An antimicrobial peptide, a recombinant antimicrobial peptide thereof, and a preparation method and application thereof

Abstract

The present invention belongs to the field of antimicrobial peptides in biotechnology, and specifically relates to an antimicrobial peptide, a recombinant antimicrobial peptide of the antimicrobial peptide, and a preparation method and application thereof. The amino acid sequence of the antimicrobial peptide is shown in SEQ ID NO: 1, and the nucleotide sequence of the gene expressing the antimicrobial peptide is shown in SEQ ID NO: 2. A recombinant antimicrobial peptide of the antimicrobial peptide is prepared, and the antimicrobial peptide or recombinant antimicrobial peptide can be used to inhibit the growth of Streptococcus suis and exhibit a highly efficient bactericidal effect on Streptococcus suis by increasing cell membrane permeability, or to participate in the regulation of IMD and Toll pathways, or to enhance the immune defense system of Lepidoptera Sphenopteridae insects, and improve the antimicrobial ability of Lepidoptera Sphenopteridae insects. The antibodies produced by using the antimicrobial peptide or recombinant antimicrobial peptide can be used to track the above antimicrobial peptide or the above recombinant antimicrobial peptide, or to promote the expression of multiple antimicrobial peptides of insects, or to specifically recognize, bind and shield antigens.

Description

Technical Field

[0001] The present invention belongs to the field of antimicrobial peptides in biotechnology, and specifically relates to an antimicrobial peptide, a recombinant antimicrobial peptide of the antimicrobial peptide, and a preparation method and application thereof. Background Art

[0002] Insects are one of the oldest organisms on Earth, with a wide variety of species. More than one million species have been identified so far. Insects are almost everywhere in the biosphere, except in the polar regions and the deep sea. Insects are invertebrates. Unlike vertebrates, they do not have an acquired immune system. In order to better adapt to the environment, insects have evolved a complex innate immune system. The unique innate immune system of insects enables them to survive in nature. When insects are stimulated by foreign pathogens, the pattern recognition receptors in the insects can recognize these foreign substances and transmit these signals step by step, eventually triggering factors such as humoral immunity and cellular immunity of insects to remove foreign substances. Cellular immunity mainly refers to the phagocytosis, aggregation, and encapsulation of foreign invading substances or antigens by blood cells composed of plasma cells and granulocytes. The main functions of humoral immunity include promoting the production of antimicrobial peptides and activating the phenoloxidase cascade reaction to form melanin to jointly fight against pathogens. Among them, the production of antimicrobial peptides plays a very important role in humoral immunity. Insect antimicrobial peptides are stable small molecule polypeptides that are synthesized by the fat body of insects and released into the hemolymph to resist the invasion of foreign substances. Antimicrobial peptides have attracted much attention due to their wide variety and antimicrobial spectrum. So far, many antimicrobial peptides have been found in insects such as fruit flies, silkworms, wax moths, cotton bollworms, tobacco tussahs, etc.

[0003] When insects are stimulated by pathogens, they will produce a large number of antimicrobial peptides to eliminate pathogens. When different types of pathogens attack insects, insects will secrete different antimicrobial peptides to eliminate the corresponding pathogens. At present, the research on the regulatory mechanism of insect antimicrobial peptides is mainly based on the Toll and IMD signaling pathways. The Toll signaling pathway is generally activated by fungi or Gram-positive bacteria and can produce antimicrobial peptides that specifically eliminate fungi and Gram-positive bacteria, while the IMD signaling pathway is mostly activated by Gram-negative bacteria to produce antimicrobial peptides that specifically eliminate Gram-negative bacteria and some Gram-positive bacteria.

[0004] As active biological macromolecules, antimicrobial peptides have an inhibitory effect on foreign pathogens such as bacteria. As more and more antimicrobial peptides are discovered, the research on the mechanism of action of antimicrobial peptides is also increasing. Positively charged antimicrobial peptides can bind to negatively charged substances on the cell wall through electrostatic attraction, thereby destroying the structure of the cell wall and allowing the antimicrobial peptide to approach the cell membrane. The hydrophilic end of the antimicrobial peptide then binds to the phospholipids of the cell membrane, and the hydrophobic end of the antimicrobial peptide binds to the lipids of the cell membrane. The combination of the two destroys the originally stable lipid bilayer of the cell membrane, causing a large outflow of cell contents and the death of bacterial cells. A few antimicrobial peptides can quickly penetrate the cell membrane without destroying the cell membrane, enter the cell and bind to intracellular targets, such as inhibiting cell respiration, destroying the structure of DNA, and hindering the replication and transcription process of the cell to achieve a bactericidal effect.

