A miRNA-nz, a miRNA-nz precursor gene and its application and acquisition method

Abstract

The present invention relates to the field of genetic engineering breeding, and in particular to a miRNA-nz, a miRNA-nz precursor gene, and an application and acquisition method thereof. The mature sequence of the miRNA-nz is shown in SEQ ID No.1, and the precursor sequence of the miRNA-nz is shown in SEQ ID No.2. The present invention uses 84k silver gland poplar as a material, screens and identifies miRNA-nz, and based on the phenotypic identification of miRNA-nz gene overexpression plants and physiological and biochemical indicators, it is shown that miRNA-nz can improve its nitrogen absorption and utilization efficiency by changing the poplar root system configuration, indicating that miRNA-nz is a key gene for the poplar root system to respond to nitrogen, which provides a new idea for improving the nitrogen absorption and utilization efficiency of woody plants, and has important application value in the field of forest genetic engineering.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to a miRNA-nz, a miRNA-nz precursor gene and an application and an acquisition method thereof. Background Art

[0002] Nitrogen is one of the essential macronutrients in the growth and development of plants. The absorption and utilization efficiency of nitrogen directly affects the growth, development and yield of agricultural and forestry plants. In order to cope with the complex and changeable soil nitrogen environment, plants often reshape their root architecture to improve their nitrogen absorption and utilization efficiency. The remodeling of plant root morphology depends on the change of root growth and development gene expression pattern. Plant roots mainly sense the changes in nitrogen in the soil, activate the expression of key regulatory genes, such as transporter genes, microRNAs and transcription factors, and then regulate the expression of genes related to root growth and development to reshape the root architecture. In this process, nitrate is not only the main nutrient for most terrestrial plants to absorb inorganic nitrogen, but also plays a key role as a signal molecule. It is generally believed that nitrate supply can promote the growth of plant taproots. Therefore, it is necessary to deeply explore the key genes of agricultural and forestry plant root systems responding to nitrogen and analyze their molecular regulatory mechanisms. Using molecular biological methods to improve the nitrogen absorption and assimilation capacity of agricultural and forestry plant roots is an urgent problem to be solved in order to cultivate new agricultural and forestry plant germplasms that efficiently absorb and utilize soil nitrogen.

[0003] MicroRNAs (miRNAs) are a class of highly conserved small RNAs with a length of about 18 to 24 bases (nt) that are widely present in eukaryotes. Most of them come from non-coding spacers between nuclear genes, and some come from partial regions of introns of known genes. It is estimated that in eukaryotes, about 30% of genes are regulated by miRNAs. Since the discovery of the first miRNA in eukaryotes in 1993, the analysis of the mechanism of action of miRNAs has become a frontier hotspot in the field of biological research. Studies have shown that miRNAs play an important role in plant growth and development and plant response to abiotic environmental stress. In recent years, researchers have found that under nitrate treatment, the expression pattern of miRNAs changes. Among them, the research on miR393 and miR167 is the most in-depth. Under nitrate treatment, the expression patterns of the above two miRNAs change, thereby inhibiting the growth of the main root of Arabidopsis thaliana and promoting the initiation and germination of lateral roots. The above findings on miRNAs research have opened up a new perspective for the study of the mechanism of plant root morphological reconstruction in response to nitrate.

[0004] At present, there are few reports on the breeding of new varieties that regulate the response of poplar roots to nitrate in woody plants. Therefore, it is of great significance to use woody plants as research objects, combine molecular biology and genetic engineering technology, analyze the response of poplar root miRNA-nz to nitrate, and cultivate new poplar varieties with high nitrogen absorption and utilization efficiency through molecular breeding.

[0005] In view of this, the present invention proposes a miRNA-nz, a miRNA-nz precursor gene and an application and acquisition method thereof to address the deficiencies in the prior art. Summary of the invention

[0006] In order to solve the above problems, the present invention provides a miRNA-nz, a miRNA-nz precursor gene and its application and acquisition method. The present invention uses transgenic means to obtain poplar overexpression plants, in order to improve the absorption and utilization efficiency of nitrogen by changing the root structure of the poplar, provide technical means for the breeding or screening of new poplar varieties with high nitrogen absorption and utilization efficiency, and lay the foundation for exploring the molecular mechanism of nitrogen absorption and utilization in woody plants.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] The present invention provides a miRNA-nz, wherein the nucleotide sequence of the mature sequence of the miRNA-nz is shown as SEQ ID No.1, and the nucleotide sequence of the precursor sequence of the miRNA-nz is shown as SEQ ID No.2.

