Phenylalanine ammonia-lyase gene RkPAL and application thereof
By overexpressing the phenylalanine ammonia-lyase gene RkPAL in *Rhodotorula rubra*, the problem of insufficient yield in the production of carotenoids and oils was solved, achieving efficient microbial synthesis and promoting the industrial application of carotenoids and oils.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- KUNMING UNIV OF SCI & TECH
- Filing Date
- 2024-07-19
- Publication Date
- 2026-07-24
AI Technical Summary
In existing technologies, the production methods of carotenoids and oils are characterized by high costs, questionable safety and physiological activity, and insufficient yields, especially since the sources of ω-3 fatty acids are limited and production costs are high.
By isolating the phenylalanine ammonia-lyase gene RkPAL from Rhodotorula rubrum, constructing a recombinant plasmid, and overexpressing it in Rhodotorula rubrum, the synthesis of carotenoids and lipids was increased.
It significantly increased the yield of carotenoids and oils in Rhodotorula rubrum, providing a basis for the industrial production of carotenoids and oils, and improving the efficiency and economic benefits of microbial synthesis.
Smart Images
Figure CN118620929B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a phenylalanine ammonia-lyase gene. RkPAL And its application in promoting the production of carotenoids and oils by Rhodotorula rubra. Background Technology
[0002] Carotenoids are a class of abundant natural pigments. They are based on isoprene and have a molecular structure containing 40 carbon atoms. They are generally yellow, red, or orange-red. Currently, more than 800 kinds of natural carotenoids have been discovered in organisms such as higher plants, animals, and fungi. Common fruits and vegetables are rich in carotenoids, such as citrus fruits, mangoes, and pumpkins.
[0003] Carotenoids have diverse physiological functions, including cancer prevention, anti-oxidation, and promoting cell communication. They enhance the body's resistance and slow down the aging process by quenching singlet oxygen and scavenging free radicals. Since the human body cannot synthesize them, they must be obtained through diet. Carotenoids are valued in the pharmaceutical, health, and food industries for their health benefits. Furthermore, as feed additives, they can improve animal appearance and enhance production performance, positively impacting animal husbandry.
[0004] There are various methods for producing carotenoids, including plant extraction, chemical synthesis, and microbial synthesis. Plant extraction is costly and limited by geographical climate, while chemical synthesis is low-cost but its safety and physiological activity are questionable. In contrast, microbial synthesis has the advantages of low cost, high efficiency, and high bioactivity, and is not affected by environmental factors, making it the most promising production method currently available.
[0005] Fats and oils, as essential biomolecules in living organisms, play an irreplaceable role in maintaining life activities. Among the many types of fats and oils, functional fats such as linoleic acid (LA), alpha-linolenic acid (ALA), gamma-linolenic acid (GLA), arachidonic acid (ARA), eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA) are highly valued for their unique physiological functions. These fats and oils, especially the omega-3 series ALA, DHA, and EPA, are considered key factors for human health, showing significant benefits in promoting growth and development, preventing chronic diseases such as diabetes, cardiovascular and cerebrovascular diseases, and cancer, as well as in anti-inflammation, lowering blood lipids, and enhancing immunity. However, the human body cannot synthesize these essential fatty acids and must obtain them through diet. ALA is mainly found in certain plant oils, while the main sources of DHA and EPA are fish oil and specific microbial oils. Although fish oil is rich in these beneficial fatty acids, its production cost is high, and it is limited by pollution risks and quality stability, making it difficult to meet the growing global demand. Oil-producing microorganisms have attracted attention due to their high oil content, fatty acid composition similar to that of plant oils, and advantages such as short growth cycle and ease of large-scale production.
[0006] Phenylalanine ammonia-lyase (PAL) is an enzyme widely found in plants and certain microorganisms. It plays a crucial role in amino acid metabolism and secondary metabolic pathways. PAL catalyzes the conversion of phenylalanine to cinnamic acid, releasing NH3, a key step in the amino acid metabolic pathway. Microbial PAL has potential for industrial applications, particularly in amino acid production and biotransformation. PAL from red yeast has been used for the industrial-scale production of L-phenylalanine, an important amino acid widely used in the food, pharmaceutical, and biotechnology fields.
