A biomarker of liver injury in male piglets with intrauterine growth restriction and application thereof

Abstract

The application belongs to the technical field of medicine, and particularly relates to a liver damage biomarker for judging whether a newborn male piglet is affected by intrauterine growth restriction. The application discloses application of APOA4 as a biomarker for judging whether a male piglet is affected by intrauterine growth restriction. Expression of APOA4 in serum and liver biopsy tissue samples of a male piglet to be detected is determined; when APOA4 is abnormally up-regulated, it is judged that the male piglet to be detected is a male piglet affected by intrauterine growth restriction.

Description

Technical Field

[0001] This invention belongs to the field of medical technology, specifically relating to a biomarker for determining liver damage in newborn male piglets affected by intrauterine developmental restriction. Background Technology

[0002] In recent years, in pursuit of high litter sizes, an average of 1-3 piglets per litter are IUGR (Intrauterine Growth Restriction) piglets, with a morbidity rate of approximately 15%-20%. Intrauterine growth restriction leads to a high mortality rate in newborn piglets, affects the growth and development of organs such as the small intestine, liver, and muscles after birth, and is accompanied by catch-up growth, ultimately resulting in long-term developmental damage and prolonging the time to market. Currently, it has been found that liver damage in IUGR male piglets is significantly more severe than in IUGR female piglets. Currently, newborn male piglets are typically weighed, and those whose weight is below two standard deviations below the average weight of male piglets in their litter (one standard deviation is represented by the square root of the sum of the squares of the differences between each male piglet's weight and the average weight of male piglets in the litter, divided by the total sample size minus one) are classified as IUGR piglets and culled. However, this method has errors; some piglets may simply be underweight but not necessarily IUGR piglets. Therefore, the above method results in a serious early waste of resources.

[0003] Nutritional regulation is a crucial step in the early and effective prevention and control of intrauterine growth restriction (IUD) in piglets. However, there is currently a lack of biomarkers to measure whether nutritional regulation effectively improves IUD in piglets. Therefore, there is an urgent need to further study the damage mechanisms of IUD, identify new IUD-related biomarkers, and promote the application of precise nutritional regulation measures in IUD piglets, truly achieving a three-pronged approach of diagnosis, improvement, and prevention.

[0004] Invention CN114414339B, entitled "A Method for Detecting Plasma Metabolites in Intrauterine Growth Restricted Lambs Based on Non-Targeted Metabolomics," discloses that compared with healthy newborn lambs, the concentrations of multiple metabolites in the plasma of IUGR lambs are altered, mainly involving multiple metabolic pathways such as lipid metabolism, amino acid metabolism, and glucose metabolism. Compared with NBW lambs, IUGR lambs show changes in multiple lipid metabolites in their plasma, mainly including upregulation of low-density lipoprotein / very low-density lipoprotein (LDL / VLDL), 2-hydroxyisovaleric acid, choline, phosphoric acid choline, and glycerophosphocholine, and downregulation of isovaleric acid expression. The contents of multiple amino acids and carbohydrates in the plasma of IUGR lambs are significantly reduced, mainly including glucose, lactate, leucine, valine, alanine, tyrosine, 3-methylhistidine, and N-acetylcysteine, further revealing insufficient amino acid sources or increased utilization in IUGR fetuses.

[0005] The invention CN114703277B, "Application of ADORA2A Gene as a Molecular Marker in the Preparation of Products for Preventing or Alleviating IUGR Pregnancy Outcomes," states that Adenosine / ADORA2A signaling can serve as a molecular marker for alleviating IUGR pregnancy outcomes in female mice, providing a strong theoretical basis and technical support for mitigating the occurrence of IUGR pregnancy outcomes in female mice.

[0006] APOA4 is a plasma lipoprotein involved in many metabolic pathways, such as lipid and glucose metabolism. It is also a natural antioxidant and possesses anti-inflammatory properties; administration of APOA4 can alleviate colitis inflammation. Therefore, the potential link between APOA4 and some diseases is gradually being explored, and plasma APOA4 may help prevent the formation of atherosclerosis. Summary of the Invention

[0007] The technical problem to be solved by the present invention is to provide a biomarker for determining the effects of intrauterine developmental restriction on liver damage in newborn male piglets and its application.