[0009] The present invention also provides a miRNA-nz precursor gene, the nucleotide sequence of the miRNA-nz precursor gene is shown as SEQ ID No.9.

[0010] The present invention also provides the use of the miRNA-nz described in the above technical solution or the miRNA-nz precursor gene described in the above technical solution in regulating the poplar root architecture in response to nitrate.

[0011] The present invention also provides the use of the miRNA-nz described in the above technical solution or the miRNA-nz precursor gene described in the above technical solution in cultivating poplar varieties with high nitrogen absorption and utilization efficiency through molecular breeding.

[0012] The present invention also provides the use of the miRNA-nz described in the above technical solution or the miRNA-nz precursor gene described in the above technical solution in increasing the length of poplar roots under nitrate treatment.

[0013] The present invention also provides the use of the miRNA-nz described in the above technical solution or the miRNA-nz precursor gene described in the above technical solution in increasing the nitrate ion absorption rate of poplar roots under nitrate treatment.

[0014] The present invention also provides the use of the miRNA-nz described in the above technical solution or the miRNA-nz precursor gene described in the above technical solution in increasing the nitrate content of poplar roots under nitrate treatment.

[0015] The present invention also provides the use of the miRNA-nz described in the above technical solution or the miRNA-nz precursor gene described in the above technical solution in improving the nitrate reductase activity of poplar roots under nitrate treatment.

[0016] The present invention also provides a method for obtaining a transgenic poplar with high nitrogen absorption and utilization efficiency, comprising the following steps:

[0017] 1) Connecting the miRNA-nz precursor gene described in the above technical solution to the pCAMBIA2306 vector to obtain a connection product;

[0018] 2) transforming the ligation product obtained in step 1) into Agrobacterium tumefaciens to obtain recombinant Agrobacterium;

[0019] 3) The recombinant Agrobacterium obtained in step 2) is used to infect poplars using a leaf disc method to obtain transgenic poplars.

[0020] Preferably, in step 1) the pCAMBIA2306 vector is digested with Xba I endonuclease and then ligated;

[0021] The Agrobacterium tumefaciens in step 2) is Agrobacterium GV3101.

[0022] The present invention transforms silver gland poplar 84K (P.albaxP.glandulosa) by Agrobacterium-mediated method, and obtains transgenic plants (OE16 and OE20) overexpressing miRNA-nz. After 21 days of nitrate treatment of the obtained different transgenic strains, it is observed and measured that the transgenic poplars overexpressing the miRNA-nz precursor gene have significantly increased root length, root nitrate content and nitrate ion absorption rate compared with the wild type under nitrate treatment conditions, and the NR enzyme activity is also significantly increased. The above research results prove that miRNA-nz has a key regulatory role in improving nitrogen absorption and utilization efficiency by changing the root configuration of poplars, and it has important application value in forest molecular breeding and excellent variety selection.

[0023] The beneficial effects of the present invention are:

[0024] Compared with the prior art, the present invention uses 84k silver gland poplar as material, clones and identifies miRNA-nz, and based on the creation of miRNA-nz overexpressing plants, the phenotypic identification of related transgenic plants and physiological and biochemical indicators show that miRNA-nz can improve its nitrogen absorption and utilization efficiency by changing the root structure of poplar, indicating that miRNA-nz is a key gene for the poplar root system to respond to nitrogen, which opens a new perspective and new idea for the research on genetic improvement of forest trees for efficient absorption and utilization of soil nitrogen, and has important application value in the field of forest genetic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0026] Figure 1 It is a stable stem-loop structure formed by the miRNA-nz precursor sequence in the present invention;

[0027] Figure 2 The relative expression results of miRNA-nz in the root system of wild-type poplar under the nitrate treatment and control treatment conditions of the present invention;