[0007] Currently, there is no literature indicating the relationship between the phenylalanine ammonia-lyase gene PAL and the synthesis of carotenoids and lipids. Summary of the Invention
[0008] This invention provides a phenylalanine ammonia-lyase gene. RkPAL This gene was derived from *Rhodotorula rubrum* (…). Rhodosporidium kratochvilovae The gene was isolated from YM25235. The nucleotide sequence of the gene is shown in SEQ ID NO:1. The gene sequence is 2142 bp long. The amino acid sequence encoded by the gene is shown in SEQ ID NO:2. The gene was ligated to a vector and transformed into Rhodotorula rubrum cells. The increase in the expression level of the gene promoted the synthesis of carotenoids and lipids in Rhodotorula rubrum cells.
[0009] The objective of this invention is achieved through the following technical solution: 1. Total RNA was extracted from *Rhodotorula rubrum* YM25235, and then cDNA was synthesized by reverse transcription. Using the synthesized cDNA as a template, amplification was performed... RkPAL Gene-specific primers were used to amplify the target sequence via polymerase chain reaction. The vector pRH2034 was double-digested and recovered. The target fragment and vector were ligated using a one-step cloning method to obtain the ligation product, recombinant plasmid pRHRkPAL. The recombinant plasmid pRHRkPAL was transformed into *E. coli*, and positive single clones were selected by PCR. The recombinant plasmid pRHRkPAL was then used... BamH I. EcoR V. Enzyme digestion with two restriction endonucleases was performed for verification. After culturing positive clones, plasmids were extracted and sequenced to obtain the phenylalanine ammonia-lyase gene fragment with a size of 2142 bp. RkPAL ; 2. The recombinant vector pRHRkPAL was transformed into Rhodotorula rubrum YM25235 using the PEG-mediated protoplast method. Transformants were screened to obtain overexpression strains containing pRHRkPAL. Carotenoids and oils were extracted from the overexpression strains containing pRHRkPAL after culturing.
[0010] This invention helps elucidate the mechanism of carotenoid and lipid production in *Rhodotorula rubrum* YM25235, providing a reference for revealing the mechanisms by which microorganisms enhance carotenoid and lipid production. It will facilitate the modification of the product using genetic engineering to increase carotenoid and lipid content, offering promising application prospects and economic benefits for the industrial production of carotenoids and lipids, and laying the foundation for large-scale commercial lipid production. The method of this invention is simple, easy to operate, and suitable for industrial production and market application. Attached Figure Description
[0011] Figure 1 The red syringomyelia YM25235 of the present invention RkPAL Gene PCR amplification diagram; 1. DNA molecular weight marker DL5000; 2. Negative control; 3. Gene RkPAL cDNA fragments; Figure 2 Electrophoresis image for colony PCR verification; 1. DNA molecular weight marker DL5000; 2. Negative control; 3. Gene. RkPAL The cDNA fragments; the rest are transformants; Figure 3 Restriction enzyme digestion analysis of recombinant plasmid pRHRkPAL was performed; including: 1. DNA molecular weight marker DL10000; 2. negative control; 3. plasmid pRH2034. BamHI and EcoRV Double enzyme digestion; 4. Recombinant plasmid pRHRkPAL BamHI , EcoRVDouble enzyme digestion; 5. Gene RkPAL 6. cDNA fragment; DNA molecular weight marker DL5000; Figure 4 The plasmid map of the recombinant plasmid pRHRKPAL; Figure 5 Verification of positive clones of *Rhodotorula rubrum* YM25235 transformed with recombinant plasmid pRHRkPAL; 1. DNA molecular scalar DL5000; 2. Negative control; 3. PCR product amplified with the YM25235 genome; 4. PCR product amplified with plasmid pRHRkPAL; 5. PCR product amplified with the YM25235 / pRHRkPAL strain genome; Figure 6 Comparison of carotenoid content between overexpression strain YM25235 / pRHRkPAL and strain YM25235; Figure 7 Comparison of lipid content between overexpression strain YM25235 / pRHRkPAL and strain YM25235. Detailed Implementation
[0012] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. However, the scope of protection of the present invention is not limited to the contents described. Unless otherwise specified, the reagents and methods used in the embodiments are all conventional reagents and conventional methods.
