A colloidal gold test strip for detecting anti-pla2r antibody, a preparation method and kit thereof and application

The detection of anti-PLA2R antibodies using colloidal gold test strips solves the problems of invasiveness and high equipment requirements in the diagnosis of membranous nephropathy in existing technologies. It provides a rapid, simple, and low-cost method for detecting anti-PLA2R antibodies, which is suitable for screening at the grassroots level and home testing.

CN118777592BActive Publication Date: 2026-07-24JIANGNAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310347886.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-04-03
Publication Date
2026-07-24
Estimated Expiration
2043-04-03

AI Technical Summary

Technical Problem

Existing technologies for diagnosing membranous nephropathy, especially primary membranous nephropathy, are highly invasive, require sophisticated equipment, and are difficult to popularize. There is a lack of non-invasive, low-risk, safe, inexpensive, and accurate rapid diagnostic kits.

Method used

A colloidal gold test strip was developed that utilizes PLA2R protein as both a capture and detection antigen. It detects anti-PLA2R antibodies using a double-antigen sandwich method. The strip consists of a PVC base plate, an absorbent pad, a reaction membrane, a conjugate pad, and a sample pad. The conjugate pad is loaded with colloidal gold-labeled detection antigens, and the reaction membrane has a detection line and a control line. The strip is easy to operate and requires no specialized equipment.

Benefits of technology

It enables rapid, simple, and low-cost detection of anti-PLA2R antibodies, suitable for large-scale screening at the grassroots level. The results are intuitive and applicable to home and point-of-care testing, reducing the false positive rate and improving the specificity and sensitivity of the test.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118777592B_ABST
    Figure CN118777592B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of biological medicine detection, and discloses a colloidal gold test strip for detecting anti-PLA2R antibody, a preparation method, a kit and application thereof.Capture antigens and detection antigens of the colloidal gold test strip are both PLA2R proteins, the nucleotide sequence of the PLA2R protein is shown as SEQ ID No.1, and the amino acid sequence of the PLA2R protein is shown as SEQ ID No.2.The colloidal gold test strip for detecting anti-PLA2R antibody and the kit have the characteristics of simplicity, good stability, high sensitivity, good specificity, simple operation, suitability for on-site rapid detection, rapid result output and directness, and can be applied to family and bedside detection without special laboratory and experimental personnel.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical detection technology, and in particular to a colloidal gold test strip for detecting anti-PLA2R antibodies, its preparation method, reagent kit, and application. Background Technology

[0002] Membranous nephropathy (MN) is the most common cause of nephrotic syndrome in adults. Its onset is slow, and clinical manifestations vary in severity, mainly including: 1. Nephrotic syndrome: massive proteinuria, hypoalbuminemia, hyperlipidemia, and severe edema; 2. Approximately one-third of patients may develop deep vein thrombosis, twice as often as those without membranous nephropathy; 3. Weakened immune function and susceptibility to infection. Based on etiology, membranous nephropathy can be divided into primary membranous nephropathy (pMN) and secondary membranous nephropathy (sMN). Primary membranous nephropathy accounts for 70%-80% of membranous nephropathy cases and can be further divided into two categories: one expressing anti-phospholipase A2 receptor (PLA2R) antibodies; and the other being idiopathic membranous nephropathy (IMN), in which no related autoantibodies are detectable or the cause is unknown. Currently, primary membranous nephropathy is considered an autoimmune disease, with most patients associated with anti-phospholipase A2 receptor antibodies (PLA2R).

[0003] Anti-PLA2R antibody is a highly specific and sensitive serological marker for primary membranous nephropathy and can also be used to differentiate between primary and secondary membranous nephropathy. Studies have shown that anti-PLA2R antibody titers are correlated with disease activity, with high titers often associated with severe stages of primary membranous nephropathy. Successful immunosuppressive therapy can reduce anti-PLA2R antibody titers, and this decrease precedes a decrease in proteinuria levels. Furthermore, disease relapse is often accompanied by the reappearance of anti-PLA2R antibodies.

[0004] Currently, diagnosis relies on clinical manifestations, histological examination via kidney biopsy, or electron microscopy of kidney tissue. Kidney biopsy is an invasive diagnostic method that causes some harm to the patient; electron microscopy of kidney tissue requires sophisticated equipment, making widespread use difficult; while serum biomarker testing can provide auxiliary screening and disease monitoring for idiopathic membranous nephropathy. Therefore, developing non-invasive, low-risk, safe, inexpensive, and accurate rapid diagnostic kits is of great significance. Summary of the Invention

[0005] To address the aforementioned problems in the prior art, this invention proposes a colloidal gold test strip for detecting anti-PLA2R antibodies. Specifically, it relates to a colloidal gold test strip for detecting anti-PLA2R antibodies, its preparation method, kit, and applications.

[0006] One objective of this invention is to provide a colloidal gold test strip for detecting anti-PLA2R antibody, a marker antibody for primary membranous nephropathy. The capture antigen and detection antigen of the colloidal gold test strip are both PLA2R protein. The nucleotide sequence encoding the PLA2R protein is shown in SEQ ID No. 1, and the amino acid sequence of the PLA2R protein is shown in SEQ ID No. 2.