[0008] To address the aforementioned technical problems, this invention provides the application of APOA4 as a biomarker for determining whether a male piglet is intrauterine growth-restricted.

[0009] This biomarker shows a high degree of correlation with liver damage caused by intrauterine growth restriction and can be used to indicate the rationality of applying nutritional regulation interventions to piglets with intrauterine growth restriction.

[0010] As an improvement to the application of this invention: the amino acid sequence of APOA4 is shown in SEQ ID NO:1.

[0011] That is, the present invention provides a biomarker for determining liver injury in newborn male piglets affected by intrauterine growth restriction. The biomarker is a protein, with the Chinese name apolipoprotein A4 and the English name Apolipoprotein A-Ⅳ, abbreviated as APOA4. The Uniprot sequence number is O46409. It contains 382 amino acids and the predicted protein molecular weight is 45 kDa. The specific sequence is shown in SEQ ID NO:1.

[0012] As a further improvement to the application of this invention: the expression of APOA4 in serum and liver biopsy tissue samples of male piglets to be tested (approximately 7±1 days after birth) was measured; when APOA4 was abnormally upregulated, the male piglets to be tested were identified as male piglets with intrauterine growth restriction.

[0013] The measured values ​​of male piglets to be tested were compared with the reference values ​​(measured values ​​of normal newborn male piglets), and the degree of liver damage due to intrauterine growth restriction in male piglets was judged based on the degree of abnormal upregulation of APOA4.

[0014] Note: Normal newborn male piglets and male piglets with intrauterine growth restriction should be from the same genetic background.

[0015] As a further improvement to the application of this invention:

[0016] For male piglets in the same litter:

[0017] Male piglets whose weight is two standard deviations below the average weight of male piglets in their litter are defined as suspected IUGR male piglets; otherwise, they are defined as normal male piglets.

[0018] The APOA4 content in the serum of normal male piglets was detected, and the average value was taken.

[0019] The APOA4 content of suspected IUGR male piglets was tested. When the APOA4 content exceeded 1.25 times the average value, the piglets were identified as IUGR male piglets; otherwise, they were identified as normal male piglets (non-IUGR male piglets).

[0020] Note: The sum of the squares of the differences between the weight of each male piglet and the average weight of male piglets in the litter, divided by the arithmetic square root of the sample size minus one, represents one standard deviation of the average weight of male piglets in the litter. This is common knowledge.

[0021] During the invention process, it was discovered that:

[0022] In male piglets with intrauterine growth restriction, the protein expression levels of APOA4 in the liver and serum are significantly elevated. Therefore, the degree of liver damage caused by intrauterine growth restriction can be diagnosed by detecting the expression level of APOA4.

[0023] This invention integrates multi-dimensional data and has been experimentally proven to show that the expression levels of APOA4 in the serum and liver of male piglets affected by intrauterine growth restriction are significantly upregulated. Therefore, APOA4 is valuable for diagnosing liver damage in male piglets with intrauterine growth restriction.

[0024] Using the method of this invention, IUGR piglets can be correctly identified, avoiding the culling of piglets that are only low in weight. This helps to reduce the culling rate and mitigate the negative impact of intrauterine growth restriction, thus avoiding early waste of resources.

[0025] Furthermore, the proportion of IUGR piglets to normal piglets can be used to determine whether the sow's nutritional regulation is reasonable, thereby further adjusting the sow's nutritional management. In other words, this invention provides a reliable evaluation target for developing new nutritional regulation methods for intrauterine growth-restricted male piglets. Attached Figure Description

[0026] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0027] Figure 1 The transcriptome and single-cell transcriptome showed that the expression level of APOA4 in the liver tissue of intrauterine growth-restricted male piglets was significantly higher than that in normal male piglets, and this gene was expressed only in hepatocytes.

[0028] Figure 1 In the middle: the left side shows the changes in the expression levels of apolipoprotein family genes during transcriptome sequencing; the middle side shows the expression of APOA4 in various cell types of liver tissue; and the right side shows a comparison of APOA4 gene expression between IUGR male piglets and normal male piglets (NBW).

[0029] Figure 2 The results, verified by Western blotting and ELISA kits, showed that the APOA4 levels in the liver tissue and serum of male piglets with intrauterine growth restriction were significantly higher than those in normal male piglets.

