Sts marker, primer and identification method completely linked to wheat heading date and plant height and application thereof in breeding
By inserting a G base STS marker at position 68416769 on wheat chromosome 7D, the problem of insufficient molecular markers for regulating heading date and plant height in wheat breeding was solved, achieving stable improvement of wheat heading date and plant height, and providing a method for molecular-assisted breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
- Filing Date
- 2024-07-30
- Publication Date
- 2026-06-26
AI Technical Summary
There are few reports on molecular markers associated with wheat heading date in existing technologies, making it difficult to effectively regulate heading date and plant height traits in wheat breeding.
We developed STS markers that are fully linked to wheat heading date and plant height. By inserting a G base at position 68416769 on wheat chromosome 7D, we designed specific primers for PCR amplification and sequencing identification. We used STS markers to achieve stable improvement of wheat heading date and plant height.
This study achieved stable improvement of wheat heading date and plant height traits, filled the gap in existing technologies regarding insufficient reporting of molecular markers, provided a means of molecular-assisted breeding, and enabled the screening of wheat materials that head early or late.
Smart Images

Figure CN118813853B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular biology and crop breeding technology, and specifically relates to an STS marker, primer, identification method that is completely linked to wheat heading date and plant height, and its application in breeding. Background Technology
[0002] Wheat is a long-day crop, and flowering is induced under long-day conditions. Based on different growth habits, wheat can be divided into spring wheat and winter wheat. Winter wheat requires a period of sustained low-temperature induction before it can normally head and flower. Therefore, genes affecting wheat heading through photoperiod and vernalization are the main genetic regulatory factors determining its growth habits. Furthermore, even under ideal vernalization and day length conditions, wheat still exhibits differences in heading time, indicating the existence of genes that regulate heading unaffected by environmental factors; these genes are collectively referred to as precocity genes (Bullrich et al., 2002). With the release of a high-quality wheat reference genome, some minor genes involved in regulating wheat heading time have been identified through homologous cloning or map-based cloning, enriching the genetic regulatory network of wheat heading time (Fan et al., 2021; Liu et al., 2019). However, due to the diversity of factors affecting wheat heading time variation and the complexity of the genome structure, the discovery and utilization of superior allelic variations in heading time-related genes and the cloning of new genes remain of great significance.
[0003] Vernalization refers to the phenomenon that plants must undergo a period of sustained low-temperature induction before transitioning from vegetative growth to reproductive growth. Based on whether vernalization is required, common wheat can be divided into winter wheat and spring wheat. Winter wheat requires low-temperature treatment and can only be sown in autumn, while spring wheat, which does not require vernalization, can be sown in autumn or spring. The diversity of wheat growth habits is mainly controlled by vernalization genes. Currently, four vernalization genes have been cloned in wheat, named VRN1, VRN2, VRN3, and VRN4 (Kippes et al., 2015; Yan et al., 2006; Yan et al., 2004; Yan et al., 2003). VRN1, located on the long arm of wheat chromosome 5, encodes an AP1-like MADS-box transcription factor that promotes wheat heading and flowering (Yan et al., 2003). VRN2 encodes a flowering inhibitor, the flowering-inhibiting effect of which can be partially offset by vernalization. In diploid wheat, map-based cloning identified two closely linked genes, ZCCT1 and ZCCT2, at the VRN2 locus, encoding proteins containing conserved zinc finger and CCT domains, respectively (Yan et al., 2004). VRN3 encodes a flowering-promoting factor highly homologous to the Arabidopsis flower-producing locus T(FT) gene (Yan et al., 2006). Besides regulating wheat heading time, studies have shown that VRN3 and some of its paralogous genes also influence yield-related traits in wheat, including spike length, number of spikelets per spike, and plant height. Map-based cloning revealed that VRN-D4 originates from an insertion of a 290 kb segment on the long arm of chromosome 5A, which contains the VRN-A1 gene (Kippes et al., 2015). Wheat is a long-day crop, and flowering is induced when day length exceeds a certain duration. The photoperiod response of wheat is mainly