Triple Fluorescent PCR Detection Method for Differentially Diagnosing Three Genes of Different African Swine Fever Viral Strains

By designing specific primer probes and constructing triple fluorescent PCR system, the problem of simultaneous detection of three genes of African swine fever virus is solved, and high-sensitivity virus detection and early diagnosis is achieved, which is suitable for a variety of sample types.

CN118755879BActive Publication Date: 2025-08-05CHINA INST OF VETERINARY DRUG CONTROL

Patent Information

Application Number
CN202410737602.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-07
Publication Date
2025-08-05
Estimated Expiration
2044-06-07

AI Technical Summary

Technical Problem

The prior art cannot detect the three genes of African swine fever virus B646L, CD2v and I177L, especially the CD2v gene deletion strain, which leads to the increased difficulty in preventing and controlling African swine fever.

Method used

Design specific primer probes to target B646L, CD2v and I177L genes, build a triple fluorescent PCR system, optimize the ratio and reaction procedures of primer probes, and achieve simultaneous detection of these three genes.

Benefits of technology

It has achieved high sensitivity detection of African swine fever virus, can identify CD2v and I177L gene deletion strains, and has no cross-reactivity with other pig diseases. It is suitable for detection of multiple sample types and provides early diagnosis and monitoring methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118755879B_ABST
    Figure CN118755879B_ABST
Patent Text Reader

Abstract

The present application relates to the field of veterinary diagnostic technology, and specifically to a probe composition, a primer composition, and a triple fluorescence PCR kit and related methods for differential diagnosis of three genes of different strains of African swine fever composed of the above-mentioned probe composition and primer composition. The kit includes primer probes specific to the B646L gene, the CD2v gene, and the I177L gene. The present application designs fluorescent PCR primers and probes for the B646L gene, the CD2v gene, and the I177L gene, respectively, and establishes a triple fluorescence PCR detection method, which can quickly identify African swine fever virus strains and gene-deficient strains. At the same time, it has no cross-reaction with swine fever virus, porcine reproductive and respiratory syndrome virus, pseudorabies virus, porcine epidemic diarrhea virus, porcine circovirus, porcine parvovirus, healthy whole blood, oropharyngeal swabs, nasal swabs, anal swabs, environmental swabs, pig tissues, etc., and has good specificity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application relates to the field of veterinary diagnostic technology, and in particular to a detection method for three genes of different strains of African swine fever using triple fluorescence PCR for differential diagnosis. Background Art

[0002] African swine fever (ASF) is a highly contagious and lethal viral disease of pigs, causing significant economic and social impacts on the swine industry. Currently, the epidemic trends of ASF are complex both domestically and internationally. my country still lacks a commercially available vaccine for the prevention and control of ASF, placing significant pressure on its prevention and control efforts. Biosafety control and continuous pathogen surveillance are effective means of preventing and controlling ASF.

[0003] At present, the detection of African swine fever mainly targets the B646L gene encoding the p72 protein, which is a method of conducting a comprehensive test on all strains. However, in addition to the strong strains, the clinically prevalent strains also include weak strains that lack the CD2v gene, but the current detection method cannot detect the three genes at the same time. Summary of the Invention

[0004] Therefore, a test kit that can detect these three genes simultaneously is particularly important. This application is based on the characteristics of African swine fever virus currently in clinical practice, and selects a conserved region of the B646L gene that can be used to detect different genotypes to design specific primer probes for all subtypes of African swine fever virus strains that appear clinically. In view of the gene deletion strains currently existing in clinical practice, which are mainly deleted in CD2v, a specific primer probe is designed for CD2v to detect the CD2v gene. In view of the I177L gene deletion vaccine used in Vietnam, a specific primer probe for I177L is designed to detect the presence of this gene. For each target gene, 2 pairs of primer probes are designed, and it is ensured that the amplified fragments and annealing temperatures of each set of primer probes are similar, so as to be used for the subsequent construction of a triple fluorescence PCR system. The three genes are optimized and compared respectively. After screening, the set of primer probes with the highest amplification efficiency is selected and used as the supporting gene for triple fluorescence PCR. Then, a triple fluorescence PCR system was constructed, and the ratio and concentration of the primers and probes of the three target genes in the system and the reaction procedure were optimized. The system with the highest sensitivity for detecting all three genes was selected as the final system and reaction conditions for triple fluorescence PCR, and the detection method was established.