[0030] Figure 2 The top image shows the exposure bands of APOA4 in Western Blot; the middle image shows the statistical results of APOA4 expression in IUGR male piglets and normal male tissues based on Western Blot; and the bottom image shows the comparison of APOA4 expression in serum and liver tissues of IUGR male piglets and normal males based on ELISA kit assays.

[0031] Figure 3 This demonstrates the construction process of the APOA4-KO HepG2 cell line;

[0032] Figure 3 The top image shows a schematic diagram of APOA4 gene exon knockout and verification, while the bottom image shows DNA gel electrophoresis of the amplification products of the designed primers Region1,2,3.

[0033] Figure 4 The results, verified by Oil Red O staining and triglyceride kit assay, showed that APOA4-KO HepG2 exhibited more pronounced lipid accumulation.

[0034] Figure 4 The top image shows scans of HepG2 and APOA4-KO cell lines stained with Oil Red O under hypoxia treatment; the bottom image shows a line graph illustrating the changes in triglyceride content of APOA4 in HepG2 and APOA4-KO cell lines as hypoxia time increases.

[0035] Figure 5 The results, verified by RT-qPCR, showed different changes in HepG2 and related lipid metabolism genes in APOA4-KO under hypoxic stimulation.

[0036] Figure 5The left side shows the changes in lipid breakdown-related genes in the HepG2 and APOA4-KO cell lines as hypoxia duration increased, while the right side shows the changes in lipid synthesis and transport-related genes in the HepG2 and APOA4-KO cell lines as hypoxia duration increased. Detailed Implementation

[0037] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0038] The male piglets mentioned below refer to male piglets that are 7 days old.

[0039] Experiment 1:

[0040] Transcriptomic and single-cell transcriptomic analyses were conducted to detect APOA4 expression in intrauterine growth-restricted male piglets and normal male piglets. Figure 1 ).

[0041] Materials and Methods:

[0042] 1. Transcriptome: Download the raw sequencing data in fq format from the NCBI database (project number PRJNA597972). After quality control using FASTP software and alignment of the sequence information with the reference genome using HISAT2 software, the expression matrix was obtained. The data was then standardized, and apolipoprotein family-related gene data were extracted and visualized.

[0043] 2. Single-cell transcriptomics: Liver tissue from male piglets (7 days old) was extracted from the tissue storage medium and processed to prepare a single-cell suspension as follows: The cells were washed on ice with RPMI 1640 medium and cut into small pieces. Enzymatic digestion was performed at 37°C for 1 hour with 2.0 mg / ml collagenase IV, 0.25 mg / ml hyaluronidase, and 20 μl / ml deoxyribonuclease I (prepared using RPMI 1640 medium). After digestion, the cells were sieved through a 70 μm stacked filter, centrifuged at 400g for 10 min, and the supernatant was discarded. The cells were resuspended in red blood cell lysis buffer (RBC Lysis Buffer), washed with PBS (pH 7.2) containing 0.05% BSA, and finally lysed on 36% Percoll to obtain single-cell suspensions for single-cell capture sequencing. This yielded liver gene transcription information at the single-cell level.

[0044] according to Figure 1 It can be seen that APOA4 is expressed only in hepatocytes of the liver, and the mRNA level of APOA4 in the liver of male piglets with intrauterine growth restriction is significantly higher than that in normal male piglets.

[0045] Note: In this experiment, normal male piglets and IUGR male piglets were distinguished based on body weight and head shape.

[0046] Experiment 2: Detection of APOA4 expression in serum and liver of intrauterine growth-restricted male piglets and normal male piglets ( Figure 2 ):

[0047] The specific testing process is as follows:

[0048] Western Blot: 0.03 g of liver tissue was weighed and lysed using RIPA buffer supplemented with protease and phosphatase inhibitors to obtain total protein lysis buffer. Protein concentration was determined using a BCA protein assay kit. Equal masses of proteins were separated by 10% polyacrylamide gel electrophoresis and blotted onto a polyvinylidene fluoride membrane. After blocking with skim milk powder blocking buffer, the membrane was incubated overnight at 4°C with APOA4 primary antibody. The blotted membrane was washed with antibody stripping buffer and then incubated with β-actin primary antibody. Incubation with goat anti-mouse secondary antibody was performed at room temperature for 1 hour. Exposure signal was detected using ECL developing solution, and images were taken using a gel recording system. Finally, density analysis was performed using ImageJ software.