[0013] Example 1: Isolation of phenylalanine ammonia-lyase gene from Rhodotorula rubrum YM25235 RkPAL Construction and transformation of the overexpression vector pRHRkPAL 1. Total RNA was extracted from *Rhodotorula rubrum* YM25235 using the UNlQ-10 Trizol Total RNA Extraction Kit (product number: SK1321) from Sangon Biotech (Shanghai) Co., Ltd. Then, cDNA was synthesized via reverse transcription according to the instructions of the Vazyme HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper). 1 μL of cDNA was used as a template for polymerase chain reaction (PCR), and the RNA was extracted based on the results obtained from transcriptome sequencing. RkPAL Sequence, design specific primers RkPAL -F and RkPAL -R, using the cDNA template obtained above, and primers RkPAL -F and RkPAL -R, PCR amplification was performed on a PCR instrument (Beijing Liuyi Biotechnology Co., Ltd.). The primers, amplification system, and amplification conditions used in the reaction are as follows: RkPAL-F: 5'- ATCACTCACCATGGCGGATCC GATGTCGCCCTCGCTCGA-3' (double underscores represent the upstream vector terminal homologous sequence, single underscores represent...) BamH I) Enzyme cleavage site Rk PAL-R: 5'- CCGGTCGGCATCTACGATATC TAGGCGAGCATCTGGACG-3' (double underscores represent the downstream vector terminal homologous sequence, single underscores represent...) EcoR V restriction site); The PCR amplification system is as follows (50 μL):
[0014] Amplification conditions: 95℃ pre-denaturation for 3 min, followed by 95℃ denaturation for 15 s, 68℃ annealing for 15 s, and 72℃ extension for 2 min 10 s, for a total of 30 cycles, with a final extension at 72℃ for 5 min; after the reaction, 2 μL of the product was taken and analyzed by electrophoresis on a 1% agarose gel. The results are as follows. Figure 1 As shown; the amplified fragment was approximately 2142 bp in size, named RkPAL pRH2034 was processed BamH Ⅰ EcoR V. Double digestion with two restriction endonucleases; the two fragments were then recovered using a multifunctional DNA recovery kit (Beijing Biotech Biotechnology Co., Ltd., product number: DP1502). The recovered fragments were then ligated using a seamless cloning kit (LightNing™ DNA Assembly Mix Plus, Jiangsu Baishimei Biotechnology Co., Ltd.) to obtain the recombinant plasmid pRHRkPAL. The ligation system was as follows (10µL): LightNing™ DNA Assembly Mix Plus 5µL, linearized vector pRH2034 3µL, RkPAL 2 μL of fragment; gently mix by pipetting, briefly centrifuge to collect the reaction solution to the bottom of the tube, and then react in a PCR instrument (Beijing Liuyi Biotechnology Co., Ltd.) at 37℃ for 30 min; cool to 4℃ or immediately place on ice to cool.
[0015] 2. Add 10 µL of the ligation product to 100 µL of DH5α competent cells, gently tap the tube wall to mix, incubate on ice for 30 min, heat shock at 42℃ for 90 s, and immediately cool on ice for 90 s. Add 900 µL of LB liquid medium to the ligation system, incubate at 37℃ and 100 rpm with shaking for 1 h, centrifuge at 5000 rpm for 10 min, discard 900 µL of supernatant, and gently pipette the remaining approximately 100 µL of LB medium to suspend the cells and spread them on LB agar plates (containing 100 µg / mL spectinomycin). Incubate at 37℃ upside down for 12-16 h. Randomly pick 5 white colonies growing on the plate and verify positive clones by colony PCR. The results are shown in the figure. Figure 2 As shown in the figure, all selected monoclonal strains amplified specific bands of the same size as the target fragment by colony PCR, indicating that the recombinant plasmid was successfully transformed into all selected DH5α strains. The positive clones were inoculated into LB liquid medium (containing 100 µg / mL spectinomycin) and cultured overnight. The bacterial cells were collected and plasmids were extracted (OMEGA Plasmid Mini Kit I, OMEGA, USA). BamH Ⅰ EcoR V. Double digestion of pRHRkPAL was performed for verification; the results are shown below. Figure 3 The results showed that the recombinant plasmid pRHRKPAL produced two bands of approximately 2kb and 10kb after double enzyme digestion. These two bands were respectively associated with... RkPAL The fragments were the same size as those from the pRH2034 vector after double enzyme digestion, preliminarily indicating that the recombinant plasmid pRHRkPAL was successfully constructed. The plasmid map of the recombinant vector pRHRkPAL can be found in [link to image]. Figure 4 Sequencing was performed using sequencing primers, and the plasmid that had been verified to be correct by enzyme digestion was sent for further sequencing verification. The sequencing results showed that the sequence obtained was completely consistent with the target sequence, without any base mutations or deletions.