[0028] Figure 3 The relative expression results of miRNA-nz in the roots of transgenic and wild-type plants after the miRNA-nz precursor gene of the present invention was transformed into poplar;

[0029] Figure 4 This is a schematic diagram of the root phenotype of miRNA-nz in transgenic and wild-type plants and a statistical table of root length after the miRNA-nz precursor gene of the present invention was transformed into poplar under nitrate treatment conditions;

[0030] Figure 5 It is the nitrate ion absorption rate of the root system of the transgenic poplar and the wild-type plant under nitrate treatment conditions after the miRNA-nz precursor gene of the present invention is transformed into the poplar.

[0031] Figure 6 After the miRNA-nz precursor gene of the present invention is transformed into poplar, the nitrate content in the root system of the transgenic poplar and the wild-type plant is determined under nitrate treatment conditions;

[0032] Figure 7 After the miRNA-nz precursor gene of the present invention was transformed into poplar, nitrate reductase (NR) in the root system of transgenic poplar and wild-type plants was measured under nitrate treatment conditions. DETAILED DESCRIPTION

[0033] The present invention provides a miRNA-nz, wherein the nucleotide sequence of the mature sequence of the miRNA-nz is shown as SEQ ID No.1, and the nucleotide sequence of the precursor sequence of the miRNA-nz is shown as SEQ ID No.2.

[0034] SEQ ID No.1:GUUAUGCGUUUUUGUCCCUCG;

[0035] SEQ ID No.2:

[0036] CUGGGGACAUAAACGCAUGAGGAUCGAAGGGGUGCAAGAGAAAAA UCUGAAGAACAGAGUAGUAAAAGAAUUUGCAGAAAACUUGCUACUUCU GCGUAUCGUUAUGCGUUUUUGUCCCUCGCAAAUCUCAUUCAUGUC.

[0037] The present invention provides a miRNA-nz precursor gene, the nucleotide sequence of the miRNA-nz precursor gene is shown in SEQ ID No.9, and is specifically as follows:

[0038] CTGGGGACATAAACGCATGAGGATCGAAGGGGTGCAAGAGAAAAATC TGAAGAACAGAGTAGTAAAAGAATTTGCAGAAAACTTGCTACTTCTGCGT ATCGTTATGCGTTTTTGTCCCTCGCAAATCTCATTCATGTC.

[0039] The present invention also provides the use of the miRNA-nz described in the above technical solution or the miRNA-nz precursor gene described in the above technical solution in regulating the poplar root architecture in response to nitrate.

[0040] The present invention also provides the use of the miRNA-nz described in the above technical solution or the miRNA-nz precursor gene described in the above technical solution in cultivating poplar varieties with high nitrogen absorption and utilization efficiency through molecular breeding.

[0041] The present invention also provides the use of the miRNA-nz described in the above technical solution or the miRNA-nz precursor gene described in the above technical solution in increasing the length of poplar roots under nitrate treatment.

[0042] The present invention also provides the use of the miRNA-nz described in the above technical solution or the miRNA-nz precursor gene described in the above technical solution in increasing the nitrate ion absorption rate of poplar roots under nitrate treatment.

[0043] The present invention also provides the use of the miRNA-nz described in the above technical solution or the miRNA-nz precursor gene described in the above technical solution in increasing the nitrate content of poplar roots under nitrate treatment.

[0044] The present invention also provides the use of the miRNA-nz described in the above technical solution or the miRNA-nz precursor gene described in the above technical solution in improving the nitrate reductase activity of poplar roots under nitrate treatment.

[0045] The present invention also provides a method for obtaining a transgenic poplar with high nitrogen absorption and utilization efficiency, comprising the following steps:

[0046] 1) Connecting the miRNA-nz precursor gene described in the above technical solution to the pCAMBIA2306 vector to obtain a connection product;

[0047] 2) transforming the ligation product obtained in step 1) into Agrobacterium tumefaciens to obtain recombinant Agrobacterium;

[0048] 3) The recombinant Agrobacterium obtained in step 2) is used to infect poplars using a leaf disc method to obtain transgenic poplars.

