Corn gene z mereb211 and application thereof

Abstract

The present application relates to a kind of corn gene Zmereb211 and its application, it is related to plant genetic engineering technical field, the nucleotide sequence of the Zmereb211 gene is as shown in SEQ ID NO.1.The present application constructs recombinant plasmid and corn gene Zmere b211 is introduced into brassicaceae plant genome as the purpose gene, it is found that corn gene Zmereb211 overexpression can delay the flowering of brassicaceae plant while causing the leaf rolling of brassicaceae plant, it indicates that corn gene Zmereb211 is involved in the regulation of flowering and leaf shape of brassicaceae plant, the present application can provide gene resources for crop breeding.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a maize gene Zmereb211 and its applications. Background Technology

[0002] For most plants, flowering is a crucial life stage for reproduction and propagation, marking the transition from vegetative to reproductive growth. The timing of flowering is critical to plant reproduction; flowering too late may prevent the plant from completing its reproductive process before the optimal growth environment ends, while flowering too early may result in insufficient nutrient accumulation to support reproduction. Leaf morphology is a vital component of plant architecture, directly influencing photosynthetic rate, dry matter accumulation, and consequently, growth and development. Dynamic plant architecture is fundamental to plant adaptation to environmental changes, and dynamic leaf curling is a common, reversible response to water stress. Therefore, studying and editing genes related to flowering and leaf curling in plants has significant theoretical and practical value.

[0003] AP2 / ERF transcription factors all contain AP2 / ERF domains. Based on the number of AP2 / ERF domains and the presence of other domains, they are divided into five subfamilies: AP2, ethylene response factor (ERF), dehydration response element binding protein (DREB), RAV, and Soloist. AP2 family members mainly participate in the regulation of plant processes such as flowering and lateral root formation. The ERF subfamily can bind to the ethylene response element GCC-box, participating in the regulation of ethylene response and abiotic stress response. The CBF / DREB subfamily can bind to drought and low temperature response elements DRE / CRT, thereby inducing the expression of related genes, which greatly helps plants cope with abiotic stress. This family plays an important role in plant growth and development, as well as in responses to biotic and abiotic stresses. In recent years, there has been increasing research on the involvement of AP2 / ERF family proteins in plant growth and development and in stress responses. This study mainly focuses on the method of obtaining maize varieties that delay flowering due to the Zmereb211 gene, and the breeding of transgenic late-flowering and leaf-curling cruciferous varieties, providing assistance for future research on this type of transcription factor. Summary of the Invention

[0004] The purpose of this invention is to provide a maize gene Zmereb211 and its applications in order to solve the above-mentioned problems.

[0005] The present invention achieves the above objectives through the following technical solutions:

[0006] A maize gene Zmereb211, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] As a further optimization of the present invention, the maize variety is the B73 maize inbred line.

[0008] Application of a maize gene, Zmereb211, in regulating flowering time and leaf morphology in cruciferous plants.

[0009] As a further optimization of the present invention, overexpression of the maize gene Zmereb211 can delay the flowering period of cruciferous plants while causing leaf curling in cruciferous plants.

[0010] As a further optimization of the present invention, the cruciferous plant is Arabidopsis thaliana.

[0011] A recombinant plasmid obtained by transforming the maize gene Zmereb211 into the pCAMBIA 2300 vector.

[0012] A method for obtaining a transgenic late-flowering, curl-leaf cruciferous plant variety involves introducing the maize gene Zmereb211 as the target gene into the genome of a cruciferous plant for overexpression, thereby cultivating a transgenic late-flowering, curl-leaf cruciferous plant variety.

