Application of GmSIG1 gene in regulating soybean plant type
By cloning and functionally studying the GmSIG1 gene, and using the CRISPR-Cas9 system to edit soybean plant height and petiole angle, the problem of lodging in soybeans under high-density planting conditions was solved, achieving the effect of short stalks and high yield.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NANJING AGRICULTURAL UNIVERSITY
- Filing Date
- 2024-04-10
- Publication Date
- 2026-06-19
AI Technical Summary
In existing technologies, soybeans are prone to lodging and reduced yield under high-density planting conditions. There is a lack of short-stemmed, high-density-tolerant, and high-yielding varieties, and no research on the GmSIG1 gene has been reported.
By cloning and functionally studying the GmSIG1 gene, the GmSIG1 gene was edited using the CRISPR-Cas9 system to regulate soybean plant height and petiole angle, and recombinant expression vectors were constructed to overexpress or reduce the content and activity of GmSIG1 protein.
To obtain plant varieties with short stalks and reduced petiole angles under suitable dense planting conditions, thereby improving soybean yield and lodging resistance.
Smart Images
Figure CN118126150B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the application of the GmSIG1 gene in regulating soybean plant architecture. Background Technology
[0002] Soybeans are an important dual-purpose crop for both grain and oil. In recent years, my country's soybean demand has remained at around 110 million tons, with nearly 90 million tons imported annually, resulting in a dependence on imports exceeding 85%. The main problems facing my country's soybean industry are limited arable land and low yields. my country's effective arable land area is approximately 1.8 billion mu (120 million hectares). While ensuring the planting areas of the three major staple crops—rice, wheat, and corn—the annual soybean planting area is only about 120-150 million mu (8.7-11 million hectares), which is limited. Currently, increasing soybean yields without increasing the planting area mainly involves two measures: reasonable close planting and intercropping. Under these conditions, plants will induce a shade-avoidance response due to mutual shading, exhibiting traits such as stem elongation and thinning, leading to increased lodging and reduced yields. Therefore, cultivating short-stalked, high-yielding soybean varieties is of great significance.
[0003] Transcriptomic analysis was performed on Williams 82 soybeans grown under different density conditions to identify genes related to high-density planting. The GmSIG1 gene was found to be significantly induced under high-density planting conditions. The GmSIG1 protein contains a ring-finger domain. To date, no studies on the soybean GmSIG1 gene have been reported. Therefore, cloning and functional studies of the GmSIG1 gene are of great significance. Summary of the Invention
[0004] The purpose of this invention is to provide an application of the soybean GmSIG1 gene in regulating soybean plant height and petiole angle.
[0005] To achieve the objectives of this invention, the following technical solutions can be used.
[0006] This invention first protects the use of any of the following substances in regulating soybean plant architecture:
[0007] (1) Soybean GmSIG1 gene;
[0008] (2) Soybean GmSIG1 protein;
[0009] (3) Recombinant expression vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the soybean GmSIG1 gene;
[0010] The amino acid sequence of the transcription factor GmSIG1 is as follows (A1) or (A2):
[0011] (A1) A protein consisting of the amino acid sequence described in SEQ ID NO.2 of the sequence listing;
[0012] (A2) A protein derived from (A1) with the same function as the amino acid sequence described in SEQ ID NO.2 in the sequence listing, by substitution and / or deletion and / or addition of one or more amino acid residues;
[0013] The nucleotide sequence of the soybean GmSIG1 gene is shown in SEQ ID NO.1 in the sequence listing.
[0014] In a specific implementation plan, the plant type includes plant height and petiole angle, etc.
[0015] In specific terms,
[0016] Firstly, this invention protects the use of any of the following substances to regulate soybean plant height:
[0017] (1) Soybean GmSIG1 gene;
[0018] (2) Soybean GmSIG1 protein;
[0019] (3) Recombinant expression vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the soybean GmSIG1 gene;
[0020] The amino acid sequence of the transcription factor GmSIG1 is as follows (A1) or (A2):
[0021] (A1) A protein consisting of the amino acid sequence described in SEQ ID NO.2 of the sequence listing;
[0022] (A2) A protein derived from (A1) with the same function as the amino acid sequence described in SEQ ID NO.2 in the sequence listing, by substitution and / or deletion and / or addition of one or more amino acid residues;
[0023] The nucleotide sequence of the soybean GmSIG1 gene is shown in SEQ ID NO.1 in the sequence listing.