[0049] The present invention connects the miRNA-nz precursor gene described in the above technical solution with the pCAMBIA2306 vector to obtain a connection product. In the present invention, the pCAMBIA2306 vector is preferably digested with Xba I endonuclease before connection. The present invention does not specifically limit the conditions for digesting the pCAMBIA2306 vector with Xba I endonuclease, and those skilled in the art can follow the routine. Those skilled in the art do not specifically limit the conditions for connection, and those skilled in the art can follow the routine.

[0050] The present invention transforms the obtained ligation product into Agrobacterium tumefaciens to obtain recombinant Agrobacterium. In the present invention, the Agrobacterium tumefaciens is preferably Agrobacterium GV3101. The present invention does not specifically limit the method for transforming the ligation product into Agrobacterium tumefaciens, and those skilled in the art can use conventional methods.

[0051] The invention uses the leaf disc method to infect poplars with the obtained recombinant Agrobacterium to obtain transgenic poplars.

[0052] In order to further illustrate the present invention, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0053] Example 1

[0054] Identification of miRNAs that regulate plant root architecture in response to nitrate

[0055] This example proposes to obtain miRNA that regulates the root architecture of woody plants in response to nitrate based on small RNA sequencing technology combined with bioinformatics joint analysis, named miRNA-nz.

[0056] (1) Nitrate treatment of experimental seedlings and root sample harvesting

[0057] Rooted poplar hydroponic seedlings were used as experimental materials. They were treated with 1mM nitrate for 10 days. The root samples of poplars in the nitrate-treated group and the control group without nitrate treatment were harvested and placed in liquid nitrogen and placed in a -80℃ refrigerator for later use. Three samples were selected from each treatment group and control group as replicates. Small RNAs were extracted using commercial kits, and cDNA libraries for miRNA sequencing were constructed and sent to sequencing companies for sequencing.

[0058] (2) Analysis of differentially expressed miRNAs based on high-throughput small RNA sequencing results

[0059] The transcripts per million (TPM) technique was used to quantify the expression levels of miRNAs in the root samples of the experimental poplars in the treatment group and the control group. The TPM of miRNA under nitrate treatment was divided by the TPM of the control to calculate the fold change (FC) of miRNA. The screening threshold for differentially expressed miRNAs was: P < 0.05.

[0060] The results of small RNA high-throughput sequencing analysis showed that a new miRNA was identified in the root samples of woody plants under nitrate treatment, named miRNA-nz, and its mature sequence is shown in SEQ ID No. 1. The expression level of miRNA-nz was significantly upregulated compared with the control treatment.

[0061] At the same time, based on the original sequencing data, the precursor sequence was retrieved as shown in SEQ ID No. 2, and its structure was analyzed to find that it can be folded into a stable stem-loop structure, which is a typical secondary structure of miRNA precursor and meets the structural characteristics of miRNA precursor, such as Figure 1 shown.

[0062] Example 2

[0063] Relative expression analysis of miRNA-nz in poplar roots under nitrate treatment and control treatment

[0064] This example proposes a method for verifying the correlation between miRNA-nz and nitrate treatment, using real-time fluorescence quantitative PCR (RT-qPCR) to analyze the expression pattern of the key miRNA-nz obtained, and the steps are as follows:

[0065] (1) Verification of differential expression of miRNA-nz under nitrate treatment and control conditions

[0066] Using the poplar root samples harvested under nitrate treatment and control conditions in Example 1, small RNAs were extracted and reverse transcribed using a small RNA extraction kit and a reverse transcription kit (Polymer, Beijing, China). RT-qPCR was performed using a TB Green qRT-PCR kit (TaKaRa, Japan).