[0016] 3. Select single clones of DH5α strain that have been successfully transformed into the correct recombinant vector pRHRkPAL and inoculate them into LB liquid medium (containing 100µg / mL spectinomycin) for overnight culture. Extract plasmids (OMEGA Plasmid Mini Kit I, OMEGA, USA), measure their concentration, and store them at -20℃ for later use.
[0017] The recombinant vector pRHRkPAL was transformed into *Rhodotorula rubrum* YM25235 using PEG-mediated protoplast transformation. The specific method is as follows: A single colony of *Rhodotorula rubrum* YM25235 was picked and inoculated into 5 mL of YPD liquid medium, and cultured overnight at 28°C with shaking at 160 rpm to obtain the seed culture. The seed culture was then transferred at a 1% inoculation rate to 50 mL of YPD liquid medium and cultured at 28°C with shaking at 160 rpm until the bacterial growth rate reached OD500. 600The bacterial culture was centrifuged at 4500 rcf for 5 min at 4℃ to collect the bacterial cells, with a pH between 0.45 and 0.5. The collected bacterial cells were washed twice with a pre-prepared citrate buffer (30 mmol / L citric acid, 83 mmol / L sodium citrate, 600 mmol / L mannitol, and NaOH adjusted to pH 5.4), and then resuspended in 800-1000 μL of citrate buffer and placed on ice for later use. An enzymatic hydrolysate (0.075 g snail enzyme, 0.03 g Sigma-Aldrich) was prepared. The lysozyme was diluted to 4 mL with citrate buffer and filtered through a 0.22 μm sterile filter membrane. The solution was then placed in a 5 mL sterile centrifuge tube for later use. 4 mL of the enzyme solution was mixed with 800-1000 μL of bacterial cells suspended in citrate buffer and incubated at 28°C with shaking at 90 rpm for 2.5-3 h for enzymatic digestion. A small amount of bacterial culture was taken and observed under a microscope to observe the digestion efficiency. Once it was confirmed that the digestion volume was sufficient, the culture was centrifuged at 4°C and 1300 rcf for 10 min to collect the bacterial cells. 10 mL of lysozyme was added... Wash the collected bacterial cells twice on ice with STC buffer (1.2 mol / L sorbitol, 10 mmol / L Tris-HCl, 100 mmol / L CaCl2) to prepare competent yeast cells. Resuspend the bacterial cells in 800-1000 μL of STC buffer and aliquot 100 μL into 5 mL sterile centrifuge tubes. Add 10 μL of pRHRkPAL recombinant plasmid to 100 μL of competent cells and mix gently. Incubate on ice for 10 min. Add 200 μL of pre-chilled PTC buffer (50% PEG, 10 mmol / L Tris-HCl, 100 mmol / L CaCl2) to the solution. (CaCl2), incubate on ice for 10 min, add 200 μL of pre-chilled PTC buffer, incubate on ice for 10 min, and finally add 800 μL of pre-chilled PTC buffer and gently mix. Incubate at 42℃ for 30 min. After the water bath, centrifuge at 4℃ and 1500 rcf for 10 min to collect the bacterial cells. Discard 1 mL of supernatant and add 1 mL of 0.4 mol / L sucrose YPD liquid medium to resuspend the cells. Incubate at 28℃ and 90 rpm for 24 h to revive the cells. Centrifuge the revived cells at 1300 rpm for 10 min to collect the cells. Discard the supernatant and resuspend the cells in the remaining 100 μL of medium. Finally, spread the cells onto 0.4 mol / L sucrose YPD solid medium (containing 40 μg / mL hygromycin B) and incubate upside down at 28℃ for 3-4 days until growth occurs on the solid medium. Number the transformants and transfer them to YPD solid medium containing 150 μg / mL hygromycin B. Incubate upside down at 28℃ for two days. Pick the selected transformants and then proceed according to DNA... Genomic DNA was extracted from yeast transformants following the instructions of the extraction kit (purchased from Shanghai Sangon Biotech Co., Ltd.), followed by PCR verification. The results are as follows: Figure 5 As shown in the figure, PCR can amplify genes that are similar to those of the transformant, using the transformant's genome as a template. RkPAL The presence of bands of the same cDNA fragment size confirms the correct gene verification in the recombinant transformant, indicating... RkPAL The fragment has been successfully introduced into the genome of a yeast transformant, resulting in an overexpressing strain YM25235 / pRHRkPAL.