[0013] The beneficial effects of this invention are as follows:

[0014] This invention constructs a recombinant plasmid and introduces the maize gene Zmereb211 as the target gene into the genome of cruciferous plants. It was found that overexpression of the maize gene Zmereb211 can delay the flowering period of cruciferous plants and cause leaf curling. This indicates that the maize gene Zmereb211 is involved in the regulation of flowering period and leaf morphology of cruciferous plants. This discovery can provide gene resources for crop breeding and provides a reference for using the Zmereb211 gene to breed cruciferous plants with delayed flowering time and leaf curling. Attached Figure Description

[0015] Figure 1 This is a cloning diagram of the maize gene Zmereb211;

[0016] Figure 2 This is a schematic diagram of the pCAMBIA 2300 carrier structure;

[0017] Figure 3 This is a Western blot (WB) image of a Zmereb211 transgenic overexpressing plant.

[0018] Figure 4 Phenotypic diagrams (1 week, 2 weeks, 3 weeks) of Zmereb211 transgenic overexpressing plants (Zmereb211-83, Zmereb211-42) and wild-type plants (CK);

[0019] Figure 5 This is a phenotypic analysis of delayed flowering in Zmereb211 transgenic overexpressing plants (Zmereb211-83, Zmereb211-42) and wild-type plants (CK).

[0020] Figure 6 Figure 1 shows the leaf curl phenotype analysis of Zmereb211 transgenic overexpressing plants (Zmereb211-83, Zmereb211-42) and wild-type plants (CK). Detailed Implementation

[0021] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0022] 1. Materials

[0023] Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.

[0024] 2. Method

[0025] 2.1 Extraction of total RNA

[0026] (1) Prepare the mortar and grinding rod required for grinding the sample, and transfer them to a dry heat oven at 180℃ for dry heat sterilization for 8 hours; prepare enzyme-free and sterile 2mL and 1.5mL centrifuge tubes, blue pipette tips and yellow pipette tips; set the refrigerated centrifuge to 4℃ for pre-cooling, and place the 75% ethanol prepared by Trizol, chloroform:isoamyl alcohol (24:1), isopropanol and DEPC water on ice for pre-cooling;

[0027] (2) After the mortar is pre-cooled with liquid nitrogen, an appropriate amount of corn leaves from the B73 corn inbred line are transferred to the mortar and ground thoroughly and quickly until the leaves turn white-green. The leaves are then quickly transferred to a 2 mL centrifuge tube (about 1 / 4 to 1 / 3 of the tube volume), 1 mL of Trizol solution is added, and the mixture is thoroughly shaken and mixed using a vortex mixer (about 30 seconds). The mixture is then left to stand on ice for 10 minutes.

[0028] (3) Add 250 μL of pre-cooled chloroform:isoamyl alcohol (24:1) to the sample obtained in step (2) in a fume hood, shake vigorously for 30 seconds with a vortex mixer to mix thoroughly, and let stand on ice for 8 minutes.

[0029] (4) The sample obtained after step (3) is transferred to a pre-cooled 4°C refrigerated centrifuge and centrifuged at 12000r / min for 12min.

[0030] (5) Take 400-500 μL of the upper aqueous phase of the sample obtained in step (4) (generally take 400 μL, do not take the middle layer impurities) and transfer it to a new 1.5 mL centrifuge tube. Then add an equal volume (generally 400 μL) of pre-cooled isopropanol, invert the tube to mix thoroughly, and let it stand on ice for 8 min to allow the RNA to precipitate fully. Then transfer it to a pre-cooled 4℃ refrigerated centrifuge and centrifuge at 12000 r / min for 10 min.

[0031] (6) Discard the supernatant in the fume hood, add 1 mL of pre-cooled 75% ethanol (obtained in step (1)), vortex to mix, and centrifuge at 12000 r / min for 5 min.

[0032] (7) Repeat step (6) once;

[0033] (8) Discard the supernatant, centrifuge at 12000r / min for 2min at 4℃, transfer to a pre-sterilized clean bench, and use an RNase-free yellow pipette tip to remove the remaining ethanol solution.

[0034] (9) Dry in a clean bench (about 5 minutes). Do not turn on the air during the drying process. After drying, add 50 μL of RNase-Free water and mix with a pipette tip to fully dissolve the RNA. Store the RNA in a -80℃ refrigerator for later use.

