Application of Zkscan4 1-133 peptide in antidepressant

Abstract

The present invention discloses the application of Zkscan4 1‑133 peptide segment in antidepressant. The Zkscan4 1‑133 peptide segment disclosed in the present invention is as follows A1), A2) or A3): A1) the amino acid sequence is a protein at position 1‑133 of SEQ ID No.2; A2) the amino acid sequence shown at position 1‑133 of SEQ ID No.2 in the sequence table is replaced and / or deleted and / or added with one or more amino acid residues and has a protein with the same function; A3) a fusion protein obtained by connecting a label at the N-terminus or / and C-terminus of A1) or A2). The present invention finds that the Zkscan4 1‑133 peptide segment can inhibit the expression of 5‑hydroxytryptamine 2a receptor (Htr2a) in vivo, correct the synaptic dysfunction and animal depressive-like behavior caused by abnormal expression of Htr2a, and has a good application prospect.

Description

Technical Field

[0001] The present invention relates to application of Zkscan4 1-133 peptide segment in anti-depression in the field of biomedicine. Background Art

[0002] Major depressive disorder (MDD) is a common severe mental disorder characterized by significant and persistent low mood. The main clinical manifestations are persistent low mood, loss of interest, anhedonia, slow thinking and movement, accompanied by sleep disorders, loss of appetite, etc. MDD affects about 10% of the world's population and is one of the main causes of disability and suicide.

[0003] To date, the etiology of depression is far from clear. MDD is generally believed to be the result of the interaction between genetic and environmental factors. The pathogenesis of depression has not yet been elucidated. The insufficiency of central monoamine neurotransmitters (5-hydroxytryptamine and norepinephrine) is one of the most widely recognized hypotheses for depression. The antidepressant drugs currently used in clinical practice mostly work on enhancing the function of these neurotransmitters. The first-line antidepressant drugs mainly include selective serotonin reuptake inhibitors (SSRI, such as fluoxetine, paroxetine, citalopram and escitalopram), serotonin and norepinephrine reuptake inhibitors (SNRI, such as venlafaxine and duloxetine), monoamine receptor blockers (such as mirtazapine), monoamine oxidase inhibitors (MAOI, such as moclobemide), etc. In general, these drugs have slow onset, low antidepressant efficacy (the efficacy of a single drug is up to about 50%, and only 30% of patients can be completely relieved), large toxic side effects, high prices, and easy relapse. Ketamine, a rapid-acting antidepressant drug that has emerged in recent years, has the risk of addiction.

[0004] Studies have reported that the expression of 5-hydroxytryptamine 2A (5-HT2A) receptors in the brain and peripheral blood of patients with depression is significantly higher than that in normal people. The expression level of 5-HT2A receptors is significantly positively correlated with the severity of depression and the duration of depressive symptoms. The expression of 5-HT2A receptors in patients with depression treated with antidepressant drugs is significantly lower than before treatment, suggesting that downregulating 5-HT2A receptors or normalizing the signaling pathway mediated by 5-HT2A receptors may be the key to antidepressant treatment. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to treat depression.

[0006] In order to solve the above technical problems, the present invention first provides the use of a protein (named Zkscan4 1-133) in preparing a product for treating or preventing depression;

[0007] Zkscan4 1-133 is as follows A1), A2) or A3):

[0008] A1) a protein whose amino acid sequence is positions 1 to 133 of SEQ ID No. 2;

[0009] A2) a protein having the same function as the amino acid sequence shown in positions 1 to 133 of SEQ ID No. 2 in the sequence list, with one or more amino acid residues substituted and / or deleted and / or added;

[0010] A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

[0011] The protein in A2) is a protein having 75% or more identity with the amino acid sequence of the protein shown in positions 1-133 of SEQ ID No. 2 and having the same function. Identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page of the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gapcost and Lambda ratio to 11, 1 and 0.85 (default value) respectively, and searching for the identity of a pair of amino acid sequences for calculation, the identity value (%) can be obtained. The identity of 75% or more is 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%.

[0012] The protein in A2) above can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.

[0013] The gene encoding the protein in A2) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown at positions 1-399 of SEQ ID No.3, and / or performing missense mutation of one or several base pairs, and / or attaching a coding sequence of a tag at its 5′ end and / or 3′ end. The DNA molecule shown at positions 1-399 of SEQ ID No.3 encodes the protein shown at positions 1-133 of SEQ ID No.2.

[0014] The tag in A3) can be a polypeptide or protein fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag and / or SUMO tag, etc.

[0015] In order to solve the above technical problems, the present invention also provides the use of biomaterials related to Zkscan4 1-133 in the preparation of products for treating or preventing depression; the biomaterial is any one of the following B1) to B5):

[0016] B1) Nucleic acid molecule encoding Zkscan4 1-133;

[0017] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0018] B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0019] B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0020] B5) A transgenic cell line containing the nucleic acid molecule described in B1) or a transgenic cell line containing the expression cassette described in B2).