[0018] Example 2: Analysis of carotenoid synthesis in overexpression strain YM25235 / pRHRkPAL Positive transformants were inoculated into 50 mL of YPD liquid medium and fermented at 28 °C and 160 rpm for 168 h. The cells were then collected by centrifugation at 4500 rpm for 6 min into 50 mL centrifuge tubes. The tubes were washed twice with pre-cooled ddH2O, and finally centrifuged at 4500 rpm for 8 min to completely remove the supernatant. The tube walls were gently tapped to ensure even adhesion of the cells to the inner wall. The tubes were then dried in an oven at 55 °C. The cells were then ground into powder. 0.4 g of the powder was used to prepare an acetone-methanol mixture (V... 丙酮 V 甲醇 =4:1) Total carotenoids were extracted. Following the method described in Yang Wanzheng et al.'s "Improved Method for Determining Total Carotenoids in Seabuckthorn Oil by Ultraviolet Spectrophotometry [J]. Journal of Central University for Nationalities (Natural Science Edition), 2009, 18(03):5-8," an ultraviolet-visible spectrophotometer was used. Wild-type Rhodotorula rubrum strain YM25235 was used as a control. The absorbance was measured at 450 nm, and the total carotenoid content (mg / g dry cells) was calculated. The content is as follows: Figure 6 As shown in the figure, the total carotenoid synthesis of the overexpressing strain YM25235 / pRHRkPAL was significantly higher than that of the wild-type Rhodotorula rubrum strain YM25235. The carotenoid synthesis of the wild-type Rhodotorula rubrum strain YM25235 was 6.49±0.16 mg / g, while that of the overexpressing strain YM25235 / pRHRkPAL was 9.60±0.03 mg / g. This means that the lipid synthesis of the overexpressing strain YM25235 / pRHRkPAL was 47.92% higher than that of the control strain. The results also indicated that the phenylalanine ammonia-lyase gene... RkPAL Overexpression of [a substance] can increase the total carotenoid content in *Rhodotorula rubrum* strain YM25235. RkPAL Genes can promote the synthesis of total carotenoids.
[0019] Example 3: Analysis of lipid synthesis in overexpression strain YM25235 / pRHRkPAL Positive transformants were inoculated into 50 mL of YPD liquid medium and fermented at 28 °C and 160 rpm for 168 h. The cells were then collected by centrifugation at 4500 rpm for 6 min into 50 mL centrifuge tubes. The tubes were washed twice with pre-cooled ddH2O, and finally centrifuged at 4500 rpm for 8 min to completely remove the supernatant. The tube walls were gently tapped to ensure even adhesion of the cells to the inner wall. The tubes were then dried in an oven at 55 °C. The cells were then ground into powder. 0.3 g of the powder was used to disrupt the cell wall in a hot water bath with 4 mol / L hydrochloric acid. (V) 氯仿 V 甲醇 =2:1) Total oil was extracted, following the method described by Kong Fanmin et al., “Study on the Conditions for Extraction of Yeast Oil by Acid-Heat Method [J]. China Brewing, 2010, (05):143-146.”, with wild-type Rhodotorula rubrum strain YM25235 as a control, and the oil content (% dry cell count) was determined. The content is as follows: Figure 7 As shown in the figure, the lipid synthesis of the overexpressing strain YM25235 / pRHRkPAL was significantly higher than that of the wild-type Rhodotorula rubrum strain YM25235. The lipid synthesis of the wild-type Rhodotorula rubrum strain YM25235 was 3.83±0.00%, while that of the overexpressing strain YM25235 / pRHRkPAL was 6.05±0.92%, meaning that the lipid synthesis of the overexpressing strain YM25235 / pRHRkPAL was 57.96% higher than that of the control strain. The results indicate that the phenylalanine ammonia-lyase gene... RkPAL Overexpression of [a substance] can increase the lipid content in *Rhodotorula rubrum* strain YM25235. RkPAL Genes can promote the synthesis of lipids; In summary, the phenylalanine ammonia-lyase gene RkPAL is involved in the synthesis of carotenoids and lipids in Rhodotorula rubrum.
Claims
1. A phenylalanine ammonia-lyase gene RkPAL In promoting the growth of Rhodotorula rubrum ( Rhodosporidium short-lived Applications in the production of carotenoids and oils; The phenylalanine ammonia-lyase gene RkPAL The nucleotide sequence is shown in SEQ ID NO:1.