[0049] ELISA kit detection (Porcine apolipoprotein A4 (apo-A4) kit (ELISA), Haling Biotechnology, HLE50184): Weigh 0.1g of liver tissue, add 900ul of PBS (pH=7.2) for homogenization, and centrifuge to obtain the supernatant. Collect piglet blood through the anterior vena cava and centrifuge to obtain serum. Serum does not require pretreatment. Add 100μL of horseradish peroxidase (HRP)-labeled APOA4-specific capture antibody to each well of the standard and sample wells. Add 50μL of the sample to be tested (serum, or serum dilution, liver homogenate supernatant) to each well of the sample wells. Seal the reaction wells with sealing film and incubate at 37°C in a water bath or incubator for 60min. Discard the liquid, pat dry on absorbent paper, add 350μL of washing buffer to each well, let stand for 1min, discard the washing buffer, pat dry on absorbent paper, and repeat the washing process 5 times. Add 50 μL of substrate A and 50 μL of substrate B to each well and incubate at 37°C in the dark for 15 min. Add 50 μL of stop solution to each well and measure the OD value of each well at 450 nm using a microplate reader within 15 min.

[0050] The results of APOA4 Western blot exposure bands and the results of APOA4 levels in serum and liver are as follows: Figure 2 As shown.

[0051] according to Figure 2 It can be seen that the APOA4 content in the liver and serum of male piglets with intrauterine growth restriction is significantly higher than that in normal male piglets.

[0052] Experiment 3:

[0053] An APOA4 knockout HepG2 cell line was constructed using CRISPR / Cas9 technology. Figure 3 The specific knockout process was as follows: The APOA4 gene was successfully ablated using CRISPR-Cas9 RNP-mediated CRISPR-Cas9 containing hSpCas9 and chimeric guide RNA. Two guide RNAs were selected from the website (http: / / crispr.mit.edu), targeting exons 1-3 of the APOA4 gene, respectively. Plasmids carrying guide RNA sequences were electrotransfected into cells using the Neon transfection system. Two days later, single colonies were transferred to 96-well plates. To confirm the presence of insertions or deletions in the APOA4-targeted clones, genomic DNA was isolated using the Quick-DNA Miniprep kit, and PCR amplification was performed using 2×Taq Master Mix (Dye Plus) and exon flanking primers. The amplification products were separated by electrophoresis on a 1.5% agarose gel. Plasmids were isolated from 8-10 colonies and verified by Sanger sequencing. Clones with mutations in both alleles were selected for further analysis. All clones were cultured under the same conditions as the parental cells. The PCR amplification products obtained by primers from the three regions were fragment-free, fragment-free, and 811bp, which were APOA4-KO.

[0054] The amplification system was a 50 μl reverse transcription system: 25 μl 2×Taq Plus Master Mix; 2 μl Primer-F (10 μM); 2 μl Primer-R (10 μM); 1 μl DNA template; and double-deionized water to make up to 50 μl. The corresponding primers-F and-R are shown in Table 1 below. The amplification program was: 95℃ for 3 minutes (pre-denaturation); then, the amplification cycle was initiated: 95℃ for 15 seconds to denature the template, 60℃ for 15 seconds to fully anneal the primers and template, and 72℃ for 60 seconds to extend the primers onto the template to synthesize DNA. This was repeated for 35 cycles. Finally, 72℃ for 5 minutes was used to completely extend the product. The results are shown below. Figure 3 The results showed that sgRNA1 was successfully cleaved, sgRNA2 was successfully cleaved, and exon 1-3 fragments were successfully cleaved.

[0055] according to Figure 3 It can be seen that the APOA4 exon knockout HepG2 cell line has been successfully constructed --- APOA4-KO HepG2 cell line.

[0056] The sgRNA and primer sequences are shown in Table 1 below:

[0057] Table 1

[0058] sgRNA1 AGTGGTGGCTGTTCCGTGCG TGG sgRNA2 TTGGGGACCGAGACGAGTCT GGG Region1-F GTCTGCAGTCCTGGATGGTC Region1-R CAGGCAGACCTCATGTCCAG Region2-F CATTGAATGCCTCCGATGCG Region2-R AACAGGCTGTGGAGTCGTTT Region3-F ACTACCCACTTCGCAAGCAA Region3-R AACAGGCTGTGGAGTCGTTT

[0059] Experiment 4: Verifying the effect of APOA4 knockout on HepG2 lipid metabolism under hypoxic conditions ( Figure 4 , Figure 5 ).