[0005] The technical solution of this application is as follows:

[0006] The present application provides a probe composition, which is a probe composition for identifying African swine fever virus, wherein the target probe comprises:

[0007] The probe ASF-IVDC-prob2 targeting the African swine fever virus B646L gene has a sequence as shown in SEQ.ID.NO.1: TAAAGCTTGCATCGCA.

[0008] The probe CD2v-800-Prob2 targeting the African swine fever virus CD2v gene has a sequence as shown in SEQ.ID.NO.2: GCTTAGGAAGTAATGGTTCTCTGG.

[0009] The probe ASFV-I177L-Prb2 targeting the African swine fever virus I177L gene has a sequence as shown in SEQ.ID.NO.3: AGGATTTTATACGGATCCCC.

[0010] The present application provides a primer composition, which is a primer composition for identifying African swine fever virus, wherein the primers include:

[0011] The primers designed for the conserved region of the African swine fever virus B646L gene are ASF-IVDC-F2: SEQ.ID.NO.4: ATTGCGTCTACTGGGGCG and ASF-IVDC-R2: SEQ.ID.NO.5: GAGCGCTTTATCACCATAAAGC;

[0012] The primers designed for the conserved region of the African swine fever virus CD2v gene are CD2v-793-qF2: SEQ.ID.NO.6: CCATCTCCCAGAGAACC and CD2v-894-qR2: SEQ.ID.NO.7: AAATGGGTTGAGTGGTTG;

[0013] The primers designed for the conserved region of the African swine fever virus I177L gene are ASFV-I177L-F2SEQ.ID.NO.8: ATAGCCATTACCGGCAAG and ASFV-I177L-R2: SEQ.ID.NO.9: GGCATRATTATCAAATGCGAA.

[0014] The present application provides a kit comprising:

[0015] A probe composition for identifying African swine fever virus as described in item 1; and

[0016] A primer composition for identifying African swine fever virus as described in item 2.

[0017] The kit according to item 3, further comprising:

[0018] Positive control, negative control, nuclease-free water, fluorescent PCR premix.

[0019] The kit as described in item 3, wherein the kit is used to simultaneously detect the three genes of African swine fever virus, namely, B646L gene, CD2v gene, and I177L gene, using a triple fluorescence PCR method.

[0020] The present application provides a method for simultaneously detecting the B646L gene, CD2v gene, and I177L gene of African swine fever virus using a triple fluorescence PCR method for non-diagnostic purposes, the steps of which include:

[0021] Taking a sample that may contain viral nucleic acid (DNA), preferably whole blood, tissue sample, cell culture or swab;

[0022] DNA extraction was performed on the sample;

[0023] The extracted DNA was amplified by real-time fluorescent PCR using a primer combination and a probe;

[0024] The results of real-time fluorescence PCR amplification are used to determine whether African swine fever virus exists and the genes of the African swine fever virus that exist.

[0025] The method as described in item 5, wherein the primer composition is selected from the primer composition as described in item 2.

[0026] The method as described in item 5, wherein the probe composition is selected from the probe composition as described in item 1.