[0005] Attacin was first discovered in Hyalophora cecropia. This type of antimicrobial peptide is widely distributed and has been found in Manduca sexta, Antheraea mylitta, Drosophila melanogaster, Musca domestica, and Antheraea pernyi. Attacin has three main domains, including an α-helical domain, a β-hairpin domain, and a coiled-coil domain. The N-terminus of this type of antimicrobial peptide contains an α-helix, and the internal structure of the protein of this type of antimicrobial peptide varies depending on the insect species. Studies on the structure of antimicrobial peptides have shown that antimicrobial peptides with more α-helices have stronger antibacterial ability against Gram-negative and Gram-positive bacteria. Studies have shown that Attacin can hinder the transcription of membrane proteins in Escherichia coli, hindering the synthesis of membrane proteins, and thus increasing the permeability of the cell membrane and killing the bacteria.

[0006] Antimicrobial peptides have a unique antibacterial mechanism - they can resist bacteria and fungi and have no hemolytic activity. They have strong antibacterial ability, a broad antibacterial spectrum, no drug resistance, and good thermal stability, making them a potential new generation of antibacterial drugs to replace antibiotics. However, the content of antimicrobial peptides in insect natural body fluids is low, which is not conducive to the study of their antibacterial activity. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides an antimicrobial peptide, a recombinant antimicrobial peptide of the antimicrobial peptide, and a preparation method and application thereof.

[0008] The present invention is implemented by providing an antimicrobial peptide, the amino acid sequence of which is shown in SEQ ID NO: 1.

[0009] Preferably, the antimicrobial peptide is derived from insects of the family Cecropia in the order Lepidoptera.

[0010] A gene for expressing the antimicrobial peptide is provided, wherein the nucleotide sequence of the gene is shown in SEQ ID NO: 2.

[0011] Provided is a primer for amplifying the above gene, comprising:

[0012] Attacin-BamHI-F:

[0013] CGGGATCCATGCATCATCATCATCATTTAGTTCCTCGTGGTTCTGTCTTG

[0014] GATGGGAAATCTCAA

[0015] Attacin-HindIII-R:

[0016] CCCAAGCTTTCTAAAAACGAATATTGTATTCCAGCCTCACGCTAGGTTG CCA;

[0017] A method for preparing the above-mentioned recombinant antimicrobial peptide is provided, comprising the following steps:

[0018] 1) Construction of recombinant expression plasmid:

[0019] The cDNA of the gene was used as a template, and the above primers were used for PCR amplification to obtain the full sequence of the antimicrobial peptide, and a recombinant expression plasmid was constructed. The recombinant plasmid was transformed into competent cells to contain Kan + Screening of resistant solid culture medium, picking positive colonies for colony PCR and sequencing verification, and finally obtaining recombinant bacteria containing positive recombinant expression plasmids;

[0020] 2) Induced expression and solubility analysis of recombinant bacteria:

[0021] Pick a positive single colony and inoculate it into liquid culture medium for overnight culture, then inoculate it into new liquid culture medium and continue to culture until OD 600 ≈0.5, take the bacterial solution before induction as the control, add IPTG, and then culture at low temperature overnight, collect the bacterial cells, resuspend them, ultrasonically break them, centrifuge them, and take the supernatant and precipitate for SDS-PAGE electrophoresis analysis. The results show that the recombinant protein exists in the form of inclusion bodies;

[0022] 3) Isolation and purification of recombinant antimicrobial peptides:

[0023] 3.1) Metal chelate chromatography:

[0024] The cells were resuspended and ultrasonically disrupted, and the inclusion bodies obtained were denatured and dissolved with an equilibrium buffer containing urea, and the supernatant was centrifuged and purified by metal chelate chromatography. Each eluted sample was analyzed by SDS-PAGE electrophoresis;

[0025] 3.2) Dialysis refolding of recombinant protein:

[0026] The recombinant protein is subjected to gradient dialysis to remove urea in the equilibrium buffer to renature the recombinant protein;

[0027] 3.3) Removal of His tag from recombinant protein:

[0028] There is a thrombin recognition sequence between the His tag and the recombinant antimicrobial peptide. The His tag is removed by thrombin cleavage, and the thrombin in the cleavage product is removed by benzamidine agarose.