[0021] In the above application, the nucleic acid molecule in B1) may be the following b11) or b12) or b13) or b14) or b15):

[0022] b11) the coding sequence is the DNA molecule at positions 1 to 399 of SEQ ID No. 3 in the sequence list;

[0023] b12) the DNA molecule shown in positions 1 to 399 of SEQ ID No. 3 in the sequence listing;

[0024] b13) the DNA molecule shown in SEQ ID No. 3 in the sequence list;

[0025] b14) a DNA molecule having 75% or more identity with the nucleotide sequence defined in b11) or b12) or b13) and encoding Zkscan4 1-133;

[0026] b15) A DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in b11) or b12) or b13) or b14) and encodes Zkscan4 1-133.

[0027] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0028] Those skilled in the art can easily mutate the nucleotide sequence encoding the Zkscan4 1-133 protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of the Zkscan4 1-133 protein isolated from the present invention are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the Zkscan4 1-133 protein and have the function of the Zkscan4 1-133 protein.

[0029] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein composed of the amino acid sequence shown in the coding sequence 1 of the present invention. Identity can be evaluated by the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0030] In the above application, the stringent conditions may be as follows: 50°C, hybridization in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4 and 1mM EDTA, and rinsing at 50°C, 2×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, and rinsing at 50°C, 1×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, and rinsing at 50°C, 0.5×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, and rinsing at 50°C, 0.1×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, and rinsing at 50°C, 0.1×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M The membrane can be hybridized in a mixed solution of NaPO4 and 1mM EDTA, and rinsed in 0.1×SSC, 0.1% SDS at 65°C. Alternatively, the membrane can be hybridized in a solution of 6×SSC, 0.5% SDS at 65°C, and then washed once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS. Alternatively, the membrane can be hybridized in a solution of 2×SSC, 0.1% SDS at 68°C and washed twice for 5 minutes each time, and then hybridized in a solution of 0.5×SSC, 0.1% SDS at 68°C and washed twice for 15 minutes each time. Alternatively, the membrane can be hybridized in a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS at 65°C and washed.

[0031] The aforementioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0032] In the above application, the expression cassette containing the nucleic acid molecule encoding the Zkscan4 1-133 protein (Zkscan41-133 gene expression cassette) described in B2) refers to a DNA capable of expressing the Zkscan4 1-133 protein in a host cell, and the DNA may include not only a promoter for initiating transcription of the Zkscan4 1-133 gene, but also a terminator for terminating transcription of the Zkscan4 1-133 gene. Furthermore, the expression cassette may also include an enhancer sequence.

[0033] Existing expression vectors can be used to construct a recombinant vector containing the Zkscan4 1-133 gene expression cassette.

[0034] In the above application, the vector may be a plasmid, a cosmid, a phage or a viral vector. The viral vector may be an adeno-associated virus.

[0035] B3) The recombinant vector may specifically be AAV-Zkscan41-133 virus.

[0036] In the above applications, the microorganism may be yeast, bacteria, algae or fungi.

[0037] In the above applications, the transgenic cell line does not include propagation materials.

[0038] The use of Zkscan4 1-133 in the treatment or prevention of depression also falls within the protection scope of the present invention.

[0039] The use of the biomaterial in treating or preventing depression also falls within the protection scope of the present invention.

[0040] In the above, the treatment or prevention of depression can be reflected in the following aspects: improving the reduction in the frequency of small excitatory postsynaptic currents in depressed animals, correcting the social avoidance behavior of depressed animals, correcting the anhedonia of depressed animals (in one embodiment of the present invention, it is reflected in the reduction of sugar water preference of mice), and / or, improving the symptoms of despair in depressed animals (in one embodiment of the present invention, it is reflected in the increase of immobility time in forced swimming test and tail suspension test of mice).

[0041] The use of Zkscan4 1-133 in the preparation of antidepressant drugs also falls within the protection scope of the present invention.

[0042] The use of the biomaterial in the preparation of antidepressant drugs also falls within the protection scope of the present invention.

[0043] Among them, the antidepressant can be manifested in the following aspects: improving the reduction in the frequency of small excitatory postsynaptic currents in depressed animals, correcting the social avoidance behavior of depressed animals, correcting the anhedonia of depressed animals (in one embodiment of the present invention, it is manifested in the reduction of the preference for sugar water in mice), and / or improving the symptoms of despair in depressed animals (in one embodiment of the present invention, it is manifested in the increase in the immobility time in the forced swimming test and the tail suspension test of mice).

[0044] The present invention also provides a product, wherein the active ingredient of the product may be Zkscan4 1-133 or the biological material.

[0045] The product can be used for treating or preventing depression, and can also be used for preparing antidepressant drugs.

[0046] The animal may be a human or a mouse.

[0047] The present invention found that the Zkscan41-133 peptide segment can inhibit Htr2a receptor expression in vivo, correct synaptic transmission abnormalities and depressive-like behaviors in mice caused by abnormal Htr2a expression, and provide a new antidepressant polypeptide drug for achieving antidepressant effects by downregulating Htr2a, which has a good application prospect.