[0027] The beneficial effects of this application are:

[0028] The triple fluorescence PCR detection method established in this application can be used to detect African swine fever virus currently appearing in the clinic, and can identify CD2v and I177L gene deletion strains. The method has a minimum detection limit of 8 copies / μl, 10 copies / μl and 10 copies / μl for p72, CD2v and I177L genes, respectively. It has no cross-reaction with other important swine diseases, such as classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), pseudorabies virus (PRV), porcine epidemic diarrhea virus (PEDV), porcine circovirus (PCV), porcine parvovirus (PPV), etc. It has good sensitivity and specificity and can be used to detect African swine fever virus nucleic acid in pig whole blood, oropharyngeal swabs, nasal swabs, anal swabs, environmental swabs, pig tissues, pig-derived biological products and raw and auxiliary materials. It provides an effective technical means for early diagnosis and detection of African swine fever virus, especially gene deletion strains, in clinical practice, to control the disease in its early stages, and to discover and warn the emergence of gene deletion strains in routine monitoring. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The accompanying drawings are provided to facilitate a better understanding of the present application and do not constitute an undue limitation on the present application.

[0030] Figure 1 Amplification curves of two sets of primers and probes optimized for B646L (p72);

[0031] Figure 2 Standard curves for two sets of primers and probes for the B646L (p72) gene;

[0032] Figure 3 Amplification curves optimized for two sets of primers and probes for CD2v;

[0033] Figure 4 Standard curves for two sets of primers and probes for the CD2v gene;

[0034] Figure 5 Amplification curves of two sets of primers and probes optimized for I177L F2R2;

[0035] Figure 6 Standard curves for two sets of primers and probes for the IL77L gene;

[0036] Figure 7 It is the standard curve for detecting each target gene in triple fluorescence PCR;

[0037] Figure 8 Amplification curves of target genes in triple fluorescence PCR. DETAILED DESCRIPTION

[0038] Specific embodiments of the present application will be described in more detail below with reference to the accompanying drawings. Although specific embodiments of the present application are shown in the accompanying drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described herein. Rather, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0039] It should be noted that certain words are used in the specification and claims to refer to specific components. Those skilled in the art should understand that technicians may use different nouns to refer to the same component. This specification and claims do not use the difference in nouns as a way to distinguish components, but use the difference in the functions of the components as the criterion for distinction. As mentioned throughout the specification and claims, "including" or "comprising" is an open term, so it should be interpreted as "including but not limited to". The subsequent description of the specification is a preferred embodiment of the present application, but the description is based on the general principles of the specification and is not intended to limit the scope of the present application. The scope of protection of this application shall be as defined by the attached claims.

[0040] African swine fever (ASF) is an acute, hemorrhagic, and highly contagious disease caused by the African swine fever virus (ASFV) of the Assyrindae family. It is classified as a Category I animal disease in my country and is a notifiable disease under the World Organization for Animal Health (OIE) regulations. Naturally, the disease only infects pigs, but domestic pigs and wild boars of all ages, sexes, and breeds are susceptible, and it can occur year-round. Ornithodoros ticks are the natural reservoir, transmitting the virus through bites. The disease has broken out and is endemic in over 50 countries in Asia, Europe, and Africa, with my country experiencing its first outbreak in 2018, severely impacting the pig industry. The disease is primarily transmitted through direct contact or contact with contaminated vectors. Currently, there is no commercially available vaccine for the disease. Strict biosafety control measures, routine monitoring, and diagnosis are the primary means of prevention and control. Molecular biological testing, particularly fluorescent PCR, is an important laboratory method for the detection and prevention of the pathogen. Here, the B646L (p72), CD2v, and I177L gene fragments were selected as target genes for detection.

[0041] An African swine fever triple fluorescence PCR kit, comprising a B646L (p72) gene-specific primer probe, a CD2V-specific primer probe, and an I177L-specific primer probe, wherein the following primer probes are specific to the B646L (p72) gene:

[0042] Forward primer for B646L (p72) gene: ATTGCGTCTACTGGGGCG (SEQ.ID.NO.4);

[0043] Reverse primer for B646L (p72) gene: GAGCGCTTTATCACCATAAAGC (SEQ.ID.NO.5);

[0044] B646L (p72) gene probe: TAAAGCTTGCATCGCA (SEQ.ID.NO.1).