[0060] The APOA4-KO HepG2 cell line obtained in Experiment 3 was subjected to a hypoxia test (1% O2 concentration) in a hypoxia chamber with the HepG2 cell line. Specifically, samples were collected after 0 h of hypoxia, 24 h of hypoxia, and 48 h of hypoxia, and the following experiments were performed:

[0061] Preparation of Oil Red O staining sections: After fixing the cell slides for 15 min, wash with distilled water; wash with 60% isopropanol, stain with Oil Red O solution for 10 min; separate the color with 60% isopropanol until the background is colorless, wash with distilled water; counterstain with Mayer hematoxylin for several minutes, wash with PBS (blueing) for 1-3 min; after washing with distilled water, mount with water-soluble mounting medium, observe and photograph under a regular white light microscope.

[0062] Triglyceride content detection: Collect 5-10 million cells in centrifuge tubes, centrifuge, discard the supernatant, add 1 mL isopropanol, sonicate for 1 min, centrifuge at 4℃ for 10 min, and collect the supernatant. Utilizing the principle that KOH saponifies TG to produce glycerol and fatty acids, and periodic acid oxidizes glycerol to formaldehyde, and that formaldehyde condenses with acetylacetone in the presence of chloride ions to form a yellow substance, the intensity of which is proportional to the TG content, the TG content was measured using a microplate reader at a wavelength of 420 nm.

[0063] RT-qPCR: 5-10 million cells were collected in centrifuge tubes, centrifuged, and the supernatant was discarded. 1 mL of chloroform was added, and genomic DNA was removed using DNase I. RNA was obtained by washing the column multiple times. The concentration and mass of RNA were measured using a Nanodrop 2000 spectrophotometer, and the same mass of RNA was reverse transcribed into cDNA using M-MLV reverse transcriptase. The cDNA was diluted to 2 ng / μl, and then qPCR was performed on a CFX96 Real-Time PCR thermocycle using the SYBR Green method. The relative expression level of RT-qPCR was calculated using 2^-(△△CT). Primer sequences are shown in Table 2. The results are the amplification cycle number (Ct) of the target gene in each sample.

[0064] The reverse transcription system consisted of 20 μl (2 μl gDNA Clean Reaction Mix; 4 μl 5X Evo M-MLV RT Reaction Mix; 1 μl RNA template, with RNase-free water added to make up to 20 μl). The program was 37°C for 15 minutes, then 85°C for 5 seconds. Finally, the cDNA was stored at 4°C. The quantitative PCR reaction system consisted of 20 μl 2X... Green Pro Taq HS Premix 10 μl; cDNA 2 μl; Primer-F (10 μM) 0.4 μl; Primer-R (10 μM) 0.4 μl; RNase-free water to a final volume of 20 μl; amplification program: 95℃ for 30 seconds (pre-denaturation); followed by amplification cycles: 95℃ for 5 seconds, 60℃ for 30 seconds, for 40 cycles; melting curve plotted using a program of 95℃ for 15 seconds, 60℃ for 1 minute, and 95℃ for 15 seconds. Results are shown below. Figure 5 As stated above.

[0065] according to Figure 4 , Figure 5 The following conclusions can be drawn: HepG2 lacking the APOA4 gene leads to more severe lipid accumulation caused by hypoxia and affects the expression of a series of lipid metabolism-related genes. Specifically, it causes upregulation of ANGPTL4 and PPARG genes, affecting lipid synthesis, and downregulation of SLC27, PLTP, and APOA1 genes, affecting lipid transport. At the same time, ACOX1, ACSL4, CPT1A, ACSL5, ACSL1, ACOX3, ACAA1, and ACOX2, which regulate lipid breakdown, are also affected to varying degrees.

[0066] The primers used for the detection are shown in Table 2 below:

[0067] Table 2

[0068]

[0069]

[0070] Example 1: Blood was drawn from male piglets 7 days after birth. One volume of serum was diluted with four volumes of PBS (pH=7.2) to obtain diluted serum. The APOA4 content in the diluted serum was detected according to the method in Experiment 2 above.