[0029] Provided is a recombinant antimicrobial peptide, which is prepared according to the above method.

[0030] Provided is an application of the above antimicrobial peptide or the above recombinant antimicrobial peptide, which is used to inhibit the growth of Streptococcus suis and exhibit a highly effective bactericidal effect on Streptococcus suis by increasing cell membrane permeability, or is used to participate in the regulation of IMD and Toll pathways, or is used to enhance the immune defense system of Lepidoptera Sphenopteridae insects, thereby improving the antimicrobial ability of Lepidoptera Sphenopteridae insects.

[0031] Provided is an antibody produced using the above antimicrobial peptide or the above recombinant antimicrobial peptide as an antigen.

[0032] The application of the above-mentioned antibody is provided, which is used for tracking the above-mentioned antimicrobial peptide or the above-mentioned recombinant antimicrobial peptide or for promoting the expression of multiple antimicrobial peptides of insects or for specifically recognizing, binding and shielding antigens.

[0033] Compared with the prior art, the advantages of the present invention are:

[0034] An antimicrobial peptide is isolated from tussah silkworm, and a recombinant antimicrobial peptide of the antimicrobial peptide is prepared by genetic engineering. The antimicrobial peptide or recombinant antimicrobial peptide can be used to inhibit the growth of Streptococcus suis and exhibit a highly effective bactericidal effect on Streptococcus suis by increasing cell membrane permeability, or to participate in the regulation of IMD and Toll pathways, or to enhance the immune defense system of Lepidoptera Sphingidae insects, and improve the antimicrobial ability of Lepidoptera Sphingidae insects. The antibodies produced by the antimicrobial peptide or recombinant antimicrobial peptide can be used to track the above antimicrobial peptide or the above recombinant antimicrobial peptide, or to promote the expression of multiple antimicrobial peptides in insects, or to specifically recognize, bind and shield antigens. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1The results of the amplification of His6-Ap-Attacin by colony PCR were detected by agarose gel electrophoresis;

[0036] Figure 2 The results of the induced expression of His6-Ap-Attacin were identified by SDS-PAGE (M: Protein ladder; 1: IPTG-induced fragmentation precipitate; 2: IPTG-induced fragmentation supernatant; 3: IPTG-uninduced fragmentation precipitate; 4: IPTG-uninduced fragmentation supernatant);

[0037] Figure 3 The results of purification of recombinant Ap-Attacin by Chelating Sepharose Fast Flow column;

[0038] Figure 4 The purification results of recombinant Ap-Attacin were identified by SDS-PAGE;

[0039] Figure 5 is the BCA protein standard curve;

[0040] Figure 6 This is the tissue distribution map of the antimicrobial peptide Attacin;

[0041] Figure 7 The expression results of Ap-Attacin after induction by C.albican, S.suis, and E.coli;

[0042] Figure 8 The results are for the inhibition of the growth of Streptococcus suis S.suis by recombinant Ap-Attacin;

[0043] Fig. 9 The results show the bactericidal effect of recombinant Ap-Attacin on Streptococcus suis S.suis. DETAILED DESCRIPTION

[0044] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0045] In the present invention, the insect of the family Cecropia of the order Lepidoptera can be one of the following: tussah silkworm, ricin silkworm, silkworm, Indian tussah silkworm, amber silkworm, American tussah silkworm, catalpa silkworm, mountain silkworm, American silkworm, camphor silkworm, maple silkworm, and can be any natural or artificially raised or artificially reared insect in any region. In the following specific embodiments, tussah silkworm is selected for the following test.

[0046] Example 1: Purification of natural antimicrobial peptides from Tussah silkworm

[0047] 1) A mixture of fungi, Gram-positive bacteria and Gram-negative bacteria (10ul) resuspended in insect physiological saline was injected into the body of tussah silkworms. After induction for 12 to 24 hours, about 200ml of body fluid was slowly dialyzed in 4L 20mM Tis-HCl (pH7.4, 100mMNaCl, 2mM CaCl2) buffer system at 4℃ for at least 24h. After centrifugation at 4℃, 3000prm / min for 10min, the supernatant was divided into two groups for treatment. The first group of samples (ice bath samples): the supernatant was ice bathed and ultrasonicated (50W, 40 to 50s), and after centrifugation at 4℃, 12000prm / min for 10min, the supernatant was filtered through a 0.22um filter membrane for use. The second group of samples (heated samples): the supernatant was ultrasonicated (50W, 40-50s), heated in a 90°C water bath for 30min, centrifuged at 4°C, 12000-48000prm / min for 10min, and then filtered through a 0.22um filter membrane for later use.