[0035] 2.2 RNA reverse transcription to obtain cDNA

[0036] The reverse transcription reaction was performed using the Novizan Biotech Reverse Transcription Kit (323), strictly following the instructions. The specific steps are as follows:

[0037] 2.2.1 Genomic DNA Removal

[0038] Prepare the reaction solution (components as shown in Table 1) in RNase-free centrifuge tubes, gently mix with a pipette, and incubate at 42°C for 2 minutes.

[0039] Table 1. Components and dosage of the reaction solution

[0040] Reagent Name Dosage RNase-freeddH2O 16μl 4×gDNAwiperMix 4μl Template RNA (Total RNA) 1pg-1μg

[0041] 2.2.2 Prepare the reverse transcription reaction system and carry out the reverse transcription reaction.

[0042] Take 16 μl of the reaction solution obtained in step 2.2.1, add 4 μl of 5×HiScript III qRT SuperMix, and gently mix with a pipette. Perform reverse transcription. The specific temperature requirements for the reverse transcription reaction are shown in Table 2.

[0043] Table 2. Temperature and time of reverse transcription reaction

[0044] reaction temperature time (*)37℃ 45min 85℃ 5 seconds

[0045] Note: If the template has a complex secondary structure or a high GC region, the reaction temperature (*) can be increased to 50°C, which can help increase the yield.

[0046] The product after the reverse transcription reaction is completed is cDNA. The product should be stored at -20℃ but should be used within six months. If it is to be stored for a long period of time (more than six months), it should be aliquoted and stored at -80℃. In addition, cDNA should be protected from repeated freeze-thaw cycles to avoid degradation.

[0047] 2.3 Construction of recombinant plasmids

[0048] Primers were designed using homologous recombination to amplify the published maize gene Zmereb211 CDS sequence (as shown in SEQ ID NO.1, sequence source: gene number Zm00001eb100800) in the database. The PCR reaction system is shown in Table 3, and the PCR reaction procedure is shown in Table 4. Figure 1 As shown, the PCR product (the amplified maize gene Zmereb211 sequence) was detected by 0.1% agarose gel electrophoresis.

[0049] The PCR primer sequences are as follows:

[0050] SEQ ID NO.2: Zmereb211-F: ATCCTCTAGAGTCGACCTGCAGATGACCAAGAAGCTCATCTCCATC;

[0051] SEQ ID NO.3: Zmereb211-R: TAAAGCAGGGCATGCCTGCAGAAAACTAGACG CGGCGC

[0052] The cloned maize gene Zmereb211 CDS sequence was inserted into the following... Figure 2 The vector pCAMBIA 2300 shown is used to obtain the recombinant plasmid (pCAMBIA 2300-Zmereb211), which can then be transformed into Escherichia coli.

[0053] Table 3. PCR reaction system for target gene amplification.

[0054] Reagent Name Dosage 2×PhantaMaxMasterMix(DyePlus) 25μl SEQ ID NO.2: Upstream primer F (10 μM) 2μl SEQ ID NO.3: Downstream primer R (10 μM) 2μl cDNA 2μl GCenhance 5μl <![CDATA[ddH2O]]> 14μl Total (Overall System) 50μl

[0055] Table 4. PCR reaction procedure for target gene amplification.

[0056]

[0057] 2.4 Transformation of recombinant plasmids into Agrobacterium

[0058] (1) Take GV3101 Agrobacterium competent cells stored at -80℃ and let them partially melt at room temperature for a while. When they are in an ice-water mixture state, insert them into ice.

[0059] (2) Use a sterile pipette tip to draw 10 μL of the recombinant plasmid obtained in step 2.3 above and add it to 50 μL of competent cells. Mix well by tapping the bottom of the tube with your hand and place on ice for 5 min.