[0007] The colloidal gold test strip may specifically include a PVC base plate, an absorbent pad, a reaction membrane, a conjugate pad, and a sample pad. The conjugate pad may be loaded with a colloidal gold-labeled detection antigen. The reaction membrane may have a detection line and a control line. The detection line is closer to the conjugate pad, and the control line is closer to the absorbent pad. The detection line is coated with a capture antigen, and the control line is coated with a control agent, preferably a murine antihistidine-tagged antibody. Both the capture antigen and the detection antigen are PLA2R proteins. The nucleotide sequence encoding the PLA2R protein is shown in SEQ ID No. 1; the amino acid sequence of the PLA2R protein is shown in SEQ ID No. 2. The PLA2R protein has been optimized and selected multiple times, exhibiting high expression levels and strong specificity. In specific implementations, the concentration of the capture antigen can be 0.5–1.7 mg / mL; the gold-labeled concentration of the detection antigen can be 0.1–0.3 mg / mL, and the specific concentration can be adjusted according to actual needs.

[0008] The reaction membrane can be disposed in the middle of the PVC base plate, the absorbent pad can be disposed at one end of the PVC base plate and overlapped on one end of the reaction membrane, the bonding pad can be disposed at the other end of the PVC base plate and overlapped on the other end of the reaction membrane, and the sample pad can be disposed next to the bonding pad on the PVC base plate and overlapped on the bonding pad.

[0009] The second objective of this invention is to provide a method for preparing the colloidal gold test strip. The preparation method can refer to methods commonly used in the art, and specifically may include the following steps:

[0010] 1) Prepare PVC base plate, absorbent pad, reaction membrane, binding pad and sample pad;

[0011] 2) Preparation of colloidal gold test strips: The reaction membrane is placed in the middle of the PVC base plate. The absorbent pad is placed at one end of the PVC base plate and overlapped on one end of the reaction membrane. The binding pad is placed at the other end of the PVC base plate and overlapped on the other end of the reaction membrane. The sample pad is placed next to the binding pad on the PVC base plate and overlapped on the binding pad. The test paper is then cut into strips to obtain colloidal gold test strips.

[0012] The preparation method of the reaction membrane may specifically include the following steps: coating a murine antihistamine tag antibody onto a nitrocellulose membrane to form a control line, and coating PLA2R protein onto a nitrocellulose membrane to form a detection line; the detection line is located near the conjugate pad, and the control line is located near the absorbent pad. Preferably, the streaking flow rates of both the murine antihistamine tag antibody and the PLA2R protein on the nitrocellulose membrane are 0.8–1.0 μL / cm, and the distance between the control line and the detection line is 3–5 mm; preferably, the concentration of the murine antihistamine tag antibody is 0.8–1.2 mg / mL, and the concentration of the PLA2R protein is 0.5–1.7 mg / mL, preferably 1.3–1.7 mg / mL.

[0013] The preparation method of the conjugate pad may specifically include the following steps: uniformly spraying colloidal gold-labeled detection antigen onto a glass fiber pad and drying it; preferably, the spraying flow rate of the colloidal gold-labeled detection antigen can be 2-12 μL / cm; preferably, the drying can be carried out at 35-40℃ for 4-8 hours.

[0014] The concentration of the colloidal gold-labeled detection antigen can be 0.1–0.3 mg / mL.

[0015] The third objective of this invention is to provide a colloidal gold test strip product prepared by the preparation method described in the second objective of this invention.

[0016] The fourth objective of this invention is to provide a kit for detecting anti-PLA2R antibodies, which may include the colloidal gold test strip described in the first objective of this invention, or the colloidal gold test strip prepared by the preparation method described in the second objective of this invention, or the colloidal gold test strip described in the third objective of this invention.

[0017] In a specific implementation, the reagent kit may further include a cartridge case; the colloidal gold test strip may be placed inside the cartridge case.

[0018] The cartridge can be any cartridge conventionally used in colloidal gold detection methods. Specifically, for example, the cartridge may include an upper shell and a lower shell, with the colloidal gold test strip for detecting anti-PLA2R antibodies placed between the upper and lower shells. The upper shell is provided with a sample application well and an observation window, the observation window including a test area and a control area. The sample application well corresponds to the sample pad on the colloidal gold test strip for detecting anti-PLA2R antibodies, and the test area and control area correspond to the detection line and control line on the nitrocellulose membrane, respectively.

[0019] The fifth objective of this invention is to provide the application of the colloidal gold test strip described in the first objective of this invention, or the colloidal gold test strip prepared by the preparation method described in the second objective of this invention, or the colloidal gold test strip described in the third objective of this invention, or the kit described in the fourth objective of this invention, preferably in the detection of anti-PLA2R antibody. More preferably, the application may include the following steps: taking the sample to be tested and adding it to the colloidal gold test strip for reaction; specifically, the amount of the sample to be tested may be 8-12 μL, and the reaction time may be 10-15 min.