controlled by the Photoperiod 1 (Ppd1) gene, which belongs to the pseudo-response regulator (PRR) gene family and is homologous to the Ppd-H1 gene in barley (Beales et al., 2007). Although most wheat varieties require long-day conditions to head and flower normally, some varieties do not depend on day length for growth; these wheat varieties are called photoperiod-insensitive. An important factor that cannot be ignored is the introduction of a semi-dominant Ppd1 mutation to enable long-day wheat to grow normally under day-neutral conditions, thereby enhancing its adaptability to different planting areas (Beales et al., 2007).Even when vernalization and photoperiod are simultaneously met, wheat heading dates can still vary, indicating the existence of a class of genes that influence wheat heading independently of vernalization and photoperiod pathways. These genes are collectively referred to as earliness per se (Eps). In a narrower sense, earliness per se genes refer to a third class of genes that regulate wheat heading, independent of vernalization and photoperiod genes, similar to the autonomous flowering pathway in Arabidopsis thaliana (Bullrich et al., 2002; Cheng et al., 2017). The genetic regulatory network of wheat heading date is complex and easily influenced by various environmental factors. Developing molecular markers associated with wheat heading date is of great significance for wheat breeding; however, there are few reports on molecular markers associated with wheat heading date in current technology. Summary of the Invention
[0004] This invention addresses the problem of limited reports on molecular markers associated with wheat heading date in the prior art. It provides an STS marker, primers, identification method, and its application in breeding that are fully linked to wheat heading date and plant height, and develops new molecular markers associated with wheat heading date for molecular-assisted breeding.
[0005] The technical solution for which this invention seeks protection is as follows:
[0006] An STS marker that is fully linked to wheat heading date and plant height, wherein the STS marker is a G base insertion at 68416769 on wheat chromosome 7D, with the G base inserted between 68416769 and 68416770.
[0007] Among the STS markers mentioned above, the mutation site sequence for the insertion of the G base at position 68416769-68416773 on wheat chromosome 7D is TGGGG, corresponding to the wheat mutant plant; the wild-type site sequence at position 68416769-68416772 on wheat chromosome 7D is TGGG, corresponding to the wheat wild-type plant.
[0008] In a specific embodiment of the present invention, the mutant wheat plants exhibit early heading and reduced plant height; the wild-type wheat plants exhibit late heading and increased plant height.
[0009] Preferably, the genome version of the wheat is the Chinese Spring Reference Genome 1.0.
[0010] The present invention provides a primer capable of amplifying the above-mentioned STS marker, the primer comprising an upstream primer and a downstream primer, the nucleotide sequences of the upstream primer and the downstream primer being as shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.
[0011] The present invention provides a kit for identifying wheat heading date and plant height, comprising the above-mentioned STS markers that are completely linked to wheat heading date and plant height.
[0012] Preferably, the kit further includes primers for amplifying the STS marker that is fully linked to wheat heading date and plant height; the primers for amplifying the STS marker that is fully linked to wheat heading date and plant height include an upstream primer and a downstream primer, the nucleotide sequences of which are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.
[0013] This invention also provides a method for identifying wheat heading date and plant height, using the STS marker fully linked to wheat heading date and plant height as described above to detect the wheat material to be tested, comprising: performing PCR amplification on the DNA of the wheat material to be tested using primers that can amplify the STS marker fully linked to wheat heading date; performing first-generation sequencing on the PCR amplified DNA product; the forward and reverse sequences of the STS marker primers that can amplify and identify wheat heading date and plant height are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively;
[0014] The sequences of the sequencing primers for the first-generation sequencing are shown in SEQ ID NO:3; the results of the first-generation sequencing are as follows: the characteristic sequence of the mutant is shown in SEQ ID NO:4; the characteristic sequence of the wild type is shown in SEQ ID NO:5;
[0015] The DNA of the wheat material to be tested can be extracted from the roots, stems, leaves, flowers, ears, and grains of wheat.