[0060] (3) Place it in liquid nitrogen for quick freezing for 5 minutes, then heat shock it in a 37°C water bath for 5 minutes, and finally place it on ice for 5 minutes;

[0061] (4) Add 350 μL of antibiotic-free YEB liquid medium and incubate at 28℃ with shaking at 200 r / min for 2-3 h;

[0062] (5) Centrifuge at 6000 r / min for 1 min to collect the bacteria, discard part of the supernatant, and keep 100 μL to resuspend the bacterial block with a pipette. Spread it evenly on LB (50 μg / mL Kan, 50 μg / mL Rlif) solid medium and incubate upside down at 28℃ for 2-3 days. Resistant colonies will grow. Verify the colonies by PCR, shake the bacteria, and propagate to obtain Agrobacterium tumefaciens containing recombinant plasmids. Store for later use.

[0063] 2.5 Obtaining Transgenic Arabidopsis

[0064] Arabidopsis thaliana belongs to the Brassicaceae family, Angiosperms, and Dicotyledons. Its advantages include small plant size and high seed production. The Arabidopsis genome is the smallest known plant genome. It is a self-pollinating plant with highly homozygous genes. In maize breeding, Arabidopsis thaliana, a model plant in the same family, is often used as the initial research subject because the two share similar morphological and structural characteristics and exhibit similar molecular regulatory mechanisms in many developmental processes.

[0065] 2.5.1 Sterilization treatment of Arabidopsis thaliana seeds

[0066] Take an appropriate amount of Colombian wild-type Arabidopsis thaliana seeds into a 2.0 mL centrifuge tube, add 12% Kao solution in a clean bench and treat for 10 min. During this time, the centrifuge tube needs to be continuously inverted and shaken to ensure that the seeds are fully in contact with the disinfectant. Remove the 12% Kao solution from the centrifuge tube and wash with sterile water 6-8 times, shaking thoroughly for 1-2 min each time. After washing, add an appropriate amount of sterile water and place the Arabidopsis thaliana seeds at 4℃ in the dark for 3 days for vernalization.

[0067] 2.5.2 Cultivation of Wild-type Arabidopsis thaliana

[0068] 1) After vernalization, the seeds were evenly sown on 1 / 2 MS solid medium (Ms 2.2g, MES 0.5g, sucrose 10g; pH adjusted to 5.7-5.8 with NaOH) and placed vertically in an artificial climate chamber for growth at 25℃ with 16h light / 8h dark light.

[0069] 2) Mix vermiculite and sieved black soil after high-pressure sterilization in a volume ratio of 3:1, and divide them into small square basins (7cm×7cm×10cm). Place the basins in a tray and add tap water to the bottom of the tray to allow the nutrient soil and vermiculite to slowly soak and moisten.

[0070] 3) When the Arabidopsis thaliana has grown for 6-8 days and the roots are about 6cm long, open the culture dish and gently transplant the Arabidopsis thaliana into the prepared nutrient soil (obtained in step 2) with tweezers. Be careful not to damage the roots. Press down the roots of the Arabidopsis thaliana with an appropriate amount of soil and cover with plastic wrap to prevent the seedlings from losing water.

[0071] 4) One week later (e.g.) Figure 4 As shown in the image, once the seedlings have stabilized, the plastic wrap can be removed to allow them to grow normally. Water and fertilize them as needed, and take precautions against pests and diseases. When Arabidopsis thaliana flowers, inoculate them with the plastic wrap.

[0072] 2.5.3 Agrobacterium infection in Arabidopsis thaliana

[0073] 1) After activating the Agrobacterium tumefaciens bacterial suspension containing recombinant plasmid (obtained in step 2.4), take 500 μl to 50 mL of liquid LB medium containing antibiotics (kanamycin, rifampin) for expansion culture, and incubate in the dark at 28℃ and 220 rpm for 36-48 h.

[0074] 2) Collect the bacterial culture in a 50mL centrifuge tube, centrifuge at 3000rpm for 10min at room temperature, and discard the supernatant;

[0075] 3) Add 15 mL of Arabidopsis thaliana transformation buffer (Ms 0.22 g, MES 0.05 g, sucrose 5 g, silwetl 730 μl), fully suspend the bacterial cells and mix well;

[0076] 4) Use a Pasteur dropper to draw a certain amount of suspension and drop it onto the stigmas of Arabidopsis thaliana that are about to flower (obtained in step 2.5.2). After the infection is completed, cover the infected plants with a black plastic bag and remove it after 24 hours.

