An attenuated mutant strain of Avian bacillus paragallinarum, its construction method, application, and vaccine
By constructing the attenuated mutant strain 2016/HB64-TB76 of Avian bacillus paragallinarum, the problems of poor immune side effects and cross-protection of existing vaccines were solved, providing a live attenuated vaccine with fewer immune side effects and better cross-protection, thus improving the immune protection rate against serum A-type Avian bacillus paragallinarum.
Patent Information
- Application Number
- CN202311642681.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-04
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2043-12-04
AI Technical Summary
Existing avian bacillus vaccines suffer from severe immune side effects, poor cross-protection, and insufficient protection between different subtypes. Furthermore, there are frequent cases of immunization failure in clinical practice. There is an urgent need to develop new vaccines with fewer immune side effects and better cross-protection.
A live attenuated vaccine candidate strain with 80% immunoprotective efficacy was obtained by constructing an attenuated mutant strain of Avian bacillus paragallinarum, 2016/HB64-TB76, and inactivating the ApaH gene by transposon Tn5 insertion, for the prevention and control of infectious rhinitis.
It provides a live attenuated vaccine with fewer immune side effects and good cross-protection, which significantly improves the immune protection rate against avian paraguinea type A and reduces the impact on flock production performance.
Smart Images

Figure CN117736952B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to an attenuated mutant strain of Avian bacillus paragallinarum, its construction method, application, and vaccine. Background Technology
[0002] *Avibacterium paragallinarum* (Av. paragallinarum) is the pathogen of infectious coryza (IC) in chickens, causing decreased egg production in laying hens and poor growth in broilers. According to the Page typing scheme, *Avibacterium paragallinarum* is classified into three serotypes: A, B, and C. In recent years, IC has become prevalent in many countries worldwide, and outbreaks continue to occur frequently even in vaccinated flocks, causing significant economic losses to the poultry industry.
[0003] With the restricted use of antibiotics, biosecurity and vaccines have become the main methods for the prevention and control of this disease. Currently, IC vaccines on the market include monovalent (mostly type A), bivalent (types A and C), and trivalent (types A, B, and C) whole-cell inactivated vaccines. With all three serotypes (A, B, and C) isolated in my country, trivalent inactivated vaccines have been widely used in many large-scale farms. However, these vaccines often cause severe side effects after vaccination due to the presence of lipopolysaccharides and other components. Repeated vaccinations can also lead to immune stress and affect flock productivity. Secondly, there is a lack of cross-protection between different serotypes, and only partial cross-protection between different subtypes. Furthermore, studies have shown that the emergence and increased virulence of *Avianella paragallinarum* variants in clinical practice have resulted in poor protective effects between the same serotype. Frequent cases of immunization failure in clinical practice also confirm these problems. Therefore, there is an urgent need to develop new vaccines with fewer immune side effects and better cross-protection. Live attenuated vaccines, which can mimic the immune response mediated under natural infection conditions and leverage competitive advantages, have attracted widespread attention. Spray immunization can also significantly save manpower and resources and reduce stress response. Currently available commercially available attenuated live bacterial vaccines include bovine Brucella attenuated live vaccine (A19 strain), BCG vaccine, chicken mycoplasma vaccine (F strain), and synoviocyte mycoplasma vaccine (MS-H strain).
[0004] There are many ways to obtain live attenuated vaccines, and one of the main research directions is to develop corresponding live attenuated vaccines by mutating or deleting the virulence genes of pathogens. However, research on live attenuated vaccines against avian bacillus paragallinarum is very scarce. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide an attenuated mutant strain of Avian bacillus paragallinarum, its construction method, application, and vaccine. The ApaH gene of the obtained mutant strain is inactivated due to the insertion of transposon Tn5, and it has an 80% immune protection rate against serum Avian bacillus paragallinarum. It can be used as a candidate strain for attenuated live vaccine of Avian bacillus paragallinarum for the prevention and control of infectious rhinitis.