[0016] In a specific embodiment of the present invention, the PCR reaction system comprises: 0.5 μL / μL 2×High-FidelityMaster Mix, 10 mM each of forward and reverse primers, 40 ng / μL of DNA from the wheat material to be tested, and the remainder being double-distilled water; the PCR reaction conditions are: pre-denaturation at 98℃ for 2 min; one cycle consisting of denaturation at 98℃ for 10 s, annealing at 60℃ for 10 s, and extension at 72℃ for 120 s, for a total of 32 cycles; and a final extension at 72℃ for 5 min.
[0017] This invention also provides a molecular-assisted breeding method for wheat, which uses the above-described method to screen for early-heading or late-heading wheat at any stage of the wheat growth cycle for breeding.
[0018] Beneficial effects:
[0019] This invention provides an STS marker completely linked to wheat heading date and plant height. The STS marker involves a single-base insertion mutation at position 68416769 on wheat chromosome 7D, inserting a G base between positions 68416769 and 68416770. The mutant with the single-base G insertion at position 68416769 on wheat chromosome 7D is a mutant type, corresponding to earlier heading and reduced plant height. The genotype lacking the single-base G at position 68416769 on wheat chromosome 7D is wild-type, corresponding to later heading and increased plant height. Verification shows that the STS marker is completely linked to wheat heading date and plant height. The insertion of a single-base G at position 68416769 on wheat chromosome 7D can achieve stable improvement of wheat heading date and plant height, filling the gap in existing technologies regarding the scarcity of reports on molecular markers associated with wheat heading date. In addition, the sites identified by functional STS markers in the wild type and mutants described in this invention can be used to improve the heading date and plant height of wheat through backcross selection.
[0020] The present invention also provides primers for amplifying the STS marker, wherein the primers can identify or assist in the identification of wheat heading date and plant height; and can prepare products for identifying or assisting in the identification of wheat heading date and plant height; detect, screen or breed wheat with different heading date and plant height phenotypes; prepare wheat products for detecting, screening or breeding with different heading date and plant height; and identify or assist in the identification of heading date and plant height genotypes.
[0021] The present invention also provides a method for identifying the heading date and plant height of wheat, comprising the following steps: performing a PCR reaction on the genomic DNA of the wheat to be tested using the primers, and then sequencing the PCR product using the primers. The mutant type, as shown in SEQ ID NO:4, exhibits early heading and reduced plant height; the wild type, as shown in SEQ ID NO:5, exhibits late heading and increased plant height.
[0022] Using the STS markers, wild-type, and mutant materials described in this invention, wheat heading date and plant height can be improved through marker-assisted selection. Heading date and plant height play a crucial role in yield-related traits. Developing and identifying molecular markers fully linked to these traits, and verifying their effectiveness, holds significant application potential. The STS markers and related methods developed in this invention can be applied to the molecular improvement of wheat heading date and plant height traits. Attached Figure Description
[0023] Figure 1 The figures show the phenotypes of mutant eh1 and wild-type WT in Experiment Example 1 of this invention, where: A is the whole plant phenotype; B is the ear and cob phenotype; C is the statistical comparison of plant height; and D is the statistical comparison of ear length.
[0024] Figure 2The following is the genotyping results using the STS markers in Experiment Example 2 of this invention: A is the localization analysis of extreme mixed pools in the F2 population of the cross between mutant eh1 and wild type; B is the QTL mapping of wheat chromosome 7D; C is the sequencing verification of the mutation site on wheat chromosome 7D, where WT represents wild type and eh1 represents mutant; D is the comparison of heading dates corresponding to different genotypes of the mutant site in the F2 population of the cross between mutant eh1 and wild type.
[0025] Figure 3 The results of the mutant transgenic verification in Experiment 3 of this invention are shown below. In this example: A shows the heading phenotype of the FT-D1 gene-knockout plant and the transgenic overexpression mutant FT-D1 genotype plant. The left figure, from left to right, shows the control Fielder, the A genome FT gene-knockout line, the D genome FT gene-knockout line, and the A and D genomes FT gene-knockout line. The right figure, from left to right, shows the control Fielder and three FT-D1 overexpression lines. B shows the ear and rachis phenotypes of the edited and overexpressed plants corresponding to A above. C shows the statistical comparison of heading time, plant height, and ear length of the edited and overexpressed plants corresponding to A above.