[0024] In the specific implementation plan, regulating soybean plant height refers to increasing or decreasing soybean plant height.
[0025] Secondly, this invention protects the use of any of the following substances in regulating the petiole angle (angle) in the soybean shade avoidance response:
[0026] (1) Soybean GmSIG1 gene;
[0027] (2) Soybean GmSIG1 protein;
[0028] (3) Recombinant expression vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the soybean GmSIG1 gene;
[0029] The protein GmSIG1 is either (A1) or (A2) as follows:
[0030] (A1) A protein consisting of the amino acid sequence described in SEQ ID NO.2 of the sequence listing;
[0031] (A2) A protein derived from (A1) with the same function as the amino acid sequence described in SEQ ID NO.2 in the sequence listing, by substitution and / or deletion and / or addition of one or more amino acid residues;
[0032] The nucleotide sequence of the soybean GmSIG1 gene is shown in SEQ ID NO.1 in the sequence listing.
[0033] In a specific implementation plan, adjusting the petiole angle refers to decreasing / increasing the petiole angle.
[0034] Fourthly, this invention protects the use of any of the following substances in plant breeding:
[0035] (1) Soybean GmSIG1 gene;
[0036] (2) Soybean GmSIG1 protein;
[0037] (3) Recombinant expression vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the GmSIG1 gene;
[0038] The amino acid sequence of the protein GmSIG1 is as follows (A1) or (A2):
[0039] (A1) A protein consisting of the amino acid sequence described in SEQ ID NO.2 of the sequence listing;
[0040] (A2) A protein derived from (A1) with the same function as the amino acid sequence described in SEQ ID NO.2 in the sequence listing, by substitution and / or deletion and / or addition of one or more amino acid residues;
[0041] The nucleotide sequence of the soybean GmSIG1 gene is shown in SEQ ID NO.1 in the sequence listing.
[0042] In a specific implementation plan, the plant is a dicotyledonous plant.
[0043] Preferably, the dicotyledonous plant is a legume, specifically soybean.
[0044] In a specific implementation plan, the purpose of soybean breeding is to increase / decrease soybean plant height and decrease / increase petiole angle.
[0045] In a specific implementation, the soybean GmSIG1 protein further includes a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein described in (A1) or (A2) above.
[0046] To facilitate the purification or detection of the protein in (A1), a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in SEQ ID NO.2 in the sequence listing.
[0047] The soybean GmSIG1 protein mentioned above can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.
[0048] The vectors described herein are known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cos plasmids), Ti plasmids, or viral vectors.
[0049] Fifthly, the present invention protects a method for reducing soybean plant height and / or decreasing petiole angle: the method includes reducing the content and / or activity of soybean GmSIG1 as described above;
[0050] Preferably, the reduction of the content and / or activity of the transcription factor GmSIG1 mentioned above is achieved by editing the gene encoding GmSIG1 using the CRISPR-Cas9 system.
[0051] The nucleotide sequence of the gRNA targeting the GmSIG1 encoding gene in the CRISPR-Cas9 system described above is: GmSIG1-gRNA1: TAACCGACCGGAAAACCCATCGG,
[0052] GmSIG1-gRNA2:TTTCCGATGGGTTTCCGGTCGG,
[0053] GmSIG1-gRNA3:GGAGTCTCCGAACTTGGCGACGG and
[0054] GmSIG1-gRNA4:GGTGGAGGAGGAAGAATACGAGG.
[0055] The GmSIG1 gene was edited using the CRISPR-Cas9 system. It was found that the GmSIG1 mutation resulted in reduced soybean plant height and decreased petiole angle under shaded conditions.
[0056] Sixthly, the present invention protects a method for increasing soybean plant height and / or increasing the petiole angle:
[0057] The method includes increasing the content and / or activity of the transcription factor GmSIG1 mentioned above;
[0058] The increase in the content and / or activity of GmSIG1 mentioned above is achieved by increasing the expression level of the GmSIG1 gene.
[0059] In a specific implementation, the increase in the expression level of the GmSIG1 gene is achieved by transferring a recombinant plant expression vector that overexpresses GmSIG1 into the plant.