[0067] Wherein, the miRNA-nz quantitative forward primer (such as SEQ ID No. 3 in the sequence list) is shown in Table 1 below;

[0068] Table 1 Forward primers for miRNA-nz quantification

[0069] name SEQ ID No.3 miRNA-nz quantitative forward primer GTAATGCGTTATTGTCCCTCG

[0070] The miRNA-nz quantitative reverse primer is (such as sequence 4 in the sequence list, see Table 2 below);

[0071] Table 2 Reverse primers for miRNA-nz quantification

[0072] name SEQ ID No.4 miRNA-nz quantitative reverse primer AACGAGACGACGACAGACTTTTTTTTTTTTTTTNN

[0073] 5.8S rRNA was used as an internal reference gene, wherein the 5.8S rRNA quantitative forward primer (such as SEQ ID No. 5 in the sequence table) is shown in Table 3 below;

[0074] Table 3 5.8S rRNA quantitative forward primers

[0075] name SEQ ID No.5 5.8S rRNA quantitative forward primer CTCGGCTCTCGCATCGATGA

[0076] 5.8S rRNA quantitative reverse primer is (such as SEQ ID No.6 in the sequence list) as shown in Table 4 below;

[0077] Table 4 5.8S rRNA quantitative reverse primer

[0078] name SEQ ID No.6 5.8S rRNA quantitative reverse primer AGACGTGCCCTCGACCAAGA

[0079] The PCR program was: 98°C, 10 s; (94°C, 15 s, 60°C, 30 s) for 40 cycles;

[0080] The expression level of miRNA-nz was analyzed by The expression of miRNA-nz between nitrate treatment and control was analyzed by t-test. Log2(FC)≥1 or ≤-1 and P<0.05 were defined as statistically significant.

[0081] The results of RT-qPCR showed that the expression of miRNA-nz was significantly different between the nitrate treatment group and the control group, and the RT-qPCR results were consistent with the sequencing results. Figure 2 shown.

[0082] Example 3

[0083] Construction of miRNA-nz overexpression vector:

[0084] This example proposes a method for cloning a miRNA-nz precursor gene that regulates the plant root response to nitrate nitrogen, and the steps are as follows:

[0085] (1) Using 84K (P. alba x P. glandulosa) silver glandular poplar as the material, genomic DNA was extracted using a genomic DNA extraction kit (Omega, USA);

[0086] (2) Using Primer 5 software, specific primers were designed on the miRNA-nz precursor sequence (SEQ ID No. 2) to amplify the full length of the miRNA-nz precursor (pCAMBIA2306 linker was introduced into the primer);

[0087] Wherein, the miRNA-nz precursor forward primer (such as SEQ ID No. 7 in the sequence list) is shown in Table 5 below;

[0088] Table 5 miRNA-nz precursor forward primer

[0089]

[0090] The reverse primer of miRNA-nz precursor is (SEQ ID No. 8 in the sequence list) as shown in Table 6 below;

[0091] Table 6 miRNA-nz precursor reverse primer

[0092] name SEQ ID No.8 miRNA-nz precursor reverse primer GGGCGAATTGGTCGACTGGGACATGAATGAGATTTGCGA

[0093] (3) The high-fidelity PCR reaction system was as follows: TaKaRa high-fidelity amplification enzyme PrimeSTAR, forward primer, reverse primer, and 84K poplar DNA as template; reaction procedure: pre-denaturation at 98°C for 5 min; 98°C for 10 s; 55°C for 10 s; 72°C for 60 s, 30 cycles; 72°C for 5 min;

[0094] The final cloned miRNA-nz precursor full-length sequence was 138 bp, named miRNA-nz precursor gene, as shown in SEQ ID No.9:

[0095] CTGGGGACATAAACGCATGAGGATCGAAGGGGTGCAAGAGAAAAATCTGAAGAACAGAGTAGTAAAAGAATTTGCAGAAAACTTGCTACTTCTGCGTATCGTTATGCGTTTTTGTCCCTCGCAAATCTCATTCATGTC.

[0096] (4) The amplified 138 bp band was recovered by gel electrophoresis, connected to the pMD19-T vector and sent for sequencing, and the sequence after sequencing was compared with the sequence in the genome. The positive plasmid with consistent sequencing sequence was named pM-miRNA-nz. Using the pM-miRNA-nz positive plasmid as a template, the miRNA-nz precursor forward primer and reverse primer (SEQ ID No. 7 and 8) were used for PCR reaction, and the target fragment was recovered after detection by agarose gel electrophoresis.

[0097] (5) The pCAMBIA2306 vector was digested with XbaI endonuclease. The digestion reaction system was 10 μL, the reaction temperature was 37°C, and the reaction time was 1 h.