[0020] In practice

[0021] This invention provides a colloidal gold test strip, reagent kit, preparation method, and application for detecting anti-PLA2R antibodies. Utilizing a double-antigen sandwich method that specifically binds to PLA2R antibodies, this method uses PLA2R as the antigen to detect antibodies. The detection time is short (10-15 minutes); no specialized facilities are required, and the test can be performed by professionals. No special instruments are needed; the results can be determined visually. Furthermore, the operation is simple, the detection time is short, and the cost is low, making it suitable for large-scale screening of idiopathic membranous nephropathy at the grassroots level and enabling home use. The conjugate used for detecting the antigen is colloidal gold, which is lower in cost and more accessible than fluorescent microspheres.

[0022] One objective of this invention is to provide a colloidal gold test strip for detecting anti-PLA2R antibodies, comprising a PVC base plate, an absorbent pad, a reaction membrane, a conjugate pad, and a sample pad; the conjugate pad is loaded with a colloidal gold-labeled detection antigen; the reaction membrane has a detection line (T line) and a control line (C line); the detection line is located near the conjugate pad, and the control line is located near the absorbent pad; the detection line is coated with a capture antigen, and the control line is coated with a control material; the control material is preferably a murine antihistidine-tagged antibody; both the capture antigen and the detection antigen are PLA2R proteins; the nucleotide sequence encoding the PLA2R protein is shown in SEQ ID No. 1; the amino acid sequence of the PLA2R protein is shown in SEQ ID No. 2.

[0023] The sequence of SEQ ID No. 1 is as follows:

[0024] gaaggcgtggcggcggcgctgaccccggaacgcctgctggaatggcaggataaaggcatt

[0025] tttgtgattcagagcgaaagcctgaaaaaatgcattcaggcgggcaaaagcgtgctgacc

[0026] ctggaaaactgcaaacaggcgaacaaacatatgctgtggaaatgggtgagcaaccatggc

[0027] ctgtttaacattggcggcagcggctgcctgggcctgaactttagcgcgccggaacagccg

[0028] ctgagcctgtatgaatgcgatagcaccctggtgagcctgcgctggcgctgcaaccgcaaa

[0029] atgattaccggcccgctgcagtatagcgtgcaggtggcgcatgataacaccgtggtggcg

[0030] agccgcaaatatattcataaatggattagctatggcagcggcggcggcgatatttgcgaa

[0031] tatctgcataaagatctgcataccattaaaggcaacacccatggcatgccgtgcatgttt

[0032] ccgtttcagtataaccatcagtggcatcatgaatgcacccgcgaaggccgcgaagatgat

[0033] ctgctgtggtgcgcgaccaccagccgctatgaacgcgatgaaaaatggggcttttgcccg

[0034] gatccgaccagcgcggaagtgggctgcgataccatttgggaaaaagatctgaacagccat

[0035] atttgctatcagtttaacctgctgagcagcctgagctggagcgaagcgcatagcagctgc

[0036] cagatgcagggcggcaccctgctgagcattaccgatgaaaccgaagaaaactttattcgc

[0037] gaacatatgagcagcaaaaccgtggaagtgtggatgggcctgaaccagctggatgaacat

[0038] gcgggctggcagtggagcgatggcaccccgctgaactatctgaactggagcccggaagtg

[0039] aactttgaaccgtttgtggaagatcattgcggcacctttagcagctttatgccgagcgcg

[0040] tggcgcagccgcgattgcgaaagcaccctgccgtatatttgcaaaaaatatctgaaccat

[0041] attgatcatgaaattgtggaaaaagatgcgtggaaatattatgcgacccattgcgaaccg

[0042] ggctggaacccgtataaccgcaactgctataaactgcagaaagaagaaaaaacctggcat

[0043] gaagcgctgcgcagctgccaggcggataacagcgcgctgattgatattaccagcctggcg

[0044] gaagtggaatttctggtgaccctgctgggcgatgaaaacgcgagcgaaacctggattggc

[0045] ctgagcagcaacaaaattccggtgagctttgaatggagcaacgatagcagcgtgattttt

[0046] accaactggcataccctggaaccgcatatttttccgaaccgcagccagctgtgcgtgagc

[0047] gcggaacagagcgaaggccattggaaagtgaaaaactgcgaagaacgcctgttttatatt

[0048] tgcaaaaaagcgggccatgtgctgagcgat

[0049] The sequence of SEQ ID No.2 is as follows:

[0050] GluGlyValAlaAlaAlaLeuThrProGluArgLeuLeuGluTrpGln Asp Lys Gly IlePheValIleGlnSerGluSerLeuLysLysCys Ile GlnAlaGly Lys Ser ValLeuThrLeuGluAsnCysLysGlnAlaAsnLysHis Met LeuTrp Lys Trp Val SerAsnHis GlyLeuPheAsnIleGlyGlySerGlyCysLeuGlyLeuAsnPheSerAla Pro GluGlnPro LeuSerLeuTyrGluCysAspSerThrLeu Val SerLeuArgTrpArgCysAsnArgLysMetIleThrGlyProLeuGlnTyrSerValGln Val Ala His AspAsnThr ValValAlaSerArgLysTyrIleHisLysTrpIleSer Tyr GlySerGlyGlyGly Asp IleCysGluTyrLeuHisLysAspLeuHisThrIleLysGlyAsnThr His Gly Met Pro CysMet PheProPheGlnTyrAsnHisGlnTrpHisHisGluCysThrArgGluGlyArgGlu AspAspLeuLeuTrpCysAlaThrThrSerArgTyrGluArg Asp Glu LysTrpGlyPheCysProAspProThrSerAlaGluValGlyCysAspThrIle TrpGlu LysAsp LeuAsnSer His IleCysTyrGlnPheAsnLeuLeuSerSerLeuSerTrpSerGluAla