[0060] The recombinant plant expression vector overexpressing GmSIG1 was transferred into the soybean cultivar Williams 82 (hereinafter referred to as Wm82) using transgenic technology to increase the expression level of GmSIG1 in soybean. It was found that after GmSIG1 overexpression, the soybean plant height increased significantly; under shaded conditions, the petiole angle increased.
[0061] The recombinant plant expression vector was constructed using the following method: the GmSIG1 gene fragment was constructed into the JRH0641 vector through homologous recombination to obtain the recombinant plant expression vector.
[0062] The significant advantages of this invention are:
[0063] This invention provides, for the first time, the application of the protein encoded by the GmSIG1 gene in regulating soybean plant height and petiole angle. Therefore, this invention can yield plant lines with short stature and reduced petiole angles under suitable dense planting conditions, and has significant application value. Attached Figure Description
[0064] Figure 1 This is the gene editing form of the soybean gmsig1 mutant of the present invention.
[0065] Figure 2 This is a schematic diagram illustrating the detection of transcriptional and protein expression levels in the soybean GmSIG1-Myc transgenic line of this invention.
[0066] Figure 3 This is a graph showing the plant height and statistical results of soybeans after GmSIG1 mutation and overexpression under greenhouse conditions according to the present invention.
[0067] Figure 4 This is a schematic diagram showing the main stem height, petiole length, and angle of soybean after GmSIG1 mutation and overexpression under white light and low red / far-red light ratios.
[0068] Figure 5 This is a statistical result of the main stem height, petiole length, and angle of soybean after GmSIG1 mutation and overexpression under white light and low red / far-red light ratios. Detailed Implementation
[0069] To make the content of this invention easier to understand, the technical solution of this invention will be further described below with reference to specific embodiments, but this invention is not limited thereto.
[0070] Unless otherwise specified, all experimental materials used in the following examples were purchased from routine biochemical reagent stores. The determination of vector sequencing in the following examples was performed by routine sequencing companies.
[0071] The soybean (Glycine max) variety Wm82 was provided by the National Center for Soybean Improvement.
[0072] The gene editing vector used in this invention is pCas9, and the overexpression vector is JRH0641, both provided by the National Center for Soybean Improvement.
[0073] Example 1: Construction of plant expression vector for soybean GmSIG1 gene mutant.
[0074] This invention provides primers for constructing expression vectors, comprising primers for amplifying guide RNA sequences:
[0075] GmSIG1-F1:GGATTGAACCGACCGGAAAACCCAT;
[0076] GmSIG1-R1:AAACATGGGTTTCCGGTCGGTTCA;
[0077] GmSIG1-F3:GGATTGTTCCGATGGGTTTTCCGGT;
[0078] GmSIG1-R3: AAACACCGGAAAACCCATCGGAACA;
[0079] GmSIG1-F5: GGATTGGAGTCTCCGAACTTGGCGA;
[0080] GmSIG1-R5: AAACTCGCCAAGTTCGGAGACTCCCA;
[0081] GmSIG1-F6: GGATTGGTGGAGGAGGAAGAATACG;
[0082] GmSIG1-R6: AAACCGTATTCTTCTCCTCCACCA.
[0083] Construction of recombinant plasmid PUC19-GmSIG1-gRNA
[0084] KOD Plus is a product of TOYOBO.
[0085] 1. Obtaining gRNA fragments
[0086] (1) Prepare reaction system 1-4.
[0087] Reaction system 1 is 10 μL, consisting of 1 μL of GmSIG1-F1 primer aqueous solution (concentration 10 μM), 1 μL of GmSIG1-R1 primer aqueous solution (concentration 10 μM), and 8 μL of Anneal Buffer (TE buffer containing 50 mM NaCl for reaction);
[0088] Reaction system 2 is 10 μL, consisting of 1 μL of GmSIG1-F3 primer aqueous solution (concentration 10 μM), 1 μL of GmSIG1-R3 primer aqueous solution (concentration 10 μM), and 8 μL of Anneal Buffer (TE buffer containing 50 mM NaCl for reaction);
[0089] Reaction system 3 is 10 μL, consisting of 1 μL of GmSIG1-F5 primer aqueous solution (concentration 10 μM), 1 μL of GmSIG1-R5 primer aqueous solution (concentration 10 μM), and 8 μL of Anneal Buffer (TE buffer containing 50 mM NaCl for reaction);
[0090] Reaction system 4 consisted of 10 μL of 1 μL of GmSIG1-F6 primer aqueous solution (concentration 10 μM), 1 μL of GmSIG1-R6 primer aqueous solution (concentration 10 μM), and 8 μL of Anneal Buffer (TE buffer containing 50 mM NaCl for reaction).