[0048] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 , Identification of F1 generation knockout mice of Zkscan4 knockout mice. The upper half of the figure shows the detection results of PCR products of gene knockout mice, and the lower half of the figure shows the detection results of PCR products of wild-type mice. B6 is a negative control, and the DNA template is the genomic DNA of C57 / B6J; N is a blank control, a control without template; TRANS2K PLUS II band: DNA molecular weight standard, the size is 8000bp\5000bp\3000bp\2000bp\1000bp\750bp\500bp\250bp\100bp; the DNA templates of lanes 10 and 12 are F1 generation knockout mice 10# and 12#, and the Zkscan4 gene is deleted by 6010bp; the DNA templates of lanes 11, 13, and 14 are F1 generation knockout mice 11#, 13#, and 14#, and the Zkscan4 gene is deleted by 5995bp.

[0050] Figure 2 , Construction and detection of Zkscan4 knockout mice. A, Schematic diagram of the construction of Zkscan4 knockout mice using CRISPR / Cas9 technology. B, Schematic diagram of Zkscan4 mouse genotype identification, Zkscan4 - / - The mice were homozygous for Zkscan4 knockout. WT-F and WT-R could not amplify a DNA fragment of 469 bp, while Mut-F and Mut-R could amplify a DNA fragment of 577 bp. + / - The Zkscan4 knockout mouse is heterozygous. - / - Only 577bp DNA fragment; Zkscan4 + / + For wild-type mice, there is only a wild-type 469 bp DNA fragment. C, Expression detection of Zkscan4 gene at the mRNA level. D, In situ hybridization found that there was no mRNA signal of Zkscan4 gene in Zkscan4 knockout mice. E, Western blotting detected the expression of Zkscan4 protein in Zkscan4 knockout mice.

[0051] Figure 3 , subthreshold social frustration stress induces depressive-like behavior in Zkscan4 knockout mice. A, Schematic diagram of subthreshold social frustration stress. B, Representative heat map of each group in social detection. C, After subthreshold stress, Zkscan4 knockout mice showed a significant decrease in social ratio (social time in the social area when CD1 is present / time in the social area when CD1 is not present). D, There was no difference in the movement distance of mice in each group during the social detection. E, F, After subthreshold stress, Zkscan4 knockout mice had a reduced preference for sugar water (E), but the total water intake was no different from that of mice in other groups (F). G, H, After subthreshold stress, the immobility time of Zkscan4 knockout mice in forced swimming (G) and tail suspension tests (H) was significantly increased.

[0052] Figure 4 Abnormal excitatory synaptic transmission in CA3-CA1 of hippocampus of Zkscan4 knockout mice. A, Schematic diagram of electrophysiological detection. B, Representative trace of recorded micro postsynaptic excitatory current. C, The frequency of micro postsynaptic excitatory current in Zkscan4 knockout mice is significantly reduced. D, The amplitude of micro postsynaptic excitatory current in Zkscan4 knockout mice remains unchanged.

[0053] Figure 5 , Zkscan4 inhibits the transcription of Htr2a. A, The mRNA level of Htr2a in the hippocampus of Zkscan4 knockout mice is increased. B, C, The protein expression of Htr2a in the hippocampus of Zkscan4 knockout mice is increased and statistical graphs. D, Chromatin immunoprecipitation revealed that Zkscan4 binds to the promoter of the Htr2a gene. E, Dual luciferase assay found that Zkscan4 inhibited the expression of Htr2a, while the luciferase activity initiated by Htr2a increased after interfering with the expression of Zkscan4.

[0054] Figure 6 , Zkscan4 knockout mice were injected with a virus expressing Zkscan41-133 into the hippocampus. Three weeks after virus injection, observation under a fluorescence microscope showed the expression of EGFP (green), and blue was the cell nucleus (using Southern Biotech's DAPI-containing anti-fluorescence quenching mounting medium, catalog number: 0100-20).

[0055] Figure 7 、Zkscan41-133 rescues the expression of Htr2a in Zkscan4 knockout mice. A, Zkscan41-133 rescues the increase in Htr2a mRNA level. B, C, Zkscan4 1-133 rescues the increase in Htr2a protein level and statistical graph.

[0056] Figure 8, Zkscan4 1-133 partially rescues abnormal excitatory synaptic transmission in Zkscan4 knockout mice. A, Representative traces of recorded miniature postsynaptic excitatory currents. B, Zkscan41-133 partially rescues the reduction in the frequency of miniature excitatory postsynaptic currents in Zkscan4 knockout mice. C, Zkscan41-133 has no effect on the amplitude of miniature excitatory postsynaptic currents in Zkscan4 knockout mice.

[0057] Fig. 9 、Zkscan41-133 corrects the depressive-like behavior of Zkscan4 knockout mice. A, B, Heat map and statistical graph of Zkscan41-133 correcting the social avoidance behavior of Zkscan4 knockout mice. CE, Zkscan41-133 rescues the decrease in sugar water preference (C) and the increase in immobility time in the forced swimming test (D) and tail suspension test (E) of Zkscan4 knockout mice. DETAILED DESCRIPTION

[0058] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. The quantitative tests in the following examples are all set up for at least three repeated experiments. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0059] Example 1: Zkscan4 1-133 peptide segment has antidepressant effect

[0060] The inventors first constructed Zkscan4 knockout mice, and the resulting mice had depressive-like behaviors. Then, they found that the Zkscan4 1-133 peptide segment in the Zkscan4 knockout mice had the ability to regulate the expression of Htr2a, and could correct the depressive-like behaviors caused by increased Htr2a expression, suggesting the antidepressant effect of the Zkscan4 1-133 peptide segment.