[0006] This invention provides the following technical solution:
[0007] Firstly, a weakened mutant strain of *Avibacterium paragallinarum* is provided. The depositary institution is the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Wuhan, China. The deposit date is April 24, 2023, the accession number is CCTCC NO:M2023607, the name is 2016 / HB64-TB76, and the Latin name is *Avibacterium paragallinarum*.
[0008] Furthermore, the ApaH gene of the mutant strain is inactivated due to the insertion of transposon Tn5, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0009] Secondly, a method for constructing an attenuated mutant strain of *Avianobacterium paragallinarum* as described in the first aspect is provided, comprising the following steps:
[0010] The transposon Tn5-kan was prepared with EZ-Tn5 transposase to form the Tn5 transposon;
[0011] Competent cells of *Avianobacterium paragenomicum* 2016 / HB64 were prepared using M-IV medium. Tn5 transposons were added, and after incubation, TSB liquid medium was added. After culture, the cells were enriched by centrifugation, the supernatant was discarded, and the cells were resuspended and spread on medium for culture. All colonies on the medium were then collected to construct a random mutant library of transposons Tn5.
[0012] Biofilm formation ability of strains in the Tn5 transposon random mutant library was determined, and mutant strain 2016 / HB64-TB76 with significantly reduced biofilm formation ability was screened out.
[0013] Furthermore, 1 μg of Tn5 transposons was added to every 1 mL of *Avianobacterium paragallinarum* 2016 / HB64 competent cells.
[0014] Furthermore, the incubation is carried out in a shaker at 37°C with a rotation speed of 100 r / min for 30 min.
[0015] Furthermore, after adding TSB liquid medium, the cells were cultured at 220 rpm for 100 min, and then centrifuged at 4000 rpm for 10 min to enrich the bacterial cells.
[0016] Furthermore, the culture medium is TSA medium containing 10 μg / mL kanamycin, and the bacteria are cultured in the medium for 24 h.
[0017] Furthermore, after resuspending the bacterial cells and spreading them on a culture medium, several transformants were randomly selected from the culture medium and identified by PCR using primers Kan-F and Kan-R to determine whether the transposon Tn5 had successfully inserted into the genome of *Avianobacter paragallinarum* 2016 / HB64. The nucleotide sequence of primer Kan-F is shown in SEQ ID NO.2, and the nucleotide sequence of primer Kan-R is shown in SEQ ID NO.3.
[0018] Thirdly, the application of a weakened mutant strain of *Avianobacterium paragallinarum* described in the first aspect in the preparation of biological products for the prevention and control of infectious coryza in chickens is provided.
[0019] Fourthly, a vaccine is provided, comprising a bacterial count of 1×10⁻⁶. 8 ~1×10 9 The attenuated mutant strain of *Avianobacterium paragallinarum* as described in the first aspect (CFU / mL).
[0020] Compared with the prior art, the beneficial effects of the present invention are:
[0021] (1) This invention screened out mutant strains with significantly reduced biofilm formation ability by measuring the biofilm formation ability of strains in the Tn5 transposon random mutant library. This not only verified the change in its phenotype, but also identified the mutation site and confirmed that the mutated gene was the ApaH gene, named 2016 / HB64-TB76. The ApaH gene of this mutant strain was inactivated due to the insertion of transposon Tn5, and did not cause any clinical symptoms or lesions in SPF chickens.
[0022] (2) The attenuated mutant strain 2016 / HB64-TB76 of Avian bacillus provided by the present invention has an 80% immune protection rate against serum type A Avian bacillus, and therefore can be used as a candidate strain for attenuated live vaccine of Avian bacillus for the prevention and control of infectious rhinitis. Attached Figure Description
[0023] Figure 1 This is a diagram showing the results of PCR identification of the kanamycin resistance gene in mutant strains in an embodiment of the present invention;
[0024] Figure 2 This is a graph showing the results of the biofilm formation ability test of the mutant strain in this embodiment of the invention;
[0025] Figure 3 The image shows the electrophoresis results of the third round of PCR products during chromosome walking in this embodiment of the invention (A) and a schematic diagram of the transposon insertion site (B).