[0048] 2) Method for separating and purifying antimicrobial peptides from tussah silkworms by heating samples

[0049] The hemolymph was added to a dialysis bag with a molecular weight cutoff of 10,000 Daltons, and the dialysis bag was placed in buffer A (50 mM Tris, 3 mM EDTA, pH 6.0), dialyzed at 4°C for 12 hours, centrifuged at 20,000 g for 15 min to remove insoluble matter, and the sample was loaded onto a CM-Toyopearl 650M column (3×15CM, TOSHO) pre-equilibrated with buffer A. After completion, the column was washed with buffer A until the OD280 of the pass was less than 0.05, and then the protein adsorbed on the column was eluted with a sodium chloride gradient (0-1 M, 500 ml). The sample of the eluate was collected using a step collector, and dialyzed using buffer B (20 mM Tris, 3 mM EDTA, pH 8.0) as a dialysate for 12 hours for the next purification step. A Q-sepharose FF anion exchange column (3×15 cm) was pre-equilibrated with buffer B for 1 hour at a flow rate of 4 ml / min. The column eluate obtained in the previous step was passed through at the same flow rate. After the sample was loaded, it was equilibrated again with buffer B until the OD value of the substance passed was 0. 280Less than 0.05, collect all the sample through the peak and the equilibrium through. Use sodium chloride gradient (0-1M, 400ml) to elute the protein adsorbed on the column, and use a step collector to obtain the eluate. The concentrated Q-Sepharose eluate was used as the sample, and the HiTrap Heparin column (5 ml) was pre-equilibrated with buffer A. The sample was loaded at a flow rate of 4 ml / min. The buffer A was equilibrated until the baseline was stable. The adsorbed protein was eluted using a sodium chloride gradient (0-1 M, 400 ml). The eluate was collected and the sample was concentrated using a centrifugal ultrafiltration tube. The final volume was 5 ml for the next purification. The HiTrap SP HP column (1 ml) was pre-equilibrated with buffer A at a flow rate of 4 ml / min, and then the concentrated HiTrap Heparin eluate was loaded. After the end, it was equilibrated with buffer A until the baseline was stable. The adsorbed protein was eluted using a sodium chloride gradient (0-1 M, 400 ml). The eluate was collected and the sample was concentrated to 0.5 ml using a centrifugal ultrafiltration tube for the next purification. The TSKgel G2000SW molecular sieve chromatography column was connected to the HPLC system and buffer D (50 mM Tris, 3 mM EDTA, 150 mM NaCl, pH6.0) was pre-equilibrated to a stable baseline at a flow rate of 0.5 ml / min. The concentrated sample was injected into HPLC, and the portion with the ultraviolet absorption peak (OD280) was manually collected. The obtained sample was centrifuged and concentrated, and the buffer was replaced with C (20 mM sodium phosphate, pH7.0). The obtained sample was loaded onto a Hydroxylapatite column (5 mm x 50 mm, Bio-Rad) equilibrated with buffer C at a flow rate of 0.5 ml / min, and the same buffer was used to equilibrate to a stable baseline. The adsorbed protein was eluted using a phosphate gradient (20 mM-500 mM, 50 ml) to obtain the purified target protein.

[0050] 3) The tussah body fluid dissolved in the anticoagulant buffer solution is centrifuged to remove blood cells, and the tussah hemolymph without blood cells is used as a sample for purifying the tussah antimicrobial peptide Attacin. 200 ml of the sample is subjected to ammonium sulfate graded precipitation, and 35-50% of the precipitation component is dissolved and diluted with a citric acid-phosphate buffer system, and this is used as the initial loading liquid to be loaded on a heparin affinity chromatography column to remove the influence of foreign proteins, and the effluent is loaded on an SP-Sepharose cation exchange column and washed and eluted, and the component containing the target fragment is loaded on a Q-Sepharose anion exchange column for washing and elution, and then the target component is further washed and eluted with a ConA column to obtain the target protein.