[0061] 1. Preparation of Zkscan4 knockout mice

[0062] 1. Construction of Zkscan4 knockout mice using CRISPR-Cas9 technology

[0063] CRISPR-Cas9 technology was used to construct a Zkscan4 knockout gene (Zkscan4 - / -) mice: Four artificially synthesized sgRNAs (sgRNA-5s1, sgRNA-5s2, sgRNA-3s1, sgRNA-3s2) targeting the Zkscan4 gene (Gene ID: 544922, updated on 5-Mar-2024) and Cas9 mRNA were injected into fertilized eggs of C57 / B6J background; after injection, the obtained fertilized eggs were transplanted into C57 / B6J mice to obtain F0 generation mice. The sgRNA target sequences used are shown in Table 1 below, and the Cas9 mRNA sequence is shown in SEQ ID No. 1.

[0064] Table 1. sgRNA sequences

[0065]

[0066] The positive F0 generation obtained by PCR screening was backcrossed with wild-type C57 / B6J mice, and then the positive F1 generation (such as Figure 1 , Figure 2 As shown). In the genomes of the screened mice 10# and 12#, the Zkscan4 gene of one chromosome remained unchanged, while the Zkscan4 gene of the other chromosome was missing 6010bp (the fragment from the 5'UTR to the 3'UTR of the Zkscan4 gene was missing, Figure 2 In A), the sequence deletions are as follows:

[0067] Gtaggtgacacctctgcagctgtgcctttggtgac (6010bp missing)ccagcagttttctcctgaatggatggttccggatt.

[0068] In the screened mouse 11#, 13#, and 14# genomes, the Zkscan4 gene on one chromosome remained unchanged, while the Zkscan4 gene on the other chromosome was missing 5995bp (the fragment from the 5'UTR to the 3'UTR of the Zkscan4 gene was missing, Figure 2 In A), the sequence deletions are as follows:

[0069] Acctctgcagctgtgcctttggtgacccagagcac (deletion 5995bp)tcgtagccagcagttttctcctgaatggatggttc.

[0070] All experimental mice were bred from heterozygous mice and wild-type (Zkscan4 + / + ), heterozygous knockout (Zkscan4 + / - ) and homozygous knockout (Zkscan4 - / -) of their littermates ( Figure 2 (middle B).

[0071] Table 2. Primers for identification of Zkscan4 knockout mice

[0072]

[0073] The expression of Zkscan4 gene at the mRNA level was detected. The primers used were Zkscan4-F: AAGGTGGCAGTGGTGACA; Zkscan4-R: GTCTCAGGCTTCATTTCCAG, and the internal reference was β-actin. The internal reference primers were β-actin-F: TGTGATGGTGGGAATGGGTCAGAA; β-actin-R: TGTGGTGCCAGATCTTCTCCATGT. Results ( Figure 2 Middle C) shows that the expression level of Zkscan4 gene in wild-type mice was significantly higher than that in heterozygous knockout and homozygous knockout mice.

[0074] In situ hybridization was used to detect the expression of Zkscan4 gene at the mRNA level in Zkscan4 knockout mice. The hybridization probe of Zkscan4 used was a product of Advanced Cell Diagnostics (Cat. No. 485521). The results were ( Figure 2 Middle D) shows that homozygous knockout mice have no mRNA signal of the Zkscan4 gene.

[0075] Western blotting was used to detect the expression of Zkscan4 protein in Zkscan4 knockout mice. The antibody used was the Zkscan4 antibody from Wuhan Abotek Biotechnology Co., Ltd. Figure 2 Middle (E) shows that the Zkscan4 protein content in wild-type mice is significantly higher than that in homozygous knockout mice.

[0076] Age-matched mice were randomly assigned to each experimental group. All experimental mice were raised in a standard manner, 4-5 mice per cage, with an automatically controlled 12-hour circadian rhythm (lights off at 20:00), and food and water were provided by themselves.

[0077] 2. Behavioral testing found that Zkscan4 knockout mice had increased stress sensitivity and showed depressive-like behavior when given subthreshold stress. The mice tested were the offspring of 11#, 13#, and 14#, and were 2-3 months old.

[0078] Subthreshold social frustration stress: Subthreshold social frustration stress is used to assess the stress susceptibility of experimental mice. Experimental mice (including wild-type mice and homozygous knockout mice from the same litter) are placed in a cage with a partition (a transparent plastic partition with dense holes, so that the mice on both sides can still see and smell each other but cannot touch each other), and a CD1 male mouse is on the same side. CD1 directly contacts and attacks the experimental mouse for 5 minutes, and then the experimental mouse is moved to the other side of the partition. The experimental mouse is replaced every day in the cage of another unfamiliar CD1 male mouse and the above steps are repeated for 4 consecutive days. Then the experimental mouse is removed and kept alone, and a social test is performed 24 hours later.

[0079] Among them, CD1 male mice (5-8 months old) were products of Weitonglihua or Sibeifu (Beijing) Biotechnology Co., Ltd., and were kept in solitary and had free access to food and water.

