2. Application of GmLRM3 protein or nucleic acid in regulating the cellulose content of soybean; The amino acid sequence of the GmLRM3 protein is as shown in SEQ ID NO.1; The nucleotide sequence of the nucleic acid is shown in SEQ ID NO.3; The application is: improving the cellulose content of soybeans by knocking out the coding gene of the GmLRM3 protein or the nucleic acid in soybeans.

Images