[0026] Figure 4 This invention provides an analysis of plant height variation in control plants, edited plants, and overexpression plants in Experiment 3. A represents the whole-plant phenotype of mature control plants, edited plants, and overexpression plants; B compares the changes in internode length at different intervals in control plants, edited plants, and overexpression plants; C shows cytological observation of longitudinal sections of the rachis of control plants, edited plants, and overexpression plants; D compares the number of cells per unit area of the rachis of control plants, edited plants, and overexpression plants. Fielder represents the control non-transgenic or edited plant, ft-D1. KO For the FT-D1 edit knockout line, ft-D1 OE It is an FT-D1 overexpression line. Detailed Implementation
[0027] The present invention will be further described in detail below with reference to specific embodiments, but this does not limit the scope of protection of the present invention.
[0028] biomaterial sources
[0029] Wild-type wheat: Zhongyuan 9 is a high-generation wheat variety bred by the Institute of Crop Science, Chinese Academy of Agricultural Sciences, and is available to the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.
[0030] The wheat early heading mutant eh1 is a heading-date mutation induced by gamma ray mutagenesis of Zhongyuan 9. The applicant promises to release it to the public for verification of the effectiveness of the invention within 20 years from the date of this application. The public can also obtain the wheat heading-date mutant eh1 through the following mutagenesis method: Wild-type dry seeds are fixed on an irradiation tray, then irradiated with gamma rays, and the treated seeds are planted in the ground. After six generations of continuous planting, a stable heading-date mutant eh1 is screened out.
[0031] Individual plants of the F2 generation of the hybrid population of "Zhongyuan 9" and "eh1": These are obtained by self-pollination of the F1 generation seeds of the hybrid population of "Zhongyuan 9" and "eh1". The applicant promises to provide relevant seeds for verifying the effects of this invention. The public can also obtain these seeds by hybridizing "Zhongyuan 9" and "eh1" using the pollen tube pathway method as the male parent. The seeds produced on the female parent plant are the F1 generation seeds. Planting and harvesting the F1 generation yields the F2 generation seeds.
[0032] Group 1 Examples: STS Markers Completely Linked to Wheat Heading Date and Plant Height
[0033] This set of embodiments provides an STS marker that is completely linked to wheat heading date and plant height. All embodiments in this set share the following common feature: the STS marker that is completely linked to wheat heading date and plant height has a single-base insertion mutation at position 68416769 on wheat chromosome 7D, with a G base inserted between 68416769 and 68416770, which can specifically identify the single-base insertion mutation at position 68416769 on wheat chromosome 7D.
[0034] Those skilled in the art can design primers based on the mutation bases, mutation sites, and their genomic positions associated with the STS marker disclosed in this invention, obtain usable primers, perform PCR amplification using the obtained usable primers, sequence the PCR amplification products, and, in conjunction with the description in this invention regarding the linkage between the STS marker and wheat heading date and plant height traits, ultimately determine the specific wheat heading date and plant height based on the sequencing results.
[0035] Any behavior that involves designing primers, obtaining usable primers, performing PCR amplification using the obtained usable primers, sequencing the PCR amplification products, and identifying the wheat heading period and plant height based on the sequenced results of the STS marker mutation bases, mutation sites, and their genomic locations disclosed in this invention falls within the protection scope of this invention.
[0036] In a specific embodiment of the present invention, the wheat genome version is the Chinese Spring Reference Genome 1.0.
[0037] In a specific embodiment, the mutation site sequence of G base insertion at positions 68416769-68416773 on wheat chromosome 7D is TGGGG, corresponding to a wheat mutant plant; the wild-type site sequence at positions 68416769-68416772 on wheat chromosome 7D is TGGG, corresponding to a wheat wild-type plant; the mutant with G base insertion mutation exhibits early heading and reduced plant height; the wild-type exhibits late heading and increased plant height.
[0038] The second set of examples amplifies the STS-labeled primers described in the first set of examples.