[0051] His

[0052] SerSerCysGlnMetGlnGlyGlyThrLeuLeuSerIleThrAspGluThrGluGluAsnPheIle ArgGluHisMetSerSerLysThrValGluValTrp Met GlyLeuAsnGlnLeu AspGlu His AlaGlyTrpGlnTrpSerAspGlyThrProLeuAsn Tyr LeuAsnTrpSer ProGlu Val AsnPheGluProPheValGluAspHisCysGlyThrPheSerSerPhe Met ProSerAlaTrpArgSerArgAspCysGluSerThrLeuProTyrIleCysLysLys Tyr LeuAsnHis IleAspHisGluIleValGluLysAspAlaTrp Lys TyrTyrAlaThr His CysGluPro GlyTrpAsnProTyrAsnArgAsnCysTyr Lys LeuGln Lys GluGluLys ThrTrpHis GluAlaLeuArgSerCysGlnAlaAspAsnSerAlaLeu Ile Asp Ile

[0053] ThrSerLeuAlaGluValGluPheLeuValThrLeuLeuGlyAspGluAsnAlaSerGluThrTrpIleGlyLeuSerSerAsnLysIleProValSerPhe GluTrpSerAsn Asp SerSer ValIle PheThrAsnTrpHisThrLeuGluProHisIlePhe Pro AsnArgSerGlnLeuCys

[0054] Val SerAlaGluGlnSerGluGlyHisTrpLysVal Lys AsnCysGluGluArgLeuPhe

[0055] Tyr Ile CysLysLysAlaGlyHisValLeuSerAsp

[0056] In one embodiment of the present invention, the PLA2R protein is prepared by linking the synthesized coding sequence to a vector, adding a sequence and a signal peptide sequence to the 5' end, adding a coding sequence of 6 histidine residues (His-tag) to the 3' end, and obtaining a high-purity plasmid by large-scale plasmid extraction of the constructed expression vector, which is then transfected into HEK293 cells to express the PLA2R protein.

[0057] In one embodiment of the present invention, the PLA2R protein can be prepared using conventional protein expression methods in the art.

[0058] Specifically, the preparation method may include the following steps:

[0059] (1) The PLA2R protein sequence was ligated to the vector, and the sequence and signal peptide sequence were added to the 5' end, and the coding sequence of 6 histidines (His-tag) was added to the 3' end;

[0060] (2) The constructed expression vector was extracted to obtain a high-purity plasmid. The plasmid was transiently transfected into HEK293F suspension cells (purchased from Thermo Fisher Scientific). The supernatant of the cell culture medium was collected after 4-6 days. All cell culture medium was centrifuged to obtain the supernatant.

[0061] (3) Use nickel ion affinity chromatography to purify cell supernatant. Wash the affinity column with imidazole buffer containing 20 mM imidazole to remove non-specific binding proteins. Then perform gradient elution with imidazole buffer containing 50, 250, and 500 mM imidazole. Concentrate the eluent containing the target protein and then further purify it by gel filtration chromatography.

[0062] In one embodiment of the present invention, in step (1), preferably, the signal peptide sequence is as shown in SEQ ID No. 3.

[0063] The sequence of SEQ ID No. 3 is as follows:

[0064] MYRMQLLSCIALSLALVTNS.

[0065] The present invention utilizes the specific signal peptide, which significantly improves the expression level.

[0066] In one embodiment of the present invention, in step (2), a 0.22 μm filter membrane is used for filtration;

[0067] In one embodiment of the present invention, in step (3), the preparation method of the buffer solution in the imidazole buffer solution can be as follows: 7.8g Na2HPO4·2H2O, 17.54g NaCl, add an appropriate amount of water to dissolve and then make up to 1000mL, and adjust the pH to 8.0.

[0068] In one embodiment of the present invention, in step (3), an ultrafiltration tube with a molecular weight cutoff of 10 kDa can be selected to concentrate the eluent.

[0069] In one embodiment of the present invention, in step (3), the nickel ion metal chelate affinity chromatography medium is Ni-NTA.

[0070] In one embodiment of the present invention, in step (3), the gel filtration chromatography column may be a Superdex20010 / 300GL.

[0071] In one embodiment of the present invention, after step (3), SDS-PAGE is used to identify the protein purity.

[0072] In one embodiment of the present invention, the reaction membrane is disposed in the middle of the PVC base plate, the absorbent pad is disposed at one end of the PVC base plate and overlapped on one end of the reaction membrane, the bonding pad is disposed at the other end of the PVC base plate and overlapped on the other end of the reaction membrane, and the sample pad is disposed next to the bonding pad on the PVC base plate and overlapped on the bonding pad.

[0073] In one embodiment of the present invention, the concentration of the capture antigen during membrane application may be 0.5–1.7 mg / mL; the concentration of the gold standard for detecting the antigen may be 0.1–0.3 mg / mL.

[0074] In one embodiment of the present invention, the quality control material is a mouse-derived antihistamine tag antibody.