[0091] (2) After completing step (1), take the reaction system 1-4 and perform annealing amplification. In the PCR instrument, slowly cool down from 95℃ to 16℃ (0.1℃ / s).
[0092] 2. Attach the target to the pUC19 vector.
[0093] (1) Prepare reaction system 5-8.
[0094] Reaction system 5 is 20 μL, consisting of 10 μL of reaction system 1, 1 μL of pUC19-1 digested with BsaI, 2 μL of 10×T4 buffer, 1 μL of T4 ligase, and 6 μL of ddH2O.
[0095] Reaction system 6 is 20 μL, consisting of 10 μL of reaction system 2, 1 μL of PUC19-3 digested with BsaI, 2 μL of 10×T4 buffer, 1 μL of T4 ligase, and 6 μL of ddH2O.
[0096] Reaction system 7 is 20 μL, consisting of 10 μL of reaction system 3, 1 μL of PUC19-5 digested with BsaI, 2 μL of 10×T4 buffer, 1 μL of T4 ligase, and 6 μL of ddH2O.
[0097] Reaction system 8 is 20 μL, consisting of 10 μL reaction system 4, 1 μL PUC19-6 digested with BsaI, 2 μL 10×T4 buffer, 1 μL T4 ligase and 6 μL ddH2O.
[0098] (3) After completing step (1), take 5-8 of the reaction system and transform the products into Escherichia coli DH5α competent cells (Tolu Harbor) to obtain several monoclonal cells.
[0099] (4) Using each single clone as a template, PCR amplification was performed using primer pairs consisting of primer M13R:5'-CAGGAAACAGCTATGAC-3' and GmSIG1-R1, GmSIG1-R3, GmSIG1-R5, and GmSIG1-R6, respectively. Clones containing the target fragment of 700 bp were sent for bacterial culture sequencing to obtain positive clones.
[0100] (5) Inoculate positive monoclonal antibodies into LB liquid medium and culture at 37°C to obtain bacterial culture; then extract plasmids from the bacterial culture, namely recombinant plasmids pUC19-GmSIG1-1, pUC19-GmSIG1-3, pUC19-GmSIG1-5 and pUC19-GmSIG1-6.
[0101] 3. Connect pUC19-GmSIG1-1, pUC19-GmSIG1-3, pUC19-GmSIG1-5, and pUC19-GmSIG1-6 to the pCas9 final carrier.
[0102] (1) Preparation of reaction system 9. Reaction system 9 is 20 μL and consists of 1 μL pCas9-adaptor vector (50 ng / μL), 2 μL pUC19-GmSIG1-1 (50 ng / μL), 2 μL pUC19-GmSIG1-3 (50 ng / μL), 2 μL pUC19-GmSIG1-5 (50 ng / μL), 2 μL pUC19-GmSIG1-6 (50 ng / μL), 1 μL AarI enzyme (thermo), 0.4 μL 50×oligo, 2 μL 10×T4 ligation buffer (NEB), 1 μL T4 ligase and 6.6 μL ddH2O.
[0103] (2) After completing step (1), take the reaction system 9 and carry out the connection reaction.
[0104] The reaction conditions were: 37℃ for 5 min, 25℃ for 10 min (15 cycles in total); 50℃ for 5 min, 80℃ for 10 min, and stored at 4℃.
[0105] (3) After completing step (2), the reaction product is transformed into Escherichia coli DH5α competent cells (Tolo Harbor) to obtain several monoclonal cells.
[0106] (4) Using a single clone as a template, PCR amplification was performed using primer pairs consisting of primers GmSIG1-F1 and GmSIG1-R5; and GmSIG1-F3 and GmSIG1-R6. Clones containing the target fragment of 700 bp were sent to bacterial culture for sequencing to obtain positive clones. Positive single clones were inoculated into LB liquid medium and cultured to obtain bacterial culture; then, the plasmid, i.e., the recombinant plasmid pCas9-GmSIG1, was extracted from the bacterial culture.