[0039] This set of embodiments provides a primer that can amplify the STS marker described in the first set of embodiments. The primer includes an upstream primer and a downstream primer, and the nucleotide sequences of the upstream primer and the downstream primer are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.
[0040] Group 3 Examples: Kit for Identifying Wheat Heading Date and Plant Height
[0041] This set of embodiments provides a kit for identifying wheat heading date and plant height. A common feature of this set of embodiments is that the kit includes the STS marker described in any of the embodiments of Group 1, which is completely linked to wheat heading date and plant height.
[0042] In a specific embodiment, the kit further includes primers that can amplify the STS marker that is fully linked to wheat heading date and plant height;
[0043] Preferably, the primers that amplify the STS marker that is fully linked to wheat heading date and plant height include an upstream primer and a downstream primer, the nucleotide sequences of which are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.
[0044] In a specific embodiment of the present invention, the kit further includes: PCR reaction reagents and electrophoresis reagents;
[0045] Preferably, the PCR reaction reagents include: PCR buffer, dNTPs, DNA polymerase, and double-distilled water; the electrophoresis reagents are agarose, EB, and electrophoresis buffer.
[0046] Group 4 Examples: Methods for Identifying Wheat Heading Date and Plant Height
[0047] This set of embodiments provides a method for identifying the heading stage and plant height of wheat, using the STS marker of the first embodiment to detect the wheat material to be tested; in a specific embodiment of the present invention, the DNA of the wheat material to be tested can be extracted from the roots, stems, leaves, flowers, ears, and grains of wheat.
[0048] In a specific embodiment, the method for identifying the heading date and plant height of wheat includes: performing PCR amplification on the DNA of the wheat material to be tested using STS marker primers that can amplify the wheat heading date and plant height; then performing first-generation sequencing on the PCR amplification product, with the sequence of the sequencing primers as shown in SEQ ID NO:3, and obtaining the mutant type with characteristic sequence as shown in SEQ ID NO:4 and the wild type with characteristic sequence as shown in SEQ ID NO:5 through first-generation sequencing.
[0049] Preferably, the upstream and downstream sequences of the primers that can amplify the STS marker that is completely linked to wheat heading date and plant height are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively;
[0050] Preferably, the PCR reaction system comprises: 0.5 μL / μL 2×High-Fidelity Master Mix, 10 mM each of forward and reverse primers, 4 ng / μL of DNA from the wheat material to be tested, and the remainder being double-distilled water;
[0051] Preferably, the PCR reaction conditions are: pre-denaturation at 98℃ for 2 min; one cycle consists of denaturation at 98℃ for 10 s, annealing at 60℃ for 10 s, and extension at 72℃ for 120 s, for a total of 32 cycles; and a final extension at 72℃ for 5 min.
[0052] Group 5 Examples: Wheat Molecular Assisted Breeding Methods
[0053] This set of embodiments provides a molecular-assisted breeding method for wheat, which uses the method described in the fourth set of embodiments to screen for wild-type wheat with different heading dates and plant heights or mutant wheat with different heading dates and plant heights at any stage of the wheat growth cycle for breeding.
[0054] Example 1: Comparison of wild-type and mutant eh1 phenotypes
[0055] 1. Experimental Materials and Methods
[0056] Wild-type Zhongyuan 9 and the mutant eh1 were planted in the experimental field of the Institute of Crop Science, Chinese Academy of Agricultural Sciences, with 20 plants per row and a row length of 2 meters. The heading date and plant height were identified at the end of April and at the wheat heading and maturity stages in June, respectively. Phenotypic analysis was conducted for three consecutive years from 2018 to 2020. The mutant eh1 showed significant differences in heading date and plant height compared to the wild type.
[0057] 2. Experimental Results
[0058] Phenotypic identification results under different environments showed that the mutant eh1 had a heading date more than 10 days earlier than the wild type, a maturity date approximately 3 days earlier, a plant height significantly reduced by 26.9%, a panicle length significantly reduced by 26.1%, and an average reduction of 0.6 spikelets per panicle. Figure 1 ).