[0080] Social detection: The social detection was carried out according to the method described in the literature. First, a special device for social detection was customized, an open field device (length 42cm, width 42cm, height 42cm), two empty metal grids (length 10cm, width 6.5cm, height 42cm) that can be freely inserted into the open field device, one of which is specifically used for CD1 male mice, and the other is not for CD1 male mice. During the social detection, the empty metal grid was first inserted into the open field device, and then the experimental mouse was placed in the open field area to explore freely for 2.5 minutes. The movement and exploration time of the mouse were recorded using the Ethovision 8.5Noldus system automatic tracking system. After 30 seconds, the empty metal grid was replaced with another metal grid with a new CD1 mouse, and the experimental mouse was placed in the open field to explore for 2.5 minutes, and the time and activity distance of the experimental mouse in the social area were recorded. The social ratio was calculated as follows: the time the experimental mouse explored the social area when the CD1 male mouse appeared / the time the experimental mouse explored the social area when there was no CD1 male mouse. If the social ratio was less than 1, the experimental mouse was defined as stress-susceptible, and if the social ratio was greater than or equal to 1, the experimental mouse was defined as stress-resistant. After the recording was completed, the experimental mouse was returned to the cage.

[0081] Sugar water preference experiment: The mice to be tested were adapted to two water bottles (one containing tap water and the other containing 1% sucrose water) for 3 days. On the fourth day, the sucrose water was replaced with tap water and adapted for another two days. At 17:00 on the fifth day, the mice were kept alone and only provided with food but no water. At 19:00 in the evening, a weighed bottle of tap water and a bottle of 1% sucrose water were provided, and the mice were allowed to choose freely. The positions of tap water and sugar water were switched every 1.5 hours to eliminate the position preference of mice (19:00-23:30). After that, the water bottles were placed and not moved until 9:00 the next morning, and then weighed again. Sugar water preference was calculated as the weight of sugar water consumed × 100% / (weight of sugar water consumed + weight of tap water consumed). After the experiment, the experimental mice were returned to the breeding cage.

[0082] Forced swimming: The mice to be tested were placed in a cylindrical plastic forced swimming bucket (25 cm high, 20 cm in diameter) filled with room temperature tap water, with a water depth of about 18 cm and a water temperature of 22-25°C. The mice were forced to swim in the water for 6 minutes, and the image pixel changes were analyzed using SMART3.0 software, and the immobility time of the mice in the last 4 minutes was counted. After the recording was completed, the experimental mice were returned to the breeding cage.

[0083] Tail suspension test: The tail suspension test uses a tail suspension box (PHM-300, Med Company), where the mouse's tail is hung on a hook for 6 minutes. The data is analyzed using Med's tail suspension software, and the sum of the time below the mouse threshold in the last 4 minutes is the immobility time of the mouse. After the recording is completed, the experimental mouse is returned to the cage.

[0084] The results are as follows Figure 3 As shown, after subthreshold stress, Zkscan4 knockout mice showed a significant decrease in the social ratio (social time in the social area when CD1 was present / time in the social area when CD1 was absent) ( Figure 3 Middle C); There was no difference in the movement distance of mice in each group during social detection ( Figure 3 Middle D); After subthreshold stress, Zkscan4 knockout mice showed reduced sugar preference ( Figure 3 E), but the total water intake was no different from that of mice in other groups ( Figure 3 Middle F); Zkscan4 knockout mice after subthreshold stress in forced swimming ( Figure 3 In the tail suspension test ( Figure 3 The immobility time in the middle (H) was significantly increased, indicating that Zkscan4 knockout mice have depressive-like behaviors.

[0085] 3. Electrophysiological experiments found that the frequency of excitatory synaptic transmission in Zkscan4 knockout mice was reduced

[0086] The mice to be tested were the offspring of 11#, 13#, and 14#, and were 2-3 months old.