[0107] Based on the sequencing results, the structure of the recombinant plasmid pCas9-GmSIG1 is described as follows: The DNA molecule shown in SEQ ID NO.3 was inserted between the recognition sequence of the restriction endonuclease AarI of the vector pCas9 to obtain the recombinant plasmid.
[0108] Example 2. Construction of soybean GmSIG1 overexpression vector
[0109] Total RNA was extracted from tender leaves of soybean Wm82 seedlings and cDNA was synthesized using a reverse transcription kit.
[0110] This invention provides primers for constructing overexpression vectors, including primers for amplifying the target fragment and primers for fusion tags.
[0111] JRH0641-GmSIG1-XhoI-F: TGGAGAGCCACCATGCTCGAGATGGGTTTTCCGGTCGGTTA;
[0112] 4×Myc-R: AATCGATAACCGTCGCACCATGAAAGAAGAAGTGTA;
[0113] 4×Myc-F: TACACTTCTTCTTTCATGGTGCGACGGTATCGATT;
[0114] JRH0641-GmSIG1-SpeI-R:GCCTGGGGGAGGACCACTAGTGCCCAAGCTCTCCATTTCATT.
[0115] 1. Obtaining the GmSIG1-4×Myc fused CDS fragment, the fused CDS sequence is shown in SEQ ID NO.3.
[0116] (1) Preparation of reaction system 1. Reaction system 1 is 50 μL, consisting of 1 μL KOD Plus, 5 μL 10×PCR Buffer, 5 μL dNTP, 25 mM MgSO4, 1.5 μL primer JRH0641-GmSIG1-XhoI-F aqueous solution (concentration 10 μM), 1.5 μL primer 4×Myc-R aqueous solution (concentration 10 μM), 1 μL soybean cDNA and 34 μL ddH2O.
[0117] (2) After completing step (1), take the reaction system 1 and perform PCR amplification. The GmSIG1-4×Myc-1 fragment is recovered using an agarose gel recovery kit (Zhuangmeng International Biotechnology Co., Ltd.). The reaction program is as follows: 94℃ for 2 min; 94℃ for 15 s, 57℃ for 30 s, 68℃ for 30 s, 35 cycles; store at 12℃.
[0118] (3) Preparation of reaction system 2. Reaction system 2 is 50 μL, consisting of 1 μL KOD Plus, 5 μL 10×PCR Buffer, 5 μL dNTP, 25 mM MgSO4, 1.5 μL primer 4×Myc-F aqueous solution (concentration 10 μM), 1.5 μL primer JRH0641-GmSIG1-SpeI-R aqueous solution (concentration 10 μM), 1 μL soybean cDNA and 34 μL ddH2O.
[0119] (4) After completing step (3), take the reaction system 2 and perform PCR amplification. The GmSIG1-4×Myc-2 fragment is recovered using an agarose gel recovery kit (Zhuangmeng International Biotechnology Co., Ltd.). The reaction program is as follows: 94℃ for 2 min; 94℃ for 15 s, 57℃ for 30 s, 68℃ for 30 s, 35 cycles; store at 12℃.
[0120] 3. Digest the vector JRH0641 with the restriction endonucleases XhoI and SpeI, and recover the linearized vector.
[0121] The vector JRH0641 is described in the following literature: Lyu, X., Cheng, Q., Qin, C., Li, Y., Xu, X., Ji, R., Mu, R., Li, H., Zhao, T., Liu, J., Zhou, Y., Li, H., Yang, G., Chen, Q., and Liu, B. (2020). GmCRY1s Modulate Gibberellin Metabolism to Regulate Soybean Shade Avoidancein Response to Reduced Blue Light. Molecular Plant, 14(2), 298-314.
[0122] 3. Obtaining the ligation product
[0123] (1) Mix 1 μL of GmSIG1-4×Myc-1 fragment, 1 μL of GmSIG1-4×Myc-2 fragment, 0.5 μL of the vector backbone recovered in step 3 (50 ng) and 2.5 μL of 2×Uniclone Seamless Cloning Mix (Genesand, SC612) to obtain the ligation system.