[0071] The corresponding curve equation for the concentration and OD value of APOA4 standard is y = 2.3563x. 2 +59.533x-2.9098; x is the OD value, y is the APOA4 concentration; then substitute the OD value of the diluted serum into the above curve equation to obtain the APOA4 content in the diluted serum, and then multiply by a dilution factor of 5 to obtain the APOA4 content in the serum.

[0072] For male piglets in the same litter:

[0073] Male piglets whose weight is two standard deviations below the average weight of male piglets in their litter are defined as suspected IUGR male piglets; otherwise, they are defined as normal male piglets.

[0074] The APOA4 content in the serum of normal male piglets was detected, and the average value was taken.

[0075] The APOA4 content of suspected IUGR male piglets was tested. When the APOA4 content exceeded 1.25 times the average value, the piglets were identified as IUGR male piglets; otherwise, they were identified as normal male piglets.

[0076] The present invention has employed numerous experiments to verify the correctness of the above-described embodiment 1. The following are some of the experiments conducted during the invention process:

[0077] Experiment 1: Seven male piglets from the same litter:

[0078] The OD values ​​obtained from the serum of five male piglets with normal body weight ranged from 0.392 to 0.513, corresponding to APOA4 expression levels of 103.945 to 141.252; the average value was approximately 120.

[0079] The serum levels of two suspected IUGR piglets, which were underweight (male piglets whose weight was two standard deviations below the average weight of male piglets in the same litter), ranged from 0.601 to 0.647, corresponding to APOA4 expression levels of 168.603 to 182.972; thus, these piglets were identified as IUGR piglets.

[0080] When the IUGR piglets and normal piglets are raised using conventional methods, after 5 months, the IUGR piglets will weigh approximately 80-86 kg, while the normal piglets will weigh approximately 116-122 kg.

[0081] Experiment 2: Six male piglets from the same litter:

[0082] The OD values ​​obtained from the serum of four male piglets with normal body weight ranged from 0.4035 to 0.5215, corresponding to APOA4 expression levels of 107.4765 to 143.887; the average value was approximately 127.

[0083] Two suspected IUGR piglets were found to be underweight (male piglets whose weight was two standard deviations below the average weight of male piglets in their litter):

[0084] The serum level of suspected IUGR piglet #1 was 0.611, therefore the corresponding APOA4 expression level was 171.722; the piglet was determined to be an IUGR piglet.

[0085] The serum level of the suspected IUGR piglet #2 was 0.435, therefore the corresponding APOA4 expression level was 117.164; the piglet was determined to be a normal piglet.

[0086] The IUGR piglets and normal piglets were fed using conventional methods. After 5 months, the average weight of the suspected IUGR piglet #2 was not significantly different from that of the normal piglets; while the average weight of the suspected IUGR piglet #1 was much lower than that of the normal piglets.

[0087] Experiment 3: Five male piglets from the same litter:

[0088] The OD values ​​of serum from four male piglets with normal body weight ranged from 0.3955 to 0.5015, corresponding to APOA4 expression levels of 105.019 to 137.692; the average value was approximately 114.

[0089] A suspected IUGR piglet with low body weight (male piglets whose weight is two standard deviations below the average weight of male piglets in the same litter) was near death soon after birth, and its serum APOA4 expression level exceeded 170 μmol / L.

[0090] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.

Claims

1. The application of a reagent for detecting APOA4 in the preparation of a reagent for determining whether a male piglet is intrauterine growth-restricted, characterized in that: Male piglets with intrauterine growth restriction had higher levels of APOA4 in their liver and serum compared to normal male piglets.

2. The application according to claim 1, characterized in that: The amino acid sequence of APOA4 is shown in SEQ ID NO:

1.

3. The application according to claim 2, characterized in that: For male piglets in the same litter: Male piglets whose weight is two standard deviations below the average weight of male piglets in their litter are defined as suspected IUGR male piglets; otherwise, they are defined as normal male piglets. The APOA4 content in the serum of normal male piglets was detected, and the average value was taken. The APOA4 content of suspected IUGR male piglets was tested. When the APOA4 content exceeded 1.25 times the average value, the piglets were identified as IUGR male piglets; otherwise, they were identified as normal male piglets.

Images