[0045] The 5' end of the B646L (p72) primer probe is labeled with a reporter group FAM, and the 3' end is labeled with a fluorescence quencher group MGB.

[0046] Further preferably, the following primer probes for the CD2V gene:

[0047] Forward primer of CD2v gene: CCATCTCCCAGAGAACC; (SEQ.ID.NO.6);

[0048] Reverse primer of CD2v gene: AAATGGGTTGAGTGGTTG; (SEQ.ID.NO.7);

[0049] CD2v gene probe: GCTTAGGAAGTAATGGTTCTCTGG (SEQ.ID.NO.2).

[0050] The 5' end of the CD2v primer probe is labeled with a reporter group HEX, and the 3' end is labeled with a fluorescence quencher group MGB.

[0051] Further preferably, the following primer probes for the I177L gene:

[0052] Forward primer of I177L gene: ATAGCCATTACCGGCAAG; (SEQ.ID.NO.8);

[0053] Reverse primer of I177L gene: GGCATRATTATCAAATGCGAA; (SEQ.ID.NO.9);

[0054] I177L gene probe: AGGATTTTATACGGATCCCC (SEQ.ID.NO.3).

[0055] The 5' end of the I177L primer probe is labeled with a reporter group CY5, and the 3' end is labeled with a fluorescence quencher group MGB.

[0056] In one embodiment of the present application, the CD2v primers can sensitively and specifically detect African swine fever virus infection. The B646L (p72) gene primers, I177L gene primers, and CD2v gene primers provided herein have minimum detection limits of 8 copies, 10 copies, and 10 copies, respectively. The use of internal reference primers designed herein can avoid false positives and completely eliminate aerosol contamination from amplification products. The methods provided herein are suitable for testing complex animal clinical samples.

[0057] In a specific embodiment of the present application, the fluorescent PCR reaction system of the kit is: 1 μL each of the upstream primer (10 pmol / μL) and the downstream primer (10 pmol / μL), 0.8 μL of the probe (10 pmol / μL), 10 μL of 2× fluorescent PCR premix, 2 μL of DNA template, and 4.2 μL of nuclease-free water, for a total of 20 μL system.

[0058] In a specific embodiment of the present application, the PCR reaction conditions of the kit are: 95°C for 30s; then 95°C for 10s, 58°C for 20s, 45 cycles, and collecting the fluorescence signal at 58°C for 20s.

[0059] In a specific embodiment of the present application, a method for simultaneously detecting the B646L gene, CD2v gene, and I177L gene of African swine fever virus using a triple fluorescence PCR method for non-diagnostic purposes is adopted, and the steps include:

[0060] Taking samples containing the subject's viral nucleic acid (DNA);

[0061] DNA extraction was performed on the sample;

[0062] The extracted DNA was amplified by real-time fluorescent PCR using a primer combination and a probe;

[0063] The results of real-time fluorescence PCR amplification are used to determine whether African swine fever virus exists and the genes of the African swine fever virus that exist.

[0064] In a specific embodiment of the present application, the RNA sample is preferably a blood or tissue sample.

[0065] In a specific embodiment of the present application, the primer composition comprises:

[0066] The primers designed for the conserved region of the African swine fever virus B646L gene are ASF-IVDC-F2: SEQ.ID.NO.4: ATTGCGTCTACTGGGGCG and ASF-IVDC-R2: SEQ.ID.NO.5: GAGCGCTTTATCACCATAAAGC;

[0067] The primers designed for the conserved region of the African swine fever virus CD2v gene are CD2v-793-qF2: SEQ.ID.NO.6: CCATCTCCCAGAGAACC and CD2v-894-qR2: SEQ.ID.NO.7: AAATGGGTTGAGTGGTTG;

[0068] The primers designed for the conserved region of the African swine fever virus I177L gene are ASFV-I177L-F2SEQ.ID.NO.8: ATAGCCATTACCGGCAAG and ASFV-I177L-R2: SEQ.ID.NO.9: GGCATRATTATCAAATGCGAA.