[0059] Example 2: Development of an STS marker completely linked to wheat heading date and plant height
[0060] 1. Experimental Methods
[0061] Segregating populations were constructed using the mutant eh1 and wild-type as parents. The mutant gene was located using extreme pooling and genetic linkage mapping. The mutation site was identified by sequence variation analysis. Primers were designed based on the location of the mutation site in the genome for specific amplification, and sequencing was performed using the corresponding primers for identification. Based on the above experimental methods, a specific site-specific STS marker for identifying this site was developed. This marker was used for PCR reaction with I5 2×High-Fidelity Master Mix. The reaction system consisted of: 25 μL of 2×High-Fidelity Master Mix, 2 μL each of forward and reverse primers (10 mM), 100 ng of genomic DNA, and ultrapure water to a final volume of 50 μL. The PCR reaction program was: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 60℃ annealing for 10 s, 72℃ extension for 120 s, for a total of 32 cycles; and a final extension at 72℃ for 5 min.
[0062] 2. Experimental Results
[0063] Using heading date as the target trait, extreme pool analysis revealed the presence of a linked gene on wheat chromosome 7D. Combined with genetic linkage mapping and sequence variation analysis, a single-base insertion mutation was observed in the FT-D1 gene within the eh1 mutant, resulting in a genotype change from "TGGG" to "TGGGG". Specific amplification primers were designed based on sequences near the mutation site. The forward primer pSTS-HD-PH-for has a sequence of 5'-TTCCGCAGCTCATATACCTT-3' (SEQ ID NO:1), and the reverse primer pSTS-HD-PH-rev has a sequence of 5'-ATTTCCCTTAGTTGCTACGCCTA-3' (SEQ ID NO:2). The PCR amplification product size was 3479 bp. Sequencing primer 5'-CCCAACCTTAGGGAGTATCTC C-3' (SEQ ID NO:3) was used to amplify and sequence individual plants in the segregating population to identify the target mutation site, demonstrating a significant correlation between this mutation site and wheat heading date. Figure 2 The nucleotide sequences obtained by first-generation sequencing of the sequencing primers are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively:
[0064] SEQ ID NO:4:
[0065] CCCAACCTTAGGGAGTATCTCCACTGGTAAGTACTAAATTTGTAACTCAGTT
[0066] GAATAATTTCTCTGTCCCTAGATATACACAGTAGCTCATGTGTGTGTGTCTAC
[0067] ATGTGTGTGCAGGCTTGTGACAGATATCCCCGGTACAACTGGTGCATCCTTC
[0068] GGGCAGGAGGTGATGTGCTACGAGAGCCCTCGTCCGACCATGGGGATCCAT
[0069] CGCTTCGTGCTCGTGCTCTTCCAGCAGCTCGGCCGGCAGACCGTGTACGCT
[0070] CCCGGGTGGCGCCAGAACTTCAACACCAGGGACTTCGCCGAGCTCTACAA
[0071] CCTCGGCCCGCCTGTCGCCGCCGTCTACTTCAACTGCCAGCGTGAGGCCGG
[0072] CTCCGGCGGCAGGAGGATGTACAATTGATCTACCCATGGCCCTCGTACGCC
[0073] ACCCGCCGCCAAGTCAGCAAATTATCCAACGTGGCTAGTTTACTAGTATATA
[0074] GTTTGTCATAAGAAGCCAGCCACGAATTAATTAAGCAGTATCTCTATATTGG
[0075] CAACACATACACTACATATATGCATACTATATGATCGATGTATAACTAGCCGC
[0076] ATGCATATATGCAATCAACGGCTAAGTAAGGGGGGATGAAACCCTAGATCA
[0077] ATGGCTTGGTACTGCACTATATATGTAGTCTGCAATAAACTGATGCCAATAGT
[0078] ATACAGCACACAATATTGGAGGAGCTACACGCCATGTGCAACTTAGTGCTAT
[0079] CTGGTACATATCTGCAGGTTGGTCTTGTGTGTTCACTTATGCGTGCATGAAC
[0080] ATCA
[0081] SEQ ID NO:5