[0087] The specific experimental methods are as follows: In vitro brain slice preparation: The experiment used 8-12 week old Zkscan4 knockout mice and their littermate wild-type control mice. The experimental mice were in a state of deep anesthesia after inhalation of isoflurane, and the pre-cooled (0°C) and mixed gas oxygenated (95% oxygen: 5% carbon dioxide; volume ratio) phosphate buffer was taken out, and the experimental mice were perfused by heart with 30mL buffer, and the remaining buffer was poured into a pre-cooled slice box (0°C) and continuously perfused with mixed gas. After the perfusion, the brain was quickly taken out, and the bilateral temporal lobes including the hippocampus were trimmed with a blade, and the brain tissue blocks were fixed on the slice disk with glue, and then the slice disk with the hippocampus tissue block was placed in the slice box, and a vibrating slicer (Leica, VT1000S) was used for vibrating slices, and the slice angle was coronal section, and the slice thickness was 350μm. The cut brain slices were transferred to an incubation box filled with preheated (32°C) and oxygenated artificial cerebrospinal fluid with a pipette and incubated for 40 minutes. The incubation box was then placed at room temperature (22°C) to recover for at least one hour. At room temperature, the recording chamber was placed on a microscope (600-FN, Nikon), and the recording chamber was filled with circulating artificial cerebrospinal fluid at a flow rate of 3-4 ml per minute. The brain slices in the incubation box were transferred to the immersion recording chamber with a pipette and gently pressed and fixed with a nylon mesh. A stimulating electrode made of double-stranded Teflon-wrapped platinum-iridium gold wire was placed on the axons (Schaffer collaterals) of the hippocampal CA3 pyramidal neurons to the stratum radium of the CA1 region. A borosilicate glass electrode (resistance 1-3 MΩ) drawn by a puller (P-97, Sutter) was filled with internal liquid ACSF as a recording electrode and placed on the Schaffer collaterals of the stratum radium of the CA1 region about 300-400 μm away from the stimulating electrode to record extracellular signals. Whole-cell recording: After finding the pyramidal neurons in the CA1 region using an infrared differential interference contrast (IR-DIC) microscope, a borosilicate glass electrode (resistance 3-6 MΩ) pulled by a glass electrode puller is filled with intracellular solution and used as a recording electrode to form a whole-cell recording with the pyramidal neurons.The cells were clamped at -60 mV, and the GABAa receptor antagonist picrotoxin (PTX) was added to the circulation at a final concentration of 100 μM, and the Na+ channel blocker tetrodotoxin (TTX) was added to the circulation at a final concentration of 1 μM to record the miniature excitatory post-synaptic current (mEPSC); the cells were clamped at 0 mV, and the AMPA receptor antagonist CNQX was added to the circulation at a final concentration of 20 μM, the NMDA receptor antagonist D-AP5 was added to the circulation at a final concentration of 50 μM, and the miniature inhibitory post-synaptic current (mIPSC) was recorded. The electrophysiological signal processing was completed by a digital-to-analog converter (Digidata 1440A, Molecular Devices) and an amplifier (Multiclamp700B, Molecular Devices), with a signal filtering of 2 kHz and a sampling frequency of 10-20 kHz. Signal recording was completed by software pCLAMP10 (Molecular Devices). Field potential data analysis software was Clampfit 10 (Molecular Devices). Analysis software for miniature postsynaptic excitatory current (mEPSC) and miniature postsynaptic inhibitory current (mIPSC) was MiniAnalysis (Synaptosoft). Brain slices with a maximum field potential of less than 0.5 mV were not included in the data analysis. Whole-cell series resistance was not included in the analysis if it was not in the range of 10-25 MΩ, and cells that changed by more than 20% during the recording process were not included in the analysis. Drugs PTX, CNQX, D-AP5, and TTX are all products of Sigma.

[0088] The results are as follows Figure 4 As shown, the frequency of miniature postsynaptic excitatory currents in Zkscan4 knockout mice was significantly reduced ( Figure 4 Middle C), the amplitude of the miniature postsynaptic excitatory current remains unchanged before and after Zkscan4 knockout ( Figure 4 (middle D).

[0089] 4. Using RNA sequencing technology, it was found that the expression of Htr2a in Zkscan4 knockout mice was significantly increased; and Htr2a expression was regulated by the Zkscan4 gene.

[0090] The mice tested were the offspring of 11#, 13#, and 14#, and were 2-3 months old. Figure 5 shown.

[0091] RNA sequencing: Hippocampal tissue was extracted from Zkscan4 knockout mice and wild-type mice of their littermates after subthreshold stress. The samples were then sent to Beijing Bio-Jingdian Biotechnology Co., Ltd. for high-throughput RNA sequencing using Illumina. The original sequencing data used the mouse genome as the reference sequence, and P<0.05 and the difference multiple |log2ratio|>0.5 were used as the thresholds for differentially expressed genes.

[0092] Western blot: The hippocampal tissue was peeled off and lysed on ice for 15 minutes using RIPA lysis buffer, 1% Triton X-100, and protease inhibitors, then centrifuged at 4°C for 10 minutes at 12000rpm, the supernatant was taken and the protein was quantified using the BCA protein quantification kit, and then the protein was prepared into 1ug / ul using the loading buffer, and after denaturation at 95°C for 10 minutes, 5-25ul of sample was loaded. Protein electrophoresis was performed using 7% or 10% NuPAGE gel, and then the protein was transferred to the nitrocellulose membrane using a 200mA constant current. At room temperature, 5%-10% skim milk was used to block for 1 hour, PBST (TWEEN20 PBS) was washed three times for 5 minutes each time, and then the corresponding primary antibody was added and incubated overnight in a 4°C chromatography cabinet. The next day, PBST was used to wash three times for 5 minutes each time, and then the corresponding species of secondary antibody was added for incubation at room temperature for 1 hour, and then developed. The primary antibody used was anti-Htr2a (Immunostar, Catalog No. 24288), and the secondary antibody was horseradish enzyme-labeled goat anti-rabbit IgG (Beijing Dingguo Changsheng Biotechnology Co., Ltd., Catalog No. IH-0011).

[0093] Fluorescence quantitative PCR: Total RNA was extracted from hippocampal tissue using Trizol reagent according to the standard operation in the instruction manual, and the RNA amount was measured. Then, the first-chain cDNA was reverse transcribed, and the corresponding reaction system was prepared using 2XSYBR green mix. The primers used were as shown in the following table. A fluorescence quantitative PCR instrument was used to perform 40 cycles of reaction, and finally, the LightCycle 96 application software was used to calculate the relative expression of the gene.