[0026] Figure 4 This is a graph showing the growth curve measurement results of the mutant strain in an embodiment of the present invention;
[0027] Figure 5 This is a line graph showing the clinical symptom score of the pathogenicity test of the mutant strain in this embodiment of the invention. Detailed Implementation
[0028] The present invention will be further described below with reference to the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and should not be used to limit the scope of protection of the present invention.
[0029] Example 1: Construction of a random mutant library of Tn5 transposon from Avianella paraggis
[0030] Transposons are mobile DNA components in the genomes of many prokaryotes and eukaryotes. They can replicate independently from their original location or break off, circularize, and insert into other sites in the genome, leading to gene mutations. The insertion site of a transposon into the genome is random. This random insertion can directly or indirectly cause gene rearrangements or mutations. This characteristic can be used to construct bacterial transposon mutation libraries, where each mutant strain contains at least one insertion mutation at a random location in its genome.
[0031] Based on the foregoing, this embodiment provides a method for constructing a random mutant library of *Avianobacter paragallinarum* transposon Tn5, the specific steps of which are as follows:
[0032] Step 1: Prepare the Tn5 transposon by combining the transposon Tn5-kan with EZ-Tn5 transposase.
[0033] Step 2: Prepare competent cells of *Avianobacterium paragallinarum* 2016 / HB64 using M-IV medium. Add 1 μg of Tn5 transposons to 1 mL of *Avianobacterium paragallinarum* 2016 / HB64 competent cells and incubate at 37°C (100 r / min) for 30 min. Add 2 mL of TSB liquid medium and continue culturing at 220 r / min for 100 min. Then centrifuge at 4000 r / min for 10 min to enrich the cells. Discard the supernatant and resuspend the cells. Spread them on TSA medium containing 10 μg / mL kanamycin and culture for 24 h.
[0034] Step 3: Randomly select 20 transformants from the culture medium and perform PCR identification using primers Kan-F and Kan-R to determine whether transposon Tn5 has successfully inserted into the genome of *Avianobacter paragallinarum* 2016 / HB64. Results are shown below. Figure 1 .from Figure 1 The results show that all mutant strains exhibited bands of the same size as the positive control, proving that the transposon Tn5 successfully inserted into the genome.
[0035] Step 4: Collect all colonies on the culture medium and construct a random mutant library of transposons Tn5 with a capacity of approximately 3000.
[0036] The nucleotide sequence of transposon Tn5 in step 1 is shown in SEQ ID NO.1, the nucleotide sequence of primer Kan-F in step 3 is shown in SEQ ID NO.2, and the nucleotide sequence of primer Kan-R is shown in SEQ ID NO.3.
[0037] SEQ ID NO.1:
[0038]
[0039] SEQ ID NO.2: atgattgaacaagatggattgcacg;
[0040] SEQ ID NO. 3: aaggcggcggtggaatcgaaatctc.
[0041] Example 2: Screening and identification of the 2016 / HB64-TB76 mutant strain
[0042] The biofilm-forming ability of strains from the Tn5 transposon random mutant library was determined using crystal violet staining. A mutant strain 2016 / HB64-TB76 with significantly reduced biofilm formation was screened. The staining results are shown in the figure. Figure 2 The results showed that the biofilm formation ability of 2016 / HB64-TB76 was significantly reduced.
[0043] The insertion sites of the mutant strains were identified using the Genome Walking kit via SPF1, SPF2, and SPF3 assays. Electrophoresis results are shown below. Figure 3 A. Sequencing revealed the gene at the mutation site to be ApaH, which is 825 bp in length with a transposon insertion position of 337 bp. This gene encodes a protein of 275 amino acids, predicted to belong to the Metallophos protein family. (See the insertion diagram below.) Figure 3 B.
[0044] The nucleotide sequence of SPF1 is shown in SEQ ID NO.4, the nucleotide sequence of SPF2 is shown in SEQ ID NO.5, and the nucleotide sequence of SPF3 is shown in SEQ ID NO.6.