[0098] (6) Using homologous recombination method, the miRNA-nz precursor full-length DNA fragment with pCAMBIA2306 linker obtained in step (4) is connected to the linearized pCAMBIA2306 vector obtained in step (5).

[0099] (7) After the ligation product was transformed into DH5α Escherichia coli by heat shock transformation, a single colony with normal growth was selected for sequencing. The positive plasmid was transformed into GV3101 Agrobacterium to obtain pCAMBIA2306-miRNA-nz overexpressing recombinant Agrobacterium.

[0100] Example 4

[0101] Creation of transgenic poplar material overexpressing miRNA-nz

[0102] The miRNA-nz precursor gene was transferred into 84K poplar by GV3101 Agrobacterium-mediated transformation, and the steps are as follows:

[0103] (1) 84K tissue culture seedlings were cultured under the conditions of 16 / 8 h (day / night) light intensity and 23-25°C temperature. When the OD600 of Agrobacterium containing the pCAMBIA2306-miRNA-nz expression vector was 0.6-0.8, 10 μM acetosyringone (As) was added and cultured on a shaker at 28°C for 30 min.

[0104] (2) Infection was carried out using the leaf disc method, and the cells were cultured in the dark for 3-4 days after infection. The leaf discs were cleaned and transferred to culture dishes containing miRNA-nz overexpressing poplar selection medium. Resistant adventitious buds were induced and screened under the conditions of 16 / 8 h (day / night) light intensity and 23-25°C culture temperature.

[0105] (3) The explants carrying adventitious buds were transferred to the miRNA-nz overexpressing poplar rooting medium for further culture.

[0106] (4) The total DNA of leaves of miRNA-nz overexpressing poplar and wild-type plants was extracted by CTAB method. Using leaf DNA as template, PCR was performed using pCAMBIA2306 forward primer and pCAMBIA2306 reverse primer to identify transgenic plants overexpressing miRNA-nz. The positive control was the miRNA-nz overexpressing recombinant vector plasmid, and the negative control was the wild-type poplar plant.

[0107] Wherein, the pCAMBIA2306 forward primer (such as SEQ ID No. 10 in the sequence list) is shown in Table 7 below;

[0108] Table 7 pCAMBIA2306 forward primer

[0109] name SEQ ID No.10 pCAMBIA2306 forward primer GGCTTACGCAGCAGGTCTCAT

[0110] The reverse primer of pCAMBIA2306 is (SEQ ID No. 11 in the sequence list) as shown in Table 8 below;

[0111] Table 8 pCAMBIA2306 reverse primer

[0112] name SEQ ID No.11 pCAMBIA2306 reverse primer TCGGCAGAGGCATCTTCAACG

[0113] (5) Using the small RNA extraction method, small RNAs were extracted from the roots of miRNA-nz overexpressing poplars and wild-type plants. RT-qPCR was performed using the RT-qPCR method of Example 2 and miRNA-nz quantitative primers (primer sequences are shown in SEQ ID Nos. 3 and 4), with 5.8SrRNA as the internal reference gene (primer sequences are shown in SEQ ID Nos. 5 and 6). The relative expression levels of different transgenic lines of miRNA-nz overexpressing poplars were identified. The control was a wild-type plant.

[0114] The results are as follows Figure 3 As shown, after the miRNA-nz precursor gene was transformed into poplar, the relative expression level of miRNA-nz in the roots of transgenic plants was significantly higher than that of wild-type plants.

[0115] Example 5

[0116] Functional analysis of miRNA-nz gene in response to nitrate by changing poplar root architecture

[0117] The root morphological characteristics and physiological indices of the miRNA-nz transgenic lines and wild-type were analyzed by nitrate treatment. The steps are as follows:

[0118] (1) According to the experimental seedling nitrate treatment method in Example 1, the miRNA-nz transgenic plants and wild-type plants were treated with nitrate. After 21 days, the root length of the miRNA-nz transgenic plants and wild-type plants under nitrate treatment conditions and control treatment conditions was measured. The results are as follows: Figure 4 shown.