[0069] In a specific embodiment of the present application, the probe composition comprises:

[0070] The probe ASF-IVDC-prob2 targeting the African swine fever virus B646L gene has a sequence as shown in SEQ.ID.NO.1: TAAAGCTTGCATCGCA.

[0071] The probe CD2v-800-Prob2 targeting the African swine fever virus CD2v gene has a sequence as shown in SEQ.ID.NO.2: GCTTAGGAAGTAATGGTTCTCTGG.

[0072] The probe ASFV-I177L-Prb2 targeting the African swine fever virus I177L gene has a sequence as shown in SEQ.ID.NO.3: AGGATTTTATACGGATCCCC.

[0073] The triple fluorescence PCR detection method of the African swine fever virus B646L (p72) gene, CD2v gene and I177L gene of the present application can have no cross reaction with classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), pseudorabies virus (PRV), porcine epidemic diarrhea virus (PEDV), porcine circovirus (PCV), porcine parvovirus (PPV), healthy whole blood, oropharyngeal swabs, nasal swabs, anal swabs, environmental swabs, pig tissues, etc., and has good specificity.

[0074] To facilitate understanding of the specific solutions of the present application, further explanation will be given below using several specific embodiments as examples in conjunction with the accompanying drawings, and the drawings do not constitute a limitation on the present application.

[0075] Example

[0076] This application provides general and / or specific descriptions of the materials and experimental methods used in the experiments. In the following examples, unless otherwise specified, % represents wt%, i.e., percentage by weight. All reagents or instruments used without manufacturer indication are commercially available conventional reagents.

[0077] Example 1 Design of probes and primers

[0078] 1.1 Materials and Reagents

[0079] The full-length B646L gene fragment of the African swine fever virus B646L plasmid is the fragment sequence of the Georgia2007 strain obtained from NCBI GenBank (GenBank No. AM999764), which was commissioned to Shanghai Bioengineering to synthesize and insert into the pUC57 vector. The sequence length is 1941 bp.

[0080] The African swine fever virus CD2v plasmid was amplified using the designed primers from the full-length CD2v gene isolated in the laboratory, ligated to the pGET-T easy vector, and transformed into DH5α competent cells. Positive clones were picked to construct the CD2v plasmid; the same method was used to construct the I177L positive plasmid.

[0081] DH5α competent cells were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; T4 DNA ligase was purchased from Promega Corporation; PCR product recovery and purification kits and plasmid extraction kits were purchased from QIAgen gel&quick PCR purification, QIAprep SpinMiniprep Kit, and QIAprep Spin Maxprep Kit, all from QIAGEN, Germany; ABI TaqMan GeneExpression Mix was purchased from Invitrogen; HyperProbe Mixture was purchased from Kangwei Century Biotechnology Co., Ltd.; and TE buffer was purchased from Solebro.

[0082] 1.2 Instruments and Equipment

[0083] LightCycler 480II fluorescence PCR instrument, Roche, USA; NanoDrop 1000 UV spectrophotometer, Invitrogen, USA; PCR instrument and UV gel electrophoresis imager, Analytik Jena AG, Germany; gel electrophoresis instrument, Liuhe Instrument.

[0084] 1.3 Primers and probes

[0085] The primer and probe sequences used for amplification of the African swine fever virus target gene were designed by the laboratory based on the conserved regions of the p72, CD2V, and I177L genes, respectively, as shown in Table 1.

[0086] Table 1. Information of alternative primers and probes for ASF fluorescent PCR method

[0087]

[0088] A single fluorescent PCR reaction system was used, with 1 μL each of the upstream primer (10 pmol / μL) and downstream primer (10 pmol / μL), 0.8 μL of the probe (10 pmol / μL), 10 μL of fluorescent PCR premix, 2 μL of DNA template, and nuclease-free water added to 5.2 μL, for a total of 20 μL system.