[0045] SEQ ID NO.4: gcttgccgaatatcatggtgga;
[0046] SEQ ID NO.5: attcgcagcgcatcgccttctatc;
[0047] SEQ ID NO. 6: cgcccaacctgccatcacgagattt.
[0048] Example 3: Growth curve and pathogenicity determination of the 2016 / HB64-TB76 mutant strain
[0049] Cultivate to OD 600 The 2016 / HB64 parental strain with a value of 1 and the 2016 / HB64-TB76 mutant strain were inoculated into TSB medium at a ratio of 1:100, and the OD was measured every 1 hour. 600Numerical values were used to plot growth curves for the 2016 / HB64 parental strain and the 2016 / HB64-TB76 mutant strain. Results are shown below. Figure 4 It can be seen that the growth performance of the 2016 / HB64-TB76 mutant strain showed a certain degree of decline, but the difference was not significant. This demonstrates that the reduced biofilm formation ability caused by the deletion of the ApaH gene affected the growth performance of the mutant strain.
[0050] The concentration of the 2016 / HB64-TB76 mutant bacterial culture was adjusted to 1×10⁻⁶. 7 CFU / mL, 28-day-old SPF chickens were challenged with the virus via nasal drops at a dose of 1×10⁻⁶. 6 CFU / animal, observed for 7 days after challenge. Clinical symptom score is shown in [link to clinical symptom score]. Figure 5 Clinical symptom scores indicated that the 2016 / HB64 parent strain was highly pathogenic, while the chickens challenged with the 2016 / HB64-TB76 mutant strain showed no clinical symptoms. The necropsy results are summarized in Table 1. The chickens challenged with the 2016 / HB64 parent strain showed severe lesions in the infraorbital sinus and trachea, while the chickens challenged with the 2016 / HB64-TB76 mutant strain showed no necropsy lesions.
[0051] Table 1 Summary of autopsy results
[0052]
[0053] Example 4: Evaluation of the immunoprotective effect of the 2016 / HB64-TB76 mutant strain
[0054] The concentration of the 2016 / HB64-TB76 mutant bacterial culture was adjusted to 1×10⁻⁶. 9 CFU / mL, which is the live attenuated vaccine for avian bacillus paragallinarum, is administered via nasal drops to 28-day-old SPF chickens (1×10⁻⁶). 8 CFU / Yu).
[0055] Two weeks after immunization, patients were challenged with 2016 / HB64 via nasal drops at a dose of 1×10⁻⁶. 6 / bird. Clinical symptoms were observed and the protection rate was calculated. The results are shown in Table 2. Only 2 out of 10 SPF chickens in the immunized group showed clinical symptoms and necropsy lesions, and the vaccine protection rate was 80%.
[0056] Table 2. Immunoprotective effect of attenuated mutants
[0057] Group Immune strains Challenge strains Protection rate Immunogroup 2016 / HB64-TB76 mutant strain 2016 / HB64 80% control group PBS 2016 / HB64 0
[0058] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. An attenuated mutant strain of *Avianobacter paragallinarum*, characterized in that, Named 2016 / HB64-TB76, with accession number CCTCC NO:M 2023607.
2. The attenuated mutant strain of *Avianobacterium paragallinarum* according to claim 1, characterized in that, The mutant strain ApaH The gene is inactivated due to the insertion of transposon Tn5, the nucleotide sequence of which is shown in SEQ ID NO.
1.
3. The use of an attenuated mutant strain of *Avianobacterium paragallinarum* as described in claim 1 or 2 in the preparation of biological products for the prevention and control of infectious coryza in chickens.
4. A vaccine, characterized in that, Contains a bacterial count of 1×10 8 ~1×10 9 The attenuated mutant strain of *Avianobacterium paragallinarum* as described in claim 1 or 2, with a CFU / mL concentration.
Citation Information
Patent Citations
Protective antigen of avibacterium paragallinarum and expression and application of protective antigen
CN107529534A
Dual inactivated vaccine for chicken infectious rhinitis (type A + type B + type C) and orithobacterium rhinotrotracheale disease (type A)
CN110448690A