[0051] 4) Method for separating and purifying antimicrobial peptides from tussah silkworms using ice bath samples

[0052] The sample treated in an ice bath was first passed through a 150KDa filter membrane to remove high molecular weight proteins, and the sample was passed through an 80kDa filter membrane to obtain a further purified and concentrated sample. The retained sample was dissolved in a Tris-HCl (20mM, pH 7.5) buffer solution and used as the initial sample to load a Mono S HR 5 / 5 cation exchange column (FPLC system) equilibrated with the same buffer solution at a flow rate of 0.5ml / min. The purified fraction containing the target protein was washed and eluted under the gradient elution condition of 0-100% 0.5M NaCl (acetate buffer solution, 20mM, pH5.0), and the retained protein was equilibrated with sodium acetate (20mM, pH5.0) buffer solution and loaded onto a DEAE sepharose CL-6B anion exchange column (Pharmacia17-0710-01) as the initial loading solution, and the column was washed with Tris-HCl (20mM, pH 7.5) buffer solution at a flow rate of 0.5ml / min to A 280 <0.01. The bound protein was eluted step by step with Tris-HCl (20 mM, pH 7.5) buffer solution containing 0.5 M NaCl to finally obtain the purified target protein fraction.

[0053] 5) The tussah body fluid dissolved in the anticoagulant buffer solution is centrifuged to remove blood cells, and the tussah hemolymph without blood cells is used as a sample for purifying the tussah antimicrobial peptide Attacin. 200 ml of the sample is subjected to ammonium sulfate graded precipitation, and 35-50% of the precipitation component is taken as the initial loading liquid to act on a reversed-phase hydrophobic C8 chromatography column, and washed and eluted with an organic solvent, and the component containing the target protein is dialyzed to remove the organic solvent, and the dialyzed sample is loaded on a gel filtration chromatography column TSKgelG2000SW for further separation and purification, thereby obtaining the target protein.

[0054] 6) The tussah body fluid dissolved in the anticoagulant buffer solution was centrifuged to remove blood cells, and the tussah hemolymph without blood cells was used as a sample for purifying the tussah antimicrobial peptide Attacin. 200 ml of the sample was subjected to ammonium sulfate graded precipitation, and 35-50% of the precipitation components were dissolved and diluted with a citric acid-phosphate buffer system, and this was used as the initial loading solution and loaded onto an SP-Sepharose cation exchange column for washing and elution, and the components containing the target protein were loaded onto a Q-Sepharose anion exchange column for washing and elution, and each washing and elution component was followed and monitored by Western blot using an tussah antimicrobial peptide Attacin antibody.

[0055] 7) The tussah body fluid dissolved in the anticoagulant buffer solution is centrifuged to remove blood cells, and the tussah hemolymph without blood cells is used as a sample for purifying the tussah antimicrobial peptide Attacin. 200 ml of the sample is subjected to ammonium sulfate graded precipitation, and 35-50% of the precipitation components are dissolved and diluted with a citric acid-phosphate buffer system, and the initial sample solution is loaded onto an SP-Sepharose cation exchange column for washing and elution, and the component containing the target protein is loaded onto a heparin chromatography column for washing and elution, and the effluent is loaded onto a hydroxyapatite chromatography column for further impurity removal, and the effluent is loaded onto a Q-Sepharose anion exchange column for washing and elution, and the component containing the target fragment is loaded onto a gel filtration chromatography column Sepharose CL-6B column for further separation and purification, thereby obtaining the target protein.

[0056] Example 2: Preparation of recombinant antimicrobial peptides

[0057] 1) Construction of recombinant expression plasmid pET-28a(+)-His6-Ap-Attacin

[0058] The prepared cDNA was used as a template and Attacin-BamHI-F / Attacin-HindIII-R as primers for PCR amplification to obtain the full sequence of the mature peptide of Ap-Attacin. The recombinant expression plasmid pET-28a(+)-His6-Ap-Attacin was constructed and transformed into E.coli BL21(DE3) competent cells to contain Kan + The solid culture medium with resistance was used for screening, and positive colonies were selected for colony PCR and sequencing verification, and finally recombinant bacteria containing positive recombinant plasmids were obtained. Figure 1 shown.