[0094] Chromatin immunoprecipitation: using EZ ChIP TM The immunoprecipitation kit (Millipore, catalog number 17-731) was used according to standard procedures. Briefly, the hippocampal tissue was removed and cross-linked with freshly prepared formaldehyde, the nuclear protein was separated and the DNA was broken by ultrasound, and then the corresponding antibody was added and incubated overnight in a 4°C chromatography cabinet. The elution was performed on the next day in the order of low salt-high salt-lithium chloride elution solution-TE elution solution. After the cross-linking was reversed, the DNA was recovered and PCR detection was performed.

[0095] result( Figure 5) showed that the mRNA level of Htr2a in the hippocampus of Zkscan4 knockout mice was increased, and the primers used were Htr2a-F: TAATGCAATTAGGTGACGACTCG; Htr2a-R: GCAGGAGAGGTTGGTTCTGTTT, and the internal reference was β-actin, and the internal reference primers were β-actin-F: TGTGATGGTGGGAATGGGTCAGAA; β-actin-R: TGTGGTGCCAGATCTTCTCCATGT. The content of Htr2a increased; chromatin immunoprecipitation found that Zkscan4 bound to the promoter of the Htr2a gene; dual luciferase experiments found that Zkscan4 inhibited the expression of Htr2a, and the luciferase activity initiated by Htr2a increased after interfering with the expression of Zkscan4.

[0096] 2. Detection of the antidepressant effect of the Zkscan4 1-133 peptide

[0097] 5. Intracerebral injection of Zkscan41-133 can inhibit the increase of Htr2a expression in the brain of Zkscan4 knockout mice

[0098] The therapeutic effect of Zkscan4 1-133 on depression was detected using an adeno-associated virus capable of expressing a Zkscan4 1-133 peptide segment (whose sequence is positions 1-133 of SEQ ID No. 2 in the sequence list) and an EGFP fusion protein, and the steps are as follows:

[0099] The mice to be tested were the offspring of 11#, 13#, and 14#, and were 2-3 months old.

[0100] Virus construction: The gene encoding the Zkscan4 1-133 peptide (its sequence is SEQ ID No. 3 in the sequence list) was constructed into an adeno-associated virus vector to obtain a recombinant vector pAAV-CamKII-Zkscan41-133-3XFlag-P2A-EGFP-WPRE (Heyuan Biotechnology (Shanghai) Co., Ltd., vector number H28738), and a vector pAAV-CaMKIIa-EGFP-3xFLAG-WPRE vector (Heyuan Biotechnology (Shanghai) Co., Ltd., vector number AOV012) that does not express the Zkscan4 1-133 peptide was used as a control. The steps for constructing the viral vector are as follows:

[0101] 1) RNAsimple total RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number DP419) was used to extract total RNA from mouse hippocampus tissue. Then, the first strand of mouse cDNA was obtained by reverse transcription using total RNA as a template using FastKing cDNA First Strand Synthesis Kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number KR116). Using primer-1 and primer-3, PCR was performed with the first chain of cDNA obtained by reverse transcription as a template, and fragment a was obtained by gel excision; using primer-2 and primer-3, PCR was performed with the empty vector of pAAV-CaMKIIa-EGFP-3xFLAG-WPRE (Heyuan Biotechnology (Shanghai) Co., Ltd., vector number AOV012) as a template, and fragment b was obtained by gel excision; and the pAAV-CamKII-EGFP-3xFlag-WPRE empty vector was digested with NheI and HindIII, and the cut vector fragment c was recovered by gel excision, and then Gibson assembly (NEB, catalog number E2611S) was used to seamlessly clone the fusion fragments a, b, and c to obtain a recombinant vector with the correct sequence, namely, pAAV-CamKII-Zkscan4 1-133-3XFlag-P2A-EGFP-WPRE vector (Heyuan Biotechnology (Shanghai) Co., Ltd., vector number H28738).

[0102] Primer-1AAACCCCGGTCCGGCTAGCGCCACCATGGCTAGAGAACCCGGAACGTCCGCAGCCC;

[0103] Primer-2: CGCTGCTGGAGTACTTGGACAGGCAGCTGGACTACAAGGATGACGATGACAAGGATTACAAAG;

[0104] Primer-3: TCGATAACCGGTTTAAAGCTTTTACTTGTACAGCTCGTCCATGCCGAG.

[0105] 2) The pAAV-CamKII-Zkscan41-133-3XFlag-P2A-EGFP-WPRE vector was co-transfected with pHelper (carrying adenovirus-derived genes) and pAAV-RC (carrying AAV replication and capsid genes) into AAV-293 cells (providing trans-acting factors required for AAV replication and packaging). Recombinant AAV was assembled in the packaging cells 2 to 3 days after transfection.

[0106] 3) Collect AAV virus particles from infected AAV-293 cells. Generally, AAV particles are enriched in packaging cells, so most of the AAV particles can be recovered by collecting cells and then lysing and releasing AAV particles into the supernatant.

[0107] 4) Concentrate and purify the viral supernatant from step 3). The original supernatant contains many cell protein molecules and fragments. Most of the cell proteins and residual gradient fluid can be removed by density gradient centrifugation and ultrafiltration.