[0089] The fluorescence PCR reaction program was as follows: 95°C for 30 s; then 95°C for 10 s, 58°C for 20 s, for 45 cycles, and the fluorescence signal was collected at 58°C for 20 s.

[0090] 1.4 Preliminary establishment and optimization of fluorescence PCR method

[0091] like Figure 1During the optimization screening process of the B646L gene primer probe shown in the figure, the concentrations of the upstream and downstream primers designed according to the B646L gene sequence were matched at different concentration ratios of 10pM, 20pM, 30pM, 40pM, 50pM, and 60pM to detect positive plasmids. The results showed that when the upstream and downstream primers of F2R2 were both 20pM and 1μL respectively, the amplification curve with the highest fluorescence intensity (Y-axis value) and the smallest Ct value (the intersection of the X-axis and the threshold line) was obtained. Therefore, this concentration was selected as the working concentration, and the probe concentration was 10pM, 0.8μL.

[0092] According to the above method, CD2v and I177L gene probes were optimized and screened respectively. Figure 3 、 Figure 5 As shown, the confirmation probe concentration was 10 μM in 1 μL.

[0093] According to the two sets of primers and probes designed for the B646L gene, 10 6 copies / μl, 10 5 copies / μl, 10 4 copies / μl, 10 3 copies / μl, 10 2 The B646L plasmids with 10 copies / μl and 10 copies / μl were detected and the log 10 (copy number) as the x-axis and the Ct value as the y-axis to draw a standard curve. Figure 2 As shown, the standard curves drawn by the two sets of primers, R 2 The results are all greater than 0.98. The amplification efficiency of B646L-F2R2 (the standard curve drawn by the dotted line in the figure) is higher, so B646L-F2R2 was selected as the primer and probe for detecting the B646L gene.

[0094] According to the two sets of primers and probes designed for CD2v gene, 10 7 copies / μl, 10 6 copies / μl, 10 5 copies / μl, 10 4.5 copies / μl, 10 4 copies / μl, 10 3 The CD2v plasmid copies / μl were detected and the log 10 (copy number) as the x-axis and the Ct value as the y-axis to draw a standard curve. Figure 4 As shown, the standard curves drawn by the two sets of primers, R 2 The results are credible, and the amplification efficiency of CD2v F2R2 (the solid line standard curve in the figure) is higher. Therefore, CD2v F2R2 was selected as the primer and probe for detecting CD2v gene.

[0095] According to the designed two sets of primers and probes targeting I177L gene, 10 7 copies / μl, 10 6 copies / μl, 10 5 copies / μl, 10 4 copies / μl, 10 3 copies / μl and 10 2 The I177L plasmid was detected by log 10 (copy number) as the x-axis and the Ct value as the y-axis to draw a standard curve. Figure 6 As shown, the standard curves drawn by the two sets of primers, R 2 The results are all greater than 0.99. The amplification efficiency of I177L F2R2 (the standard curve drawn by the short dashed line in the figure) is higher, so I177L F2R2 was selected as the primer and probe for detecting the I177L gene.

[0096] According to the optimization results, the primer probes in Table 2 were selected as the primer probes used to construct the triple fluorescence PCR method.

[0097] Table 2. Primer and probe information used in the ASF triple fluorescence PCR method

[0098]