[0119] (2) At the same time, the non-invasive micro-test system (NMT150-YG, Asahi, USA) was used to measure the nitrate ion flow rate at 10 mm from the root tip of the miRNA-nz transgenic plants and wild-type plants under nitrate treatment and control conditions. The results are as follows: Figure 5 shown.

[0120] (3) Root samples of miRNA-nz transgenic plants and wild-type plants were harvested under nitrate nitrogen treatment conditions and control treatment conditions, and nitrate content was measured. The results are as follows Figure 6 The nitrate reductase (NR) activity detection kit (Ke Ming Biotechnology, Suzhou, China) was used to determine the NR enzyme activity in the root system. The results are shown in Figure 7 shown.

[0121] The experimental results are as follows Figure 1 As shown, Figure 1 It is a stable stem-loop structure formed by the miRNA-nz precursor sequence in the present invention. Figure 1 It can be seen that the miRNA-nz precursor sequence has a typical stem-loop structure unique to miRNA precursors.

[0122] Figure 2The relative expression results of miRNA-nz in the roots of wild-type poplars under nitrate treatment and control treatment conditions of the present invention. The experimental seedlings of Example 1 were treated with nitrate, and root samples were harvested as materials. Small RNA was extracted and reverse transcribed using the SYBR Premix Ex TaqTM Kit (TaKaRa) kit, 5.8S rRNA as the internal reference gene, and a LightCycler480 (Roche) real-time quantitative instrument was used to complete the process. The bar graph in the figure shows the relative expression of miRNA-nz in the roots of poplars under nitrate treatment and control conditions, the RT-qPCR results, and the sequencing results. Figure 2 It can be seen that the expression level of miRNA-nz in poplar roots was increased under nitrate treatment compared with the control.

[0123] Figure 3 The relative expression results of miRNA-nz in the root system of transgenic plants after the miRNA-nz precursor gene of the present invention was transformed into poplar. The real-time quantitative detection graph of the transcription level of the transgenic poplar overexpressing the miRNA-nz precursor gene of the present invention, using one-month-old tissue culture seedlings as materials, extracting small RNA and performing reverse transcription, using the SYBR Premix Ex TaqTM Kit (TaKaRa) kit, with 5.8S rRNA as the internal reference gene, and using the LightCycler 480 (Roche) real-time quantitative instrument) to complete the task. The bar graph in the figure shows the expression levels of the miRNA-nz precursor gene in wild-type poplar (WT) and transgenic poplar overexpressing the miRNA-nz precursor gene (OE16 and OE20). From Figure 3 It can be seen that the expression level of miRNA-nz in transgenic poplars (OE16 and OE20) was significantly higher than that in wild-type poplars (WT).

[0124] Figure 4 The schematic diagram and root length statistics of the miRNA-nz precursor gene in the transgenic poplar plant after the miRNA-nz precursor gene of the present invention was transformed into the poplar under nitrate treatment. The transgenic poplar overexpressing the miRNA-nz precursor gene of the present invention was hydroponically cultivated according to the method of Example 1, and the root phenotype was observed and photographed using an ordinary camera. Figure 4 It can be seen that under the control treatment, the root system of transgenic poplars (OE16 and OE20) was slightly longer than that of wild-type poplars (WT), but not significantly longer. After 21 days of nitrate treatment, the root length of transgenic poplars (OE16 and OE20) was significantly increased compared with that of wild-type poplars (WT).

[0125] Figure 5The results are as follows: The root nitrate ion absorption rate of the transgenic poplar and the wild-type plant after the miRNA-nz precursor gene of the present invention was transformed into poplar under nitrate treatment conditions. The transgenic poplar overexpressing the miRNA-nz precursor gene of the present invention was hydroponically cultivated according to the method of Example 1, and the net nitrate absorption rate at a distance of 10 mm from the root tip was measured using non-destructive micro-measurement technology. Figure 5 It can be seen that under the control treatment, the net nitrate uptake rate of the roots of transgenic poplars (OE16 and OE20) increased compared with wild-type poplars (WT), but not significantly. After 21 days of nitrate treatment, the net nitrate uptake rate of transgenic poplars (OE16 and OE20) increased significantly compared with wild-type poplars (WT).