[0124] (2) Take the connection system and react at 50°C for 30 min to obtain the connection product.
[0125] 4. The ligation product was transformed into Escherichia coli DH5α competent cells (Tolo Harbor) to obtain several single clones.
[0126] Each single clone was used as a template for bacterial culture PCR amplification and detection. Clones containing the 653bp target fragment GmSIG1-4×Myc were sent for bacterial culture sequencing, yielding positive clones.
[0127] 5. Inoculate positive monoclonal antibodies into LB liquid medium and culture to obtain bacterial culture; then extract plasmids from the bacterial culture, namely recombinant plasmid GmSIG1-4×Myc.
[0128] Based on the sequencing results, the structure of the recombinant plasmid GmSIG1-4×Myc is described as follows: The small DNA fragment between the recognition sequences of the restriction endonucleases XhoI and SpeI of the vector JRH0641 was replaced with the amino acid sequence encoding SEQ ID NO.4 to obtain the recombinant plasmid.
[0129] Example 3: Obtaining Transgenic Soybean Plants
[0130] 1. After constructing the recombinant plasmid and transforming Agrobacterium EHA105, soybean transformation was carried out.
[0131] 2. The recombinant plasmid was transformed into soybean variety Wm82 (hereinafter referred to as soybean). After screening, differentiation, and rooting, T0 generation transgenic soybean plants were obtained. The specific steps are as follows:
[0132] (1) Sterilize soybeans with chlorine gas produced by the reaction of 15 mL concentrated hydrochloric acid and 100 mL sodium hypochlorite for 2.5-3 hours. Remove the soybeans and dry them in a clean bench.
[0133] (2) Seed germination: Sow soybeans evenly in the germination medium, about 20-30 seeds per dish.
[0134] (3) Agrobacterium infection: Cut the soybean in half, remove part of the embryo tip, and make a wound in the meristematic area to obtain the soybean explant. Place it in a recombinant Agrobacterium bacterial solution with an OD of about 0.6 at 600 nm and shake at room temperature for 30 min. Take out the explant and blow it under sterile conditions for 10 min. Then spread it on a co-culture medium and incubate in the dark for 5 days.
[0135] (4) Wash the embryo 4-5 times with sterile water and liquid induction medium containing hormones to ensure that Agrobacterium is thoroughly cleaned. Cut off the elongated embryo, leaving only 3-4 mm. Insert the embryo downwards into the solid bud induction medium and incubate for 2 weeks in a 25°C incubator with 16 hours of light and 8 hours of darkness.
[0136] (5) After 15 days, some explants began to sprout. Those with sprouts were cut off from the stump and transferred to a new solid bud induction medium. Those without sprouts were discarded and continued to be cultured under light in the greenhouse.
[0137] (6) After 15 days, the explants that have sprouted were subcultured into a new solid bud induction medium. The explants that have not sprouted were discarded. The explants were cultured in the greenhouse for 15 days. The explants were cultured in the solid bud induction medium for a total of 30 days.
[0138] (7) Separate the well-grown callus from the bean, discard the explant, scrape off the black surface of the callus, and transfer it to a solid shoot elongation medium. Replace the solid elongation medium every 15 days, and generally subculture 4-5 times, for a total of 60-80 days. The callus is being screened while it is elongating, and seedlings will grow during the screening process.
[0139] (8) When the seedlings grow to about 4-5cm, cut them off from the callus and transfer them to the rooting medium.
[0140] (9) After culturing in the rooting medium for about 20-30 days, the seedlings that have grown strong and developed root systems can be transferred to a pure vermiculite environment in a disposable cup and placed in a low-light hardening environment. Use another disposable plastic cup to cover the seedlings to achieve the purpose of moisturizing. Generally, hardening takes 5 days.
[0141] (10) After a few days of adaptation, when you observe obvious root growth, remove the disposable cup used for moisturizing. Transfer it to a large pot containing nutrient soil and continue to cultivate it.
[0142] Example 3: Obtaining positive transgenic soybean plants and molecular identification of mutation types
[0143] To identify transgenic positive plants, fresh leaves of the T0 generation were taken, DNA was extracted, and PCR testing was performed.
[0144] For CRISPR knockout vectors, we detected their basta resistance gene and Cas9 protein. We then performed PCR amplification based on the location of their gRNA and sequenced the data.