[0059] 2) Induction expression and solubility analysis of recombinant bacteria BL21(DE3)pET-28a(+)-His6-Ap-Attacin

[0060] Pick a positive single colony and inoculate it into liquid culture medium for overnight culture, then inoculate it into new liquid culture medium and continue to culture until OD 600 ≈0.5. Take 1mL of pre-induction bacterial solution as a control, add IPTG with a final concentration of 0.1mmol / L to the rest of the bacterial solution, and then culture overnight at low temperature (25℃) for 12-16h. Collect the bacterial cells, resuspend them in the equilibrium buffer, and ultrasonically break them. Then centrifuge them at 4℃, 12000rpm for 5min, and take the supernatant and precipitate for SDS-PAGE electrophoresis analysis. The results are as follows Figure 2 , the recombinant protein mainly exists in the form of inclusion bodies.

[0061] 3) Isolation and purification of recombinant Ap-Attacin

[0062] 3.1) Metal chelate chromatography

[0063] After an appropriate amount of bacterial cells were resuspended in an equilibrium buffer and ultrasonically disrupted, the resulting inclusion body sample was denatured and dissolved in an equilibrium buffer containing 8M urea, and the supernatant was centrifuged and purified by metal chelate chromatography. The chromatogram is shown in Figure 3. Each eluted sample was analyzed by 12% SDS-PAGE. Figure 4 As shown, the target protein has basically reached electrophoretic purity.

[0064] 3.2) Dialysis refolding of recombinant protein

[0065] The protein was dialyzed by gradient to gradually remove the urea in the buffer to renature the target protein.

[0066] 3.3) Removal of His tag from recombinant protein and determination of protein concentration

[0067] There is a thrombin recognition sequence between the His tag and the recombinant antimicrobial peptide. The His tag is removed by thrombin cleavage, and the thrombin in the cleavage product is removed by benzamidine agarose. The protein standard curve Figure 5 It can be seen that the protein sample concentration obtained after measurement is about 0.2 mg / ml and is stored at -20°C for future use.

[0068] Example 3: Immune relevance of Attacin expression in Antheraea pernyi

[0069] 1) Tissue distribution of Ap-Attacin after microbial induction

[0070] The real-time quantitative PCR method was used to detect the expression of Ap-Attacin mRNA in different tissues (epidermis, midgut, fat body, hemocytes, and Malpighian tubules) of Antheraea pernyi after microbial induction. The 18S rRNA gene of Antheraea pernyi was used as an internal reference. Figure 6 Under physiological conditions, the mRNA level of the antimicrobial peptide Attacin is very low. After induction by mixed bacteria (E. coil, S. suis, C. albican), the mRNA level of Attacin is very high and the main expression tissues are the fat body and epidermis, a small amount is expressed in the hemolymph, and almost not expressed in the midgut and Malpighian tubules.

[0071] 2) Ap-Attacin mRNA expression after microbial induction

[0072] E.coil, S.suis, and C.albican were injected into the larvae of Antheraea pernyi, respectively. After 0h, 3h, 6h, 9h, 12h, 18h, 24h, and 48h, the whole insect tissues were collected to extract total RNA. The same method was used to detect the expression of Ap-Attacin in the larvae of Antheraea pernyi after being invaded by pathogenic microorganisms. Figure 7 After the induction of the three bacteria, the mRNA content of Ap-Attacin was significantly upregulated and reached a peak at 12h, and then the mRNA content of Ap-Attacin gradually decreased with the extension of time. The above experiments show that Ap-Attacin may be involved in the immune defense process of Antheraea larvae.

[0073] Example 4: Antibacterial activity of recombinant Ap-Attacin

[0074] 1) Antibacterial effect of recombinant Ap-Attacin on Streptococcus suis

[0075] The antibacterial activity of the antimicrobial peptide Ap-Attacin from tussah was investigated. Streptococcus suis was inoculated into LB liquid culture medium and cultured with shaking until the logarithmic growth phase; 30 μL of the culture solution was taken and inoculated into several test tubes containing 3 mL of fresh LB culture medium and cultured for 3 h. An equal volume of recombinant Ap-Attacin containing 20, 40 and 60 μM was added to the test tubes and cultured with shaking for 9 h. The test tubes with an equal volume of protein buffer were used as the control group. 600nm Observe the changes in the optical density of the bacteria in each test tube. Figure 8 As shown, the OD value of the culture medium of Streptococcus suis S. suis significantly decreased after adding recombinant Ap-Attacin, and the turbidity of the culture medium decreased significantly with the increase of the concentration of the recombinant protein added, indicating that recombinant Ap-Attacin does have the effect of inhibiting the growth of Streptococcus suis S. suis.