[0075] The second objective of this invention is to provide a method for preparing the colloidal gold test strip. The preparation method can refer to methods commonly used in the art, and specifically may include the following steps:

[0076] 1) Prepare PVC base plate, absorbent pad, reaction membrane, binding pad and sample pad;

[0077] 2) Preparation of colloidal gold test strips: The reaction membrane is placed in the middle of the PVC base plate. The absorbent pad is placed at one end of the PVC base plate and overlapped on one end of the reaction membrane. The binding pad is placed at the other end of the PVC base plate and overlapped on the other end of the reaction membrane. The sample pad is placed next to the binding pad on the PVC base plate and overlapped on the binding pad. The test paper is then cut into strips to obtain colloidal gold test strips.

[0078] In one embodiment of the present invention, the preparation method of the reaction membrane can refer to conventional preparation methods in the art. Specifically, it may include the following steps: coating a murine antihistamine-tagged antibody onto a nitrocellulose membrane to form a control line (C line, i.e., the control line), and coating PLA2R protein onto a nitrocellulose membrane to form a detection line (T line). The streaking flow rates of the murine antihistamine-tagged antibody and the PLA2R protein on the nitrocellulose membrane are both 0.8–1.0 μL / cm. The control line (C line) and the detection line (T line) are parallel to each other and the interval between them can be 3–5 mm. The detection line is closer to the conjugate pad, and the control line is closer to the absorbent pad.

[0079] In one embodiment of the present invention, the concentration of the murine antihistamine tag antibody may be 0.8–1.2 mg / mL; the concentration of the PLA2R protein may be 0.5–1.7 mg / mL, preferably 1.3–1.7 mg / mL, and may be adjusted according to actual conditions.

[0080] In one embodiment of the present invention, the murine antihistamine tag antibody and PLA2R protein are diluted with phosphate buffer, respectively.

[0081] In one embodiment of the present invention, during the preparation of the reaction membrane, the mouse-derived antihistamine tag antibody and PLA2R protein are sequentially applied onto a nitrocellulose membrane using a gold spraying and membrane application machine.

[0082] In one embodiment of the present invention, the preparation method of the conjugate pad can employ methods commonly used in the art, specifically including the following steps: uniformly spraying colloidal gold-labeled detection antigen onto a glass fiber pad and then drying it. The preparation method of the colloidal gold-labeled detection antigen can refer to conventional methods in the art.

[0083] In one embodiment of the present invention, the spray flow rate of the colloidal gold-labeled detection antigen can be 2 to 12 μL / cm.

[0084] In one embodiment of the present invention, the concentration of the colloidal gold-labeled detection antigen may be 0.1 to 0.3 mg / mL.

[0085] In one embodiment of the present invention, the drying is performed at 35-40°C for 4-8 hours.

[0086] The third objective of this invention is to provide a colloidal gold test strip product prepared by the preparation method described in the second objective of this invention.

[0087] The fourth objective of this invention is to provide a kit for detecting anti-PLA2R antibodies, which may include the colloidal gold test strips described in the first objective of this invention, or test strip products prepared by the preparation method described in the second objective of this invention, or colloidal gold test strips described in the third objective of this invention.

[0088] In a specific implementation, the reagent kit may further include a cartridge case; the colloidal gold test strip may be placed inside the cartridge case.

[0089] The cartridge can be any cartridge conventionally used in colloidal gold detection methods. Specifically, for example, the cartridge may include an upper shell and a lower shell, with the colloidal gold test strip for detecting anti-PLA2R antibodies placed between the upper and lower shells. The upper shell is provided with a sample application well and an observation window, the observation window including a test area and a control area. The sample application well corresponds to the sample pad on the colloidal gold test strip for detecting anti-PLA2R antibodies, and the test area and control area correspond to the detection line and control line on the nitrocellulose membrane, respectively.

[0090] The fifth objective of this invention is to provide the application of the colloidal gold test strip described in the first objective of this invention, or the colloidal gold test strip prepared by the preparation method described in the second objective of this invention, or the colloidal gold test strip described in the third objective of this invention, or the kit described in the fourth objective of this invention, preferably in the detection of anti-PLA2R antibody. More preferably, the application may include the following steps: taking the sample to be tested and adding it to the colloidal gold test strip for reaction; specifically, the amount of the sample to be tested may be 8-12 μL, and the reaction time may be 10-15 min.

[0091] In one embodiment of the present invention, the sample may be diluted with 2 to 3 drops of diluent; the diluent is a phosphate buffer containing 4 to 6% polyvinylpyrrolidone (PVP).

[0092] In one embodiment of the present invention, the application of the kit in detecting anti-PLA2R antibodies includes the following steps: adding 10 μL of the sample to be tested into the sample well of the kit, then adding 3 drops of sample diluent and reacting for 15 min. The sample diluent is a phosphate buffer containing 5% polyvinylpyrrolidone (PVP) with a pH of 7.4.

[0093] The detection principle of this invention is that the labeled antigen forms an immune complex with the corresponding antibody in the serum to be tested, and then binds to a specific antigen immobilized on a solid-phase carrier to form a labeled antigen-antibody-solid-phase antigen complex. The antibody content is determined by the label. The capture antigen is the antigen bound to the immobilized carrier to capture the antibody, and the detection antigen is the antigen labeled with the label.