[0126] Figure 6 After the miRNA-nz precursor gene of the present invention was transformed into poplar, the nitrate content in the root system of the transgenic poplar and the wild-type plant was measured under nitrate treatment conditions. The transgenic poplar overexpressing the miRNA-nz precursor gene of the present invention and the wild-type plant were hydroponically cultivated according to the method of Example 1, and the nitrate content in the root system was measured. Figure 6 It can be seen that under the control treatment, the nitrate content of transgenic poplars (OE16 and OE20) was slightly increased compared with wild-type poplars (WT). After 21 days of nitrate treatment, the nitrate content of transgenic poplars (OE16 and OE20) increased more significantly compared with wild-type poplars (WT).

[0127] Figure 7 After the miRNA-nz precursor gene of the present invention was transfected into poplars, the nitrate reductase (NR) in the roots of the transgenic poplars and wild-type plants was measured under nitrate treatment conditions. The transgenic poplars overexpressing the miRNA-nz precursor gene of the present invention were hydroponically cultivated according to the method of Example 1, and the NR enzyme activity in the roots was measured. Figure 7 It can be seen that under the control treatment, the NR enzyme activity of transgenic poplars (OE16 and OE20) increased compared with the wild-type poplar (WT). After 21 days of nitrate treatment, the NR enzyme activity of transgenic poplars (OE16 and OE20) increased more significantly compared with the wild-type poplar (WT).

[0128] The present invention transfers the miRNA-nz precursor gene into 84k poplars, and the transgenic poplars overexpressing the miRNA-nz precursor gene have significantly increased root length, nitrate content and nitrate ion absorption rate compared with the wild type under nitrate treatment conditions, and the NR enzyme activity is also significantly increased. This shows that the miRNA-nz gene is a key regulatory gene that regulates plant root architecture to respond to nitrate, and has important application value in the field of breeding or screening new poplar varieties with high nitrogen absorption and utilization efficiency.

[0129] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A miRNA-nz, characterized in that The nucleotide sequence of the mature sequence of the miRNA-nz is shown as SEQ ID No.1, and the nucleotide sequence of the precursor sequence of the miRNA-nz is shown as SEQ ID No.

2.

2. A miRNA-nz precursor gene, characterized in that: The nucleotide sequence of the miRNA-nz precursor gene sequence is shown in SEQ ID No.

9.

3. Use of the miRNA-nz described in claim 1 or the miRNA-nz precursor gene described in claim 2 in positively regulating the root architecture of 84K poplar in response to nitrate.

4. Use of the miRNA-nz described in claim 1 or the miRNA-nz precursor gene described in claim 2 in breeding a poplar variety 84K with high nitrogen absorption and utilization efficiency through molecular breeding.

5. Use of the miRNA-nz described in claim 1 or the miRNA-nz precursor gene described in claim 2 in increasing the root length of 84K poplar under nitrate treatment.

6. Use of the miRNA-nz described in claim 1 or the miRNA-nz precursor gene described in claim 2 to increase the nitrate ion absorption rate of 84K poplar roots under nitrate treatment.

7. Use of the miRNA-nz described in claim 1 or the miRNA-nz precursor gene described in claim 2 to increase the nitrate content in the root system of 84K poplar under nitrate treatment.

8. Use of the miRNA-nz described in claim 1 or the miRNA-nz precursor gene described in claim 2 in increasing the nitrate reductase activity of 84K poplar roots under nitrate treatment.

9. A method for obtaining transgenic 84K poplars with high nitrogen absorption and utilization efficiency, characterized in that: The following steps are involved: 1) connecting the miRNA-nz precursor gene according to claim 2 with the pCAMBIA2306 vector to obtain a connection product; 2) transforming the ligation product obtained in step 1) into Agrobacterium tumefaciens to obtain recombinant Agrobacterium; 3) The recombinant Agrobacterium obtained in step 2) is used to infect 84K poplars using the leaf disc method to obtain transgenic 84K poplars.

10. The acquisition method according to claim 9, characterized in that: In the step 1), the pCAMBIA2306 vector is digested with XbaI endonuclease and then connected; The Agrobacterium tumefaciens in step 2) is Agrobacterium GV3101.

Images