[0077] 5) The growth of Arabidopsis thaliana may deteriorate after infection, so timely watering and fertilization are necessary, and attention should be paid to preventing diseases and pests.

[0078] 6) When most of the Arabidopsis thaliana pods have matured and turned yellow, stop watering and harvest the T0 generation transgenic seeds.

[0079] 2.5.4 Screening of transgenic positive lines of Arabidopsis thaliana

[0080] T0 generation transgenic Arabidopsis seeds (OE-Zmereb211) and control group (WT group) Arabidopsis seeds were disinfected, vernalized, and then evenly sown on 1 / 2 MS solid medium containing 50 mg / L kanamycin. They were placed vertically in an artificial climate chamber for growth at 25°C with 16 h light / 8 h dark light. After 7-10 days of growth in the greenhouse, Arabidopsis seedlings that grew normally on the plate were considered transgenic positive seedlings and were transplanted into nutrient soil. When the transgenic positive seedlings were about to flower, 1-2 leaves were taken from each plant to extract DNA for PCR verification, and protein was extracted for Western blotting verification.

[0081] (I) The steps for extracting endogenous total protein from transgenic plants are as follows:

[0082] 1) Take the tender leaves of the above-mentioned transgenic Arabidopsis thaliana (OE-Zmereb211) and the control group (WT group), put them into a 2mL centrifuge tube, add steel balls, liquid nitrogen, and quick freeze;

[0083] 2) Vibrate and grind the blades until they are in powder form;

[0084] 3) Add 80ul of extraction buffer (at a rate of 1g / ml) and continue to mix thoroughly;

[0085] 4) Add 20ul of 5X protein loading buffer, mix thoroughly, centrifuge at 4°C for 5 minutes, and boil in a metal bath at 99°C for 10 minutes.

[0086] (II) The experimental steps for protein gel electrophoresis are as follows:

[0087] The endogenous total protein extracted in step (I) was used to perform a protein gel electrophoresis experiment. The specific steps are as follows:

[0088] 1) Clip the front and back plates of the washed and dried protein glue plate together, ensuring that the bottom edges of the front and back plates are flush.

[0089] 2) Prepare the separating gel and stacking gel using the YARN PAGE Gel Rapid Preparation Kit (10%) (PG112). Insert the comb into a clean, dry comb. After about 30 minutes, the stacking gel will solidify. At this point, you can remove the comb, load the sample, and run the gel.

[0090] 3) Clamp the protein gel in the electrophoresis tank, add 1X Tris-Gly buffer to the inner and outer tanks, and use a pipette to add the sample to the wells. Basically, add 10ul of sample to each well of a 1.0mm protein gel plate.

[0091] 4) Close the lid of the electrophoresis tank, connect the power cord to the electrophoresis apparatus, turn on the electrophoresis apparatus, adjust the voltage to 80V, and start running the gel. After the blue loading buffer of the sample enters the separating gel, adjust the voltage to 120V.

[0092] 5) After electrophoresis, the results are observed by Western blot (immunoblotting or protein blotting).

[0093] (III) The experimental steps of Western blot (immunoblotting, protein blotting) are as follows:

[0094] 1) Cut a suitable PDVF membrane according to the size of the gel obtained in step (II), soak the membrane and transfer filter paper in methanol for 30 seconds, then soak the membrane and filter paper in membrane transfer buffer, peel the protein gel from the front and back plates and assemble the protein transfer, and transfer the membrane using the Tianneng SEMI-DRYTRANSFER CELL semi-dry transfer tank.

[0095] 2) Open the safety cover of the VE 386 transfer electrophoresis tank and remove the cathode device with the stainless steel plate on the top layer;

[0096] 3) Lay a sheet of thickened filter paper soaked in membrane transfer buffer flat on the platinum plate of the anode device. Place the balanced membrane on the laid filter paper, aligning it with the edge of the filter paper, and remove any air bubbles between the membrane and the filter paper.