[0108] 5) The titer of the obtained virus was measured by quantitative PCR to obtain the physical titer value of the AAV genome packaged into the particles. The virus titer reached 1.0X10 12 above.

[0109] The obtained AAV virus (hereinafter referred to as AAV-Zkscan41-133 virus) contains the Zkscan41-133-3XFlag-P2A-EGFP encoding gene shown in SEQ ID No.3, and can express Zkscan41-133-3XFlag-P2A-EGFP shown in SEQ ID No.2.

[0110] Following the above steps, the pAAV-CamKII-Zkscan41-133-3XFlag-P2A-EGFP-WPRE vector was replaced with the pAAV-CamkII-EGFP-3xFLAG-WPRE vector to obtain the control virus.

[0111] Stereotaxic injection: All surgical operations were performed on mice anesthetized with sodium pentobarbital. The concentration of sodium pentobarbital was 0.7% and the dosage was 0.1 ml / 10 g. After the mice were anesthetized, they were fixed on a stereotaxic instrument, the skulls were exposed, and the virus (titer 1.0X10 12 ), with Bregma as the origin, and the injection coordinates of the hippocampal CA3 region were AP: -2.6mm; ML: ±2.5mm; DV: -3.0mm. All mice were injected with the virus three weeks after birth ( Figure 6 ), and then the mice were allowed to recover for at least 4 weeks, and the location of viral refraction and viral expression were verified by EGFP expression and immunoblotting. - / - Mice were injected with AAV-Zkscan41-133 virus or control virus and Zkscan4 + / + Mice injected with control virus served as controls.

[0112] The results are as follows Figure 7As shown, the results showed that the expression of Htr2a in Zkscan4 knockout mice was increased, and Zkscan4 1-133 could reduce the expression of Htr2a in Zkscan4 knockout mice. Antibodies used: anti-Htr2a (Immunostar, Cat. No. 24288), secondary antibodies were horseradish enzyme-labeled goat anti-rabbit IgG (Beijing Dingguo Changsheng Biotechnology Co., Ltd., Cat. No. IH-0011).

[0113] 6. Intracerebral injection of Zkscan41-133 corrects the reduced frequency of excitatory synaptic transmission in Zkscan4 knockout mice

[0114] The mice obtained in step 5 were allowed to recover for 4 weeks before electrophysiological experiments were performed according to step 3.

[0115] The results are as follows Figure 8 As shown, Zkscan4 1-133 can partially rescue the frequency of small excitatory postsynaptic currents in Zkscan4 knockout mice ( Figure 8 Middle B); Zkscan4 1-133 has no effect on the amplitude of small excitatory postsynaptic currents in Zkscan4 knockout mice ( Figure 8 Middle C).

[0116] 7. Intracerebral injection of Zkscan41-133 reduces the depressive-like behavior of rescue-induced ZKscan4 knockout mice

[0117] The mice obtained in step 5 were allowed to recover for 4 weeks before behavioral experiments, which were performed according to step 2.

[0118] The results are as follows Fig. 9 As shown, Zkscan41-133 can correct the social avoidance behavior of Zkscan4 knockout mice ( Fig. 9 A and B); Zkscan41-133 can also correct the anhedonia of Zkscan4 knockout mice ( Fig. 9 C) and forced swim test ( Fig. 9 D) and tail suspension test ( Fig. 9 The immobility time in middle E) increased, indicating that Zkscan41-133 can treat depression in mice.

[0119] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application of protein in the preparation of products for the treatment or prevention of depression; The protein is a protein whose amino acid sequence is positions 1 to 133 of SEQ ID No.

2.

2. Use of a biological material related to the protein of claim 1 in the preparation of a product for treating or preventing depression; the biological material is any one of the following B1) to B5): B1) a nucleic acid molecule encoding the protein according to claim 1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) A transgenic cell line containing the nucleic acid molecule described in B1) or a transgenic cell line containing the expression cassette described in B2).

3. The use according to claim 2, characterized in that: B1) The nucleic acid molecule is as follows: b11) or b12) or b13): b11) The coding sequence is the DNA molecule at positions 1 to 399 of SEQ ID No. 3 in the sequence list; b12) The DNA molecule shown in positions 1 to 399 of SEQ ID No. 3 in the sequence listing; b13) The DNA molecule shown in SEQ ID No. 3 in the sequence listing.

4. The use according to any one of claims 1 to 3, characterized in that: The treatment or prevention of depression is embodied in improving the reduction of the frequency of small excitatory postsynaptic currents in depressed animals, correcting the social avoidance behavior of animals, correcting the anhedonia of depressed animals, and / or correcting the despair symptoms of depressed animals.

5. Use of the protein according to claim 1 in the preparation of antidepressant drugs.

6. Use of the biomaterial according to claim 2 or 3 in the preparation of antidepressant drugs.

7. The use according to claim 5 or 6, characterized in that: The antidepressant is manifested in improving the reduction of the frequency of small excitatory postsynaptic currents in depressed animals, correcting the social avoidance behavior of depressed animals, correcting the anhedonia of depressed animals, and / or improving the despair symptoms of depressed animals.

8. A product for treating or preventing depression or for preparing an antidepressant, wherein the active ingredient is the protein according to claim 1 or the biological material according to claim 2 or 3.

Images