[0094] The technical solution of the present invention has the following advantages compared with the prior art:

[0095] (1) The recombinant protein has good stability and can be stored at 37°C for at least 15 days. Moreover, it has a high expression level and can be used as a key raw material for in vitro diagnostic kits for accurately detecting the content of PLA2R antibody in human blood.

[0096] (2) The colloidal gold test strip and kit for detecting anti-PLA2R antibodies described in this invention use PLA2R protein as the capture antigen and detection antigen. Since this method is based on specific antigen detection antibodies, it can effectively reduce false positives from a mechanistic perspective.

[0097] (3) The colloidal gold test strip and kit for detecting anti-PLA2R antibodies described in this invention are characterized by simplicity, speed, good stability, high sensitivity, and good specificity. They are easy to operate, suitable for rapid on-site testing, and provide quick and intuitive results. The colloidal gold test strip and kit described in this invention are suitable for home and point-of-care testing, requiring no specialized laboratory or personnel. Attached Figure Description

[0098] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein:

[0099] Figure 1 This is a gel filtration chromatography image of the PLA2R protein obtained by further purification by gel filtration chromatography according to the present invention.

[0100] Figure 2 This is an electrophoresis image of PLA2R protein purity identified by SDS-PAGE in this invention.

[0101] Figure 3 This is a schematic diagram of the colloidal gold test strip for detecting anti-PLA2R antibodies according to the present invention; wherein, 1 is the sample pad, 2 is the conjugate pad, 3 is the PVC base plate, 4 is the reaction membrane, 5 is the absorbent pad, C is the C line, and T is the T line.

[0102] Figure 4 This is a schematic diagram of the kit for detecting anti-PLA2R antibodies according to the present invention; wherein, 1 is the sample loading well, 2 is the test area, and 3 is the quality control area; if the result is positive after sample loading, a visible red band (at the T line) will be displayed in the test area, and a visible red band (at the C line) will be displayed in the quality control area.

[0103] Figure 5 This is a schematic diagram of the method for detecting anti-PLA2R antibodies according to the present invention. Detailed Implementation

[0104] The present invention will now be described in detail with reference to specific embodiments. It should be noted that the following embodiments are only used to further illustrate the present invention and should not be construed as limiting the scope of protection of the present invention. Some non-essential improvements and adjustments made by those skilled in the art based on the content of the present invention are still within the scope of protection of the present invention.

[0105] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0106] Source of raw materials

[0107] Unless otherwise specified, the raw materials used in the examples and comparative examples are all disclosed in the prior art, such as those that can be directly purchased or prepared according to the preparation methods disclosed in the prior art.

[0108] The reagents involved in the following examples are as follows:

[0109] Resuspension buffer: prepared by dissolving 0.1% Tween-20, 5% sucrose, 0.5% PEG 6000, 0.02% sodium azide, 1% polyvinylpyrrolidone, 1% mannitol, 1% sorbitol and 0.2% bovine serum albumin in phosphate buffer (0.02M, pH=7.4).

[0110] The buffer solution in the imidazole buffer is: 7.8g Na2HPO4·2H2O, 17.54g NaCl, dissolved in an appropriate amount of water and brought to a final volume of 1000mL, and the pH is adjusted to 8.0.

[0111] Example 1

[0112] A method for preparing a kit for detecting anti-PLA2R antibodies, specifically including the following steps:

[0113] A. The preparation of PLA2R protein includes the following steps:

[0114] (1) The PLA2R protein sequence was ligated to the pCMV3 vector (purchased from Beijing Yiqiao Shenzhou Technology Co., Ltd.), and the sequence and signal peptide sequence SEQ ID No.3 were added to the 5' end, and the coding sequence of 6 histidine (His-tag) was added to the 3' end;

[0115] (2) The constructed expression vector was extracted to obtain a high-purity plasmid. The plasmid was transiently transfected into HEK293F suspension cells. The cell culture medium was collected after 5 days, and all the culture medium was centrifuged to obtain the supernatant.

[0116] (3) Cell supernatant was purified using nickel affinity chromatography (Ni-NTA 6FF pre-packed gravity column, purchased from Bioengineering (Shanghai) Co., Ltd.). The affinity column was washed with imidazole buffer containing 20 mM imidazole to remove non-specifically binding proteins. Gradient elution was then performed using imidazole buffers containing 50, 250, and 500 mM imidazole, and the elution peaks at each stage were collected. The molecular weight and purity of the target protein were determined by SDS-PAGE. The eluent containing the target protein was concentrated using a 10 kDa ultrafiltration tube and further purified using a GE AKAT purifier protein purification system with a Superdex 200 10 / 300GL gel filtration pre-packed column. The collected protein samples were prepared as follows: Figure 1 As shown; protein purity was identified using SDS-PAGE, and the results are as follows. Figure 2 As shown.

[0117] from Figures 1-2 It can be seen that the target protein with a single peak and high purity can be obtained after affinity chromatography and gel filtration chromatography.