[0099] Example 2 Triple Fluorescence PCR Reaction System

[0100] 2.1 Construction of triple fluorescence PCR reaction system

[0101] Based on the optimized singleplex PCR reaction system for each gene, the concentrations of dNTPs and Taq HS enzyme were further optimized. The concentrations of Taq HS enzyme (5 U / μL) and dNTP (2.5 mM) were set to 0.3 μL, 0.5 μL, 0.8 μL, 1 μL, and 1.2 μL, respectively. The concentrations of primers and probes for each gene in the tripleplex PCR reaction were optimized using a matrix method. Finally, a standard curve was generated using the optimized tripleplex PCR method. The final optimized triple fluorescence PCR system is as follows: 1 μL each of p72 upstream primer (20 pmol / μL) and downstream primer (30 pmol / μL), 0.8 μL of probe (10 pmol / μL), 1 μL each of CD2v upstream primer (10 pmol / μL) and downstream primer (10 pmol / μL), 0.8 μL of probe (10 pmol / μL), 1 μL each of I177L upstream primer (20 pmol / μL) and downstream primer (20 pmol / μL), 1 μL of probe (10 pmol / μL), 1 μL of Taq HS (5 U / μL), 2.5 μL of dNTP (2.5 mM), 3 μL of 10× Taq buffer, 5 μL of DNA template, and make up to 4.9 μL with nuclease-free water, for a total of 25 μL system. Fluorescence PCR reaction program: 95°C for 30s; then 95°C for 10s, 58°C for 20s, 45 cycles, and collecting fluorescence signals at 58°C for 20s.

[0102] The detection limit of this method was determined to be 5 to 10 copies (Ct value of about 37-40) based on the standard curve drawn from the plasmid serial dilution. Based on the detection limit, the detection standard was determined as follows: a Ct value <38 was considered positive, a Ct value between 38 and 40 was considered suspicious, and if the value was still <40 after repeated testing, it was considered positive, otherwise it was negative.

[0103] 2.2 Specificity detection of triple fluorescence PCR reaction

[0104] The method was used to detect classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), pseudorabies virus (PRV), porcine viral diarrhea virus (PEDV), porcine circovirus (PCV), porcine parvovirus (PPV), healthy whole blood, oropharyngeal swabs, nasal swabs, anal swabs, environmental swabs, pig tissues, etc., all of which were negative, as follows Figure 4 As shown, the amplification curve is a positive control, and no amplification signal was found in other nucleic acid tests.

[0105] 2.3 Clinical Sample and Positive Sample Test Results

[0106] Clinical samples and laboratory positive samples were tested, and the results showed that all 1,295 clinical samples were negative for African swine fever virus B646L, CD2v and African swine fever I177L genes, and no African swine fever virus, CD2v gene deletion strain and African swine fever I177L gene deletion vaccine virus nucleic acid were detected; among the laboratory positive samples, the genotype II strains were all positive for African swine fever virus B646L, CD2v and African swine fever I177L genes, and the genotype I strains were positive for African swine fever virus B646L and African swine fever I177L genes and negative for CD2v; the detection results of the CD2v gene deletion strain were positive for African swine fever virus B646L and African swine fever I177L genes and negative for CD2v. 92 of the above clinical samples and positive virus samples were randomly selected and tested using the fluorescent PCR method described in Announcement No. 172 of the Ministry of Agriculture and Rural Affairs. The results showed that the detection results of the B646L gene by this method were consistent with the detection results of the fluorescent PCR method in Announcement No. 172 of the Ministry of Agriculture and Rural Affairs, with a compliance rate of 100%.

[0107] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0108] The above-described embodiments merely represent several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present application. It should be noted that a person of ordinary skill in the art may make various modifications and improvements without departing from the spirit of the present application, all of which fall within the scope of protection of the present application. Therefore, the scope of protection of the present patent application shall be determined by the appended claims.