[0097] 4) Carefully spread the balanced gel on the membrane, aligning it with the edge of the membrane, and remove any air bubbles between the gel and the membrane. Finally, lay a moistened filter paper flat on the gel, aligning it with the edge of the gel, and remove any air bubbles between the gel and the filter paper. Close the lid of the electrophoresis tank, connect the power cord to the electrophoresis apparatus, turn on the electrophoresis apparatus, adjust the voltage to 80V, and start running the gel. Once the blue loading buffer of the sample enters the separating gel, adjust the voltage to 120V.

[0098] 5) Align the four guide holes on the stainless steel cathode plate with the guide posts on the platinum plate, carefully place it on the sandwich while keeping it horizontal, cover it with the protective cover, and plug the power cord of this device into the electrophoresis apparatus, 20V for 25min.

[0099] 6) After the transfer is complete, turn off the power, take out the hybridization membrane and place it in the antibody incubation box, paying attention to the direction of the membrane, with the protein side facing up. Add 20ml of milk blocking buffer, place the antibody incubation box on the transfer and decolorization shaker and shake slowly at room temperature for 1-2 hours.

[0100] 7) Remove the milk blocking buffer and rinse the hybridization membrane twice with TBST buffer to remove any residual milk blocking buffer.

[0101] 8) Dilute the flag primary antibody at a ratio of 1:5000, add 6 ml of the diluted primary antibody, place the antibody incubation box on a transfer and decolorization shaker and shake gently, incubate overnight at 4°C;

[0102] 9) Dilute the flag secondary antibody at a ratio of 1:5000, add 6 ml of the appropriate amount of secondary antibody, and incubate on a shaker at room temperature for 1-2 hours for transfer and decolorization.

[0103] 10) Remove the secondary antibody, add TBST buffer to wash the membrane, place the antibody incubation cassette on the transfer and decolorization shaker and shake rapidly for 8 minutes, then replace the TBST buffer; repeat this process a total of 4 times.

[0104] 11) Add 1 ml of each chemiluminescent substrate, mix and incubate for 1 minute, then take a picture. Figure 3 It can be seen that the target gene was successfully expressed in the plant. The internal control used was GAPDH, with a protein size of 36 kDa, and OE-PCAMBIA2300-Zmereb211, with a protein size of 60.1 kDa.

[0105] 2.6 Identification Experiment of Late Flowering and Leaf Curling in Transgenic Plants

[0106] Transgenic positive seedlings (Zmereb211-83, Zmereb211-42) and wild-type (CK) were cultured and allowed to grow normally according to method 2.5.2. Twelve transgenic positive seedlings and 12 wild-type seedlings were observed for phenotypic development. Details are as follows: Figure 4-6 As shown.

[0107] Experimental conclusion: Compared with the wild type (CK), the transgenic Arabidopsis lines (Zmereb211-83, Zmereb211-42) that overexpressed the maize gene Zmereb211 showed significantly later flowering and leaf curling phenotypes, which proves that the overexpression of the maize gene Zmereb211 has the effect of causing later flowering and leaf curling in cruciferous plants.

[0108] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A maize gene Zmereb211 Its application in regulating the flowering period and leaf morphology of cruciferous plants is characterized by... The corn gene Zmereb211 The nucleotide sequence is shown in SEQ ID NO.1, and the maize gene is overexpressed. Zmereb211 To delay the flowering period of cruciferous plants and cause leaf curling in cruciferous plants; the cruciferous plant is Arabidopsis thaliana.

2. A method for obtaining a transgenic late-flowering, curl-leaf type cruciferous plant variety, characterized in that, The maize gene in claim 1 Zmereb211 The target gene was introduced into the genome of a cruciferous plant and overexpressed to cultivate a transgenic late-flowering, curl-leaf type cruciferous plant variety; the cruciferous plant was Arabidopsis thaliana.

Images