[0118] B. The preparation of colloidal gold nanoparticles specifically includes the following steps:

[0119] Add 22.5 mL of chloroauric acid solution (4 g / L) to an Erlenmeyer flask containing 277.5 mL of ultrapure water. Stir the solution magnetically and heat it (300 °C). After the solution boils, add 8 mL of sodium citrate solution (20 mg / mL) to the solution and continue heating and stirring for 30 min. After the reaction is complete, allow it to cool naturally to room temperature to obtain the colloidal gold nanoparticle solution.

[0120] C. Preparation of the detection antigen (PLA2R protein) labeled with colloidal gold nanoparticles, specifically including the following steps:

[0121] Take 5 mL of the above colloidal gold nanoparticle solution into a 15 mL centrifuge tube, and adjust the pH of the above colloidal gold nanoparticle solution to 8.2 with 0.1 M potassium carbonate solution. Then add 75 μg PLA2R protein, vortex to mix, and let stand for 45 min. Then add 10% (m / v) bovine serum albumin solution, vortex to mix, and let stand for 2 h. After the reaction is complete, centrifuge at 9000 rpm and 4℃ for 50 min. Finally, resuspend the bottom precipitate with 0.5 mL of resuspension buffer to obtain the colloidal gold nanoparticle-labeled detection antigen (the gold concentration of the detection antigen is 0.15 mg / mL).

[0122] D. Preparation of the kit for detecting anti-PLA2R antibodies, specifically including the following steps:

[0123] (1) Preparation of reaction membrane: Parallel detection lines T and control lines C were sequentially drawn on the nitrocellulose membrane, with a spacing of 4 mm between the detection lines T and control lines C; the murine antihistamine tag antibody and the capture antigen PLA2R protein were diluted to 1 mg / mL and 1.5 mg / mL respectively with phosphate buffer (0.01 M, pH = 7.4); the diluted murine antihistamine tag antibody and the capture antigen PLA2R protein were sequentially drawn onto the nitrocellulose membrane using a gold sputtering membrane drawing machine, with a drawing flow rate of 0.9 μL / cm for both.

[0124] (2) Preparation of conjugate pad: The colloidal gold-labeled detection antigen PLA2R protein was uniformly sprayed onto a 1cm wide glass fiber pad using a gold spraying and scribing machine with a flow rate of 10μL / cm. Finally, the conjugate pad was prepared by baking at 37℃ for 6h.

[0125] (3) Preparation of colloidal gold test strips: The reaction membrane is pasted in the middle of the PVC base plate, the absorbent pad is pasted at one end of the PVC base plate and overlapped on one end of the reaction membrane, the conjugate pad is pasted at the other end of the PVC base plate and overlapped on the other end of the reaction membrane (the detection line is close to the conjugate pad, and the quality control line is close to the absorbent pad). The sample pad is pasted next to the conjugate pad on the PVC base plate and overlapped on the conjugate pad, thus obtaining the test paper. The test paper is cut longitudinally into 3mm wide test strips, so that each strip contains a PVC base plate, absorbent pad, reaction membrane, conjugate pad and sample pad, thus obtaining colloidal gold test strips.

[0126] (4) Preparation of the kit: The above colloidal gold test strip is packaged into a cartridge to obtain the kit for detecting anti-PLA2R antibody, the structure of which is as follows. Figure 3 , 4 As shown. The assay method for the kit is as follows: A positive result is indicated by the appearance of clearly visible red bands on both the T test line and the C control line; the darker the T line, the stronger the positive result. A negative result is indicated by the appearance of only a clearly visible red band on the C control line. An invalid result is indicated if no red band appears on the C control line. Figure 5 As shown.

[0127] Application examples

[0128] Serum samples from 24 patients diagnosed with idiopathic membranous nephropathy by histopathological examination and 66 patients with non-idiopathic membranous nephropathy were selected. 10 μL of the serum sample to be tested was added to the sample well of the kit prepared in Example 1, followed by 3 drops of sample diluent. The sample was then allowed to flow through the conjugate pad, then through the reaction membrane, and finally through the absorbent pad. (If the serum sample contained anti-PLA2R antibody, the anti-PLA2R antibody would react with the colloidal gold-labeled detection antigen (PLA2R protein) when flowing through the conjugate pad, and then bind sequentially to the fixed capture antigen and murine anti-histidine-tagged antibody when flowing through the reaction membrane.) The reaction was allowed to proceed at room temperature for 15 minutes, and the results could be observed visually. The sample diluent was phosphate buffer containing 5% polyvinylpyrrolidone, pH 7.4, 0.3 mL / tube.

[0129] Using histopathological examination as a reference system, the samples were compared and analyzed. The results were statistically analyzed using a four-fold table as follows:

[0130] Specificity = (True negative / Total number of negative results) × 100%

[0131] Sensitivity = (True positives / Total positives) × 100%

[0132] Table 4. Statistical Results of the Four-fold Table

[0133]

[0134] The results in Table 4 show that the kit has a specificity of 100% and a sensitivity of 95.8%, which indicates that the PLA2R protein provided by this invention can specifically bind to anti-PLA2R antibodies in the blood of patients with membranous nephropathy and has extremely high affinity.

[0135] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A colloidal gold test strip for detecting anti-PLA2R antibodies, characterized in that, The capture antigen and detection antigen of the colloidal gold test strip are both PLA2R proteins; the nucleotide sequence encoding the PLA2R protein is shown in SEQ ID No. 1; the amino acid sequence of the PLA2R protein is shown in SEQ ID No.