Claims

1. An African swine fever virus triple fluorescence PCR kit, comprising: The probe ASF-IVDC-prob2 targeting the African swine fever virus B646L gene has a sequence as shown in SEQ.ID.NO.1: TAAAGCTTGCATCGCA. The probe CD2v-800-Prob2 targeting the African swine fever virus CD2v gene has a sequence as shown in SEQ.ID.NO.2: GCTTAGGAAGTAATGGTTCTCTGG. ASFV-I177L-Prb2, a probe targeting the African swine fever virus I177L gene, whose sequence is shown in SEQ.ID.NO.3: AGGATTTTATACGGATCCCC; and The primers designed for the conserved region of the African swine fever virus B646L gene are ASF-IVDC-F2: SEQ.ID.NO.4: ATTGCGTCTACTGGGGCG and ASF-IVDC-R2: SEQ.ID.NO.5: GAGCGCTTTATCACCATAAAGC; The primers designed for the conserved region of the African swine fever virus CD2v gene are CD2v-793-qF2: SEQ.ID.NO.6: CCATCTCCCAGAGAACC and CD2v-894-qR2: SEQ.ID.NO.7: AAATGGGTTGAGTGGTTG; The primers designed for the conserved region of the African swine fever virus I177L gene are ASFV-I177L-F2SEQ.ID.NO.8: ATAGCCATTACCGGCAAG and ASFV-I177L-R2: SEQ.ID.NO.9: GGCATRATTATCAAATGCGAA.

2. The African swine fever virus triple fluorescence PCR kit according to claim 1, wherein The kit is used to simultaneously detect the three genes of African swine fever virus, namely, the B646L gene, the CD2v gene, and the I177L gene, using a triple fluorescence PCR method.

3. A method for simultaneously detecting the B646L gene, CD2v gene, and I177L gene of African swine fever virus using a triple fluorescence PCR method for non-diagnostic purposes, comprising the following steps: Taking samples containing viral nucleic acid; DNA extraction was performed on the sample; The extracted DNA was amplified by real-time fluorescent PCR using a primer combination and a probe; Real-time fluorescence PCR amplification results are used to determine whether African swine fever virus exists and the genes of the African swine fever virus that exist; Wherein, the primers and probes for the real-time fluorescence PCR amplification are as follows: The probe ASF-IVDC-prob2 targeting the African swine fever virus B646L gene has a sequence as shown in SEQ.ID.NO.1: TAAAGCTTGCATCGCA. The probe CD2v-800-Prob2 targeting the African swine fever virus CD2v gene has a sequence as shown in SEQ.ID.NO.2: GCTTAGGAAGTAATGGTTCTCTGG. ASFV-I177L-Prb2, a probe targeting the African swine fever virus I177L gene, whose sequence is shown in SEQ.ID.NO.3: AGGATTTTATACGGATCCCC; and The primers designed for the conserved region of the African swine fever virus B646L gene are ASF-IVDC-F2: SEQ.ID.NO.4: ATTGCGTCTACTGGGGCG and ASF-IVDC-R2: SEQ.ID.NO.5: GAGCGCTTTATCACCATAAAGC; The primers designed for the conserved region of the African swine fever virus CD2v gene are CD2v-793-qF2: SEQ.ID.NO.6: CCATCTCCCAGAGAACC and CD2v-894-qR2: SEQ.ID.NO.7: AAATGGGTTGAGTGGTTG; The primers designed for the conserved region of the African swine fever virus I177L gene are ASFV-I177L-F2SEQ.ID.NO.8: ATAGCCATTACCGGCAAG and ASFV-I177L-R2: SEQ.ID.NO.9: GGCATRATTATCAAATGCGAA.

Citation Information

Patent Citations

  • Extraction-free triple fluorescent quantitative PCR (Polymerase Chain Reaction) detection composition, method and kit for nucleic acid of African swine fever virus

    CN113308570A

  • Quadruple quantitative fluorescent probe primer combination, kit and identification method for identifying African swine fever wild virus and vaccine strain

    CN113755565A

  • Triple fluorescent quantitative PCR (Polymerase Chain Reaction) detection kit for African swine fever

    CN116064969A

  • Specific probe, gene chip, nucleic acid hybridization assembly and kit

    CN116287428A

  • Quadruple quantitative fluorescent primer probe composition, kit and identification method for identifying African swine fever virus

    CN116656874A

Cited By

  • Freeze-dried multiple fluorescent quantitative PCR (polymerase chain reaction) kit for detecting African swine fever recombinant strain

    CN120700209A