[0076] 2) Bactericidal effect of recombinant Ap-Attacin on Streptococcus suis

[0077] In this experiment, the lactate dehydrogenase release assay kit (LDH Release Assay Kit) was used to test the bactericidal effect of recombinant Ap-Attacin on Streptococcus suis. Streptococcus suis S.suis was inoculated into 4 mL of liquid culture medium and cultured at 37°C overnight. After centrifugation at 4000 rpm for 5 minutes to remove the culture medium, the mixture was washed three times with PBS and resuspended. After incubating 15 μL of bacterial suspension with 135 μL of recombinant Ap-Attacin (20, 40, 60 μM) for a certain period of time, centrifuged at 4000 rpm, 120 μL of supernatant was taken into a new EP tube and 60 μL of mixed substrate of lactate dehydrogenase LDH was added. Incubated in the dark, after the color changed, the OD value of each product was detected at a wavelength of 490 nm per minute and calculated as the enzyme activity (U / mL). In the experiment, the same volume of protein buffer was added as a negative control, and each sample was tested in parallel 3 times. The results are as follows Fig. 9 As shown, compared with the control group, after adding the substrate and detecting the maximum light absorption value of the catalyzed substrate by spectrophotometer, the LDH enzyme activity in the extracellular fluid of Streptococcus suis S. suis after the action of recombinant Ap-Attacin was significantly increased, and with the increase of the concentration of the added recombinant protein, the amount of LDH released increased, indicating that Ap-Attacin can change the cell permeability of Streptococcus suis S. suis, suggesting that recombinant Ap-Attacin has a bactericidal effect on Streptococcus suis S. suis.

Claims

1. An antimicrobial peptide, characterized in that: The amino acid sequence of the antimicrobial peptide is shown in SEQ ID NO:

1.

2. The antimicrobial peptide according to claim 1, characterized in that The antimicrobial peptide is derived from insects of the family Cecropia in the order Lepidoptera.

3. The gene expressing the antimicrobial peptide according to claim 1, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO:

2.

4. Primers for amplifying the gene according to claim 3, characterized in that: include: Attacin - B H -F： CGGGATCCATGCATCATCATCATCATCATTTAGTTCCTCGTGGTTCTGTCTTGGATGGGAAATCTCAA Attacin - HindIII -R： CCCAAGCTTCTAAAAACGAATATTGTATTCCAGCCTCACGCTAGGTTGCCA.

5. The method for preparing the recombinant antimicrobial peptide of claim 1, characterized in that: The steps include: 1) Construction of recombinant expression plasmid: Using the cDNA of the gene as a template, PCR amplification is performed using the primers described in claim 3 to obtain the full sequence of the antimicrobial peptide, a recombinant expression plasmid is constructed, and the recombinant plasmid is transformed into competent cells to contain Kan + Screening of resistant solid culture medium, picking positive colonies for colony PCR and sequencing verification, and finally obtaining recombinant bacteria containing positive recombinant expression plasmids; 2) Inducible expression and solubility analysis of recombinant bacteria: Pick a positive single colony and inoculate it into liquid culture medium for overnight culture, then inoculate it into new liquid culture medium and continue to culture until OD 600 ≈0.5, take the bacterial solution before induction as the control, add IPTG, and then culture at low temperature overnight, collect the bacterial cells, resuspend them, ultrasonically break them, centrifuge them, and take the supernatant and precipitate for SDS-PAGE electrophoresis analysis. The results show that the recombinant protein exists in the form of inclusion bodies; 3) Isolation and purification of recombinant antimicrobial peptides: 3.1) Metal Chelate Chromatography: The cells were resuspended and ultrasonically disrupted, and the inclusion bodies obtained were denatured and dissolved with an equilibrium buffer containing urea, and the supernatant was centrifuged and purified by metal chelate chromatography. Each eluted sample was analyzed by SDS-PAGE electrophoresis; 3.2) Dialysis refolding of recombinant protein: The recombinant protein is subjected to gradient dialysis to remove urea in the equilibrium buffer to renature the recombinant protein; 3.3) Removal of His tag from recombinant protein: There is a thrombin recognition sequence between the His tag and the recombinant antimicrobial peptide. The His tag is removed by thrombin cleavage, and the thrombin in the cleavage product is removed by benzamidine agarose to obtain the recombinant antimicrobial peptide.

6. A recombinant antimicrobial peptide, characterized in that: It is prepared according to the method of claim 5.

Images