2.

2. The colloidal gold test strip for detecting anti-PLA2R antibodies according to claim 1, characterized in that, The colloidal gold test strip includes a PVC base plate, an absorbent pad, a reaction membrane, a conjugate pad, and a sample pad; the conjugate pad is loaded with a colloidal gold-labeled detection antigen; the reaction membrane has a detection line and a control line; the detection line is closer to the conjugate pad, and the control line is closer to the absorbent pad; the detection line is coated with a capture antigen, and the control line is coated with a quality control agent; both the capture antigen and the detection antigen are PLA2R proteins; the nucleotide sequence encoding the PLA2R protein is shown in SEQ ID No. 1; the amino acid sequence of the PLA2R protein is shown in SEQ ID No.

2.

3. The colloidal gold test strip according to claim 2, characterized in that, The reaction membrane is located in the middle of the PVC base plate. The absorbent pad is located at one end of the PVC base plate and overlaps one end of the reaction membrane. The bonding pad is located at the other end of the PVC base plate and overlaps the other end of the reaction membrane. The sample pad is located next to the bonding pad on the PVC base plate and overlaps the bonding pad.

4. The colloidal gold test strip for detecting anti-PLA2R antibodies according to claim 2, characterized in that, The quality control material is a mouse-derived antihistamine tag antibody.

5. The colloidal gold test strip for detecting anti-PLA2R antibodies according to claim 2, characterized in that, The concentration of the captured antigen during membrane application is 0.5~1.7 mg / mL; the concentration of the gold standard for detecting the antigen is 0.1~0.3 mg / mL.

6. The method for preparing colloidal gold test strips according to any one of claims 1 to 5, characterized in that... Includes the following steps: 1) Prepare PVC base plate, absorbent pad, reaction membrane, binding pad and sample pad; 2) Preparation of colloidal gold test strips: The reaction membrane is placed in the middle of the PVC base plate. The absorbent pad is placed at one end of the PVC base plate and overlapped on one end of the reaction membrane. The binding pad is placed at the other end of the PVC base plate and overlapped on the other end of the reaction membrane. The sample pad is placed next to the binding pad on the PVC base plate and overlapped on the binding pad. The test paper is then cut into strips to obtain colloidal gold test strips.

7. The method for preparing the colloidal gold test strip according to claim 6, characterized in that, The method for preparing the reaction membrane includes the following steps: coating a mouse-derived antihistamine tag antibody onto a nitrocellulose membrane to form a control line, and coating a PLA2R protein onto a nitrocellulose membrane to form a detection line.

8. The method for preparing the colloidal gold test strip according to claim 7, characterized in that, The flow rates of the murine antihistamine tag antibody and the PLA2R protein on the nitrocellulose membrane were both 0.8~1.0 μL / cm.

9. The method for preparing the colloidal gold test strip according to claim 7, characterized in that, The distance between the quality control line and the test line is 3~5mm.

10. The method for preparing the colloidal gold test strip according to claim 7, characterized in that, The concentration of the murine antihistamine tag antibody is 0.8~1.2 mg / mL; the concentration of the PLA2R protein is 0.5~1.7 mg / mL.

11. The method for preparing the colloidal gold test strip according to claim 10, characterized in that, The concentration of the PLA2R protein is 1.3~1.7 mg / mL.

12. The method for preparing colloidal gold test strips according to claim 6, characterized in that, The method for preparing the binding pad includes the following steps: uniformly spraying the colloidal gold-labeled detection antigen onto the glass fiber pad and drying it to obtain the final product.

13. The method for preparing colloidal gold test strips according to claim 12, characterized in that, The spray flow rate of the colloidal gold-labeled detection antigen is 2~12 μL / cm.

14. The method for preparing colloidal gold test strips according to claim 12, characterized in that, The drying process involves drying at 35-40℃ for 4-8 hours.

15. The method for preparing colloidal gold test strips according to claim 12, characterized in that, The concentration of the colloidal gold-labeled detection antigen is 0.1~0.3 mg / mL.

16. A colloidal gold test strip prepared by the method of any one of claims 6 to 15.

17. A kit for detecting anti-PLA2R antibodies, comprising a colloidal gold test strip as described in any one of claims 1-5 and 16, or a colloidal gold test strip prepared by the method described in claims 6-15.

18. The kit according to claim 17, characterized in that... It also includes a cartridge case; the colloidal gold test strip is located inside the cartridge case.

19. The colloidal gold test strip according to any one of claims 1 to 5, 16, or the colloidal gold test strip prepared by the preparation method according to any one of claims 6 to 15, or the kit according to claim 17 or 18, in the preparation of reagents for detecting anti-PLA2R antibodies.

20. The application according to claim 19, characterized in that: The application includes the following steps: taking the sample to be tested and adding it to the colloidal gold test strip for reaction.

21. The application according to claim 20, characterized in that: The amount of the sample to be tested is 8~12μL, and the reaction time is 10~15min.

Citation Information

Patent Citations

  • Idiopathic membranous nephropathy duplex detection kit

    CN106885901A

  • Application of detection test strip in preparation of kit for detecting PLA2R antibody

    CN111413506A