[0145] For transgenic lines overexpressing GmSIG1, we detected their basta resistance gene and designed specific primers based on the recombinant vector to detect the insertion of T-DNA in the T0 generation plants. Positive plants were self-crossed twice to identify homozygosity, and the transcriptional and protein expression levels of GmSIG1 were simultaneously detected.
[0146] Sanger sequencing yielded gmsig1-1 and gmsig1-2 plants, neither of which contained the Cas9 protein. Sequencing results showed that, compared with the wild type, gmsig1-1 had the following mutation in both homologous chromosomes of the GmSIG1 gene: the “5'-ATGGGTTTTCCGGTCGGTT-3'” in the GmSIG1 gene, corresponding to positions 125-143 of SEQ ID NO.1, was mutated to “5'-ATGGGTGGTCGGTT-3'”. This mutation results in the deletion of the nucleotide "TTTCC" at positions 132-136 of SEQ ID NO. 1 in the sequence listing, causing a frameshift and premature termination of translation, leading to loss of function of the GmSIG1 protein and thus knocking out the GmSIG1 gene. Compared with the wild type, both homologous chromosomes of gmsig1-2 have the following mutation in the GmSIG1 gene: "5'-ATGGGTTTTCCGGTCGGTTACGTGGAGGTGTTCTTCCCGAACCCGTTCCTGCACACG CTGGCCCTCCTCGGCCTCCTCCGAAACCTCGTATTCTTCCTCTTCCACCTCCTCGGACTCTCCGACTTCTTCGAAACCGAGGTCGCCTGGCCGGACCCCCGCCCCTCAGACACGGCGGAGGCACGGCCCCCCTCCGTGTCGGCGCTCCTGATCCGGGACCTCCTGCCCGTCGCCAAGTTCGGA-3'" corresponds to SEQ ID NO. A mutation at positions 125-365 of SEQ ID NO.1, labeled “5'-ATGGGCCAAGTTCGGA-3'”, causes a deletion of nucleotides “5'-GTTTTCCGGTCGGTTACGTGGAGGTGTTCTTCCCGAACCCGTTCCTGCACACGCTGG CCCTCCTCGGCCTCCTCCGAAACCTCGTATTCTTCCTCTTCCACCTCCTCGGACTCTCCG ACTTCTTCGAAACCGAGGTCGCCTGGCCGGACCCCCGCCCCTCAGACACGGCGGAGGC ACGGCCCCCCTCCGTGTCGGCGCTCCTGATCCGGGACCTCCTGCCCGTC-3'”. This frameshift causes premature translation termination, resulting in loss of GmSIG1 protein function and thus knockout of the GmSIG1 gene. Sequencing results for these two mutation sites and their surrounding nucleotides are shown in [link to sequencing data]. Figure 1 As shown.
[0147] To identify GmSIG1 overexpression-positive plants, basta testing was performed on the leaves of individual T0 generation transgenic lines from Example 3. Plants with yellowing and wilting were considered false-positive transgenic plants. Protein was extracted from basta-resistant plants for transcriptional and Western blot analysis. Results showed that, compared to the wild type, GmSIG1 was expressed at higher transcriptional and protein levels in the overexpressing plants GmSIG1-4×Myc#8, GmSIG1-4×Myc#12, and GmSIG1-4×Myc#15. The results are as follows: Figure 2 As shown.
[0148] Example 5. Phenotypic identification of GmSIG1 loss-of-function mutant plants and transgenic soybean plants.
[0149] Seeds of two homozygous mutants of the GmSIG1 gene obtained in Example 4, the GmSIG1-4×Myc#15 transgenic overexpression line, and seeds of the wild-type soybean variety Wm82 were planted in a long-day artificial greenhouse in Nanjing. After the true leaves unfolded, the plants were transplanted. Significant differences in plant height were observed when the second trifoliate leaf was fully unfolded and the third trifoliate leaf had just opened. Plant height was recorded. The plant heights of the soybean mutants gmsig1-1 and gmsig1-2 were significantly lower than that of the wild-type Wm82 (P<0.05), while the plant height of the overexpression line GmSIG1-Myc#15 was significantly higher than that of Wm82 (P<0.05). Furthermore, the number of main stem nodes in both mutant and transgenic plants was not significantly different from that in the wild type. The results are shown in [Figure 1]. Figure 3 .
[0150] Example 6. Identification of plant type phenotype in shade avoidance response of GmSIG1 loss-of-function mutant plants and transgenic soybean plants.
[0151] Soybeans are highly sensitive to changes in the light environment. The two main factors causing soybeans to exhibit a shade-avoidance response in the field are a reduced R:FR ratio and low blue light. Therefore, we simulated the effects of low R:FR conditions on soybeans under laboratory conditions by supplementing white light with far-red light.
[0152] This experiment was conducted under two illumination conditions: white light (WL: photosynthetic photon flux density (PPFD) = 300 μmol m² / s²). -2 s -1 , R:FR=8.04, Blue=59μmol m -2 s -1 ) and shade conditions (WL+FR: maintain PPFD = 300 μmol m -2 s -1Without changing the value, by supplementing with far-red light, the R:FR value was reduced to 0.63, and Blue = 58.82 μmol m. -2 s -1 ).
[0153] Seeds of two homozygous mutants of the GmSIG1 gene obtained in Example 4, the GmSIG1-4×Myc#15 transgenic overexpression line, and seeds of the wild-type soybean variety Wm82 were planted in a long-day artificial greenhouse in Nanjing. After the true leaves unfolded, they were transplanted and treated under simulated shading conditions for 7 days. The main stem height and petiole angle were then measured. The results are shown below. Figure 4 The plant height of soybean mutants gmsig1-1 and gmsig1-2 was significantly lower than that of wild-type Wm82 (P<0.05), while the overexpressing plant GmSIG1-myc#15 showed the opposite, being significantly taller than Wm82 (P<0.05). The petiole angles of the penultimate and penultimate trifoliate leaves were analyzed. The results showed that the petiole angles of soybean mutants gmsig1-1 and gmsig1-2 were significantly smaller than those of Wm82 (P<0.05), while the overexpressing transgenic plants showed the opposite phenotype. (See attached table). Figure 5 .
[0154] The present invention has been described in detail above. The scope of protection of the present invention is not limited to the embodiments described above. Variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in the present invention and are protected by the appended claims.
Claims
1. Application of reducing the expression level of soybean GmSIG1 gene or GmSIG1 protein in reducing soybean plant height: The soybean GmSIG1 protein is a protein composed of the amino acid sequence described in SEQ ID NO. 2 of the sequence listing; The soybean GmSIG1 The nucleotide sequence of the gene is shown in SEQ ID NO. 1 in the sequence listing.
2. Application of reducing the expression level of soybean GmSIG1 gene or GmSIG1 protein in decreasing petiole angle in soybean shade avoidance response: The soybean GmSIG1 protein is a protein composed of the amino acid sequence described in SEQ ID NO. 2 of the sequence listing; The soybean GmSIG1 The nucleotide sequence of the gene is shown in SEQ ID NO. 1 in the sequence listing.
3. Application of reducing the expression level of soybean GmSIG1 gene or GmSIG1 protein in soybean breeding: The soybean GmSIG1 protein is a protein composed of the amino acid sequence described in SEQ ID NO. 2 of the sequence listing; The soybean GmSIG1 The nucleotide sequence of the gene is shown in SEQ ID NO. 1 of the sequence listing; The purpose of the soybean breeding is to reduce soybean plant height and decrease petiole angle.
4. A method for reducing soybean plant height and / or decreasing the petiole angle, characterized in that, The method comprises reducing the expression of the soybean GmSIG1 protein of claim 1 or GmSIG1 the amount of the gene.
5. The method of claim 4, wherein, said soybean GmSIG1 protein or GmSIG1 The expression amount of the gene is achieved by editing the coding gene of the GmSIG1 using a CRISPR-Cas9 system.
6. The method of claim 5, wherein, The nucleotide sequence of the gRNA targeting the GmSIG1 encoding gene in the CRISPR-Cas9 system is as follows: GmSIG1-gRNA1: TAACCGACCGGAAAACCCATCGG, GmSIG1-gRNA2: TTTCCGATGGGTTTTCCGGTCGG, GmSIG1-gRNA3:GGAGTCTCCGAACTTGGCGACGG and / or GmSIG1-gRNA4:GGTGGAGGAGGAAGAATACGAGG.