[0082] CCCAACCTTAGGGAGTATCTCCACTGGTAAGTACTAAATTTGTAACTCAGTT
[0083] GAATAATTTCTCTGTCCCTAGATATACACAGTAGCTCATGTGTGTGTGTCTAC
[0084] ATGTGTGTGCAGGCTTGTGACAGATATCCCCGGTACAACTGGTGCATCCTTC
[0085] GGGCAGGAGGTGATGTGCTACGAGAGCCCTCGTCCGACCATGGGATCCATC
[0086] GCTTCGTGCTCGTGCTCTTCCAGCAGCTCGGCCGGCAGACCGTGTACGCTC
[0087] CCGGGTGGCGCCAGAACTTCAACACCAGGGACTTCGCCGAGCTCTACAAC
[0088] CTCGGCCCGCCTGTCGCCGCCGTCTACTTCAACTGCCAGCGTGAGGCCGGC
[0089] TCCGGCGGCAGGAGGATGTACAATTGATCTACCCATGGCCCTCGTACGCCA
[0090] CCCGCCGCCAAGTCAGCAAATTATCCAACGTGGCTAGTTTACTAGTATATAG
[0091] TTTGTCATAAGAAGCCAGCCACGAATTAATTAAGCAGTATCTCTATATTGGC
[0092] AACACATACACTACATATATGCATACTATATGATCGATGTATAACTAGCCGCA
[0093] TGCATATATGCAATCAACGGCTAAGTAAGGGGGGATGAAACCCTAGATCAA
[0094] TGGCTTGGTACTGCACTATATATGTAGTCTGCAATAAACTGATGCCAATAGTA
[0095] TACAGCACACAATATTGGAGGAGCTACACGCCATGTGCAACTTAGTGCTAT
[0096] CTGGTACATATCTGCAGGTTGGTCTTGTGTGTTCACTTATGCGTGCATGAAC
[0097] ATCA
[0098] The TGGGG genotype of SEQ ID NO:4 is a mutant genotype with bases 199-203, which is characterized by early heading and reduced plant height.
[0099] The TGGG genotype at bases 199-202 of SEQ ID NO:5 is wild-type, characterized by late heading and increased plant height.
[0100] Experiment Example 3: Transgenic Experiment Verifies the Regulatory Effect of Mutant Genes on Wheat Heading Date and Plant Height
[0101] 1. Experimental Methods
[0102] The mutant gene FT-D1 was edited using CRISPR / Cas9 technology, with pWMB110 as the vector and the bar gene as the selection marker. The FT-D1 gene single-stranded guide RNA (sgRNA) sequence is 5'-CAACCCTGCCAACCACCAGC-3'. The sgRNA was cloned into the pWMB110 vector driven by the TaU3 promoter, and transgenic plants were obtained by Agrobacterium-mediated transformation of the spring wheat variety "Fielder". DNA was extracted from the leaves of the T0 generation transgenic plants, and the FT-D1 gene sgRNA sequence was amplified. After first-generation sequencing of the PCR product, the sequence was compared with the corresponding site of the unedited Fielder plants. The heading date and plant height of the positive and control plants were investigated. In addition, the mutant FT-D1 was fused with a flag protein tag and cloned into the entry vector pDONR207. Then, the target fragment was constructed into the pUbiGW vector according to the steps of the Gateway Cloning Manual (Invitrogen, Carlsbad, CA). The recombinant vector was transformed into the spring wheat variety Fielder using Agrobacterium-mediated transformation.
[0103] 2. Experimental Results
[0104] Analysis of T3-positive plants with FT-D1 gene editing showed that knocking out the gene delayed the wheat heading date by an average of 5 days, while transgenic plants overexpressing the mutant FT-D1 allele advanced the heading date by approximately 10 days. Furthermore, gene knockout and FT-D1 overexpression resulted in a 5.6% increase and an 8.5% decrease in ear length compared to the wild-type control, respectively, and overexpression of the mutant FT-D1 also significantly reduced the number of spikelets per ear. Figure 3 An investigation of transgenic plant height showed that knockout and overexpression of the FT-D1 gene significantly increased wheat plant height by 12.6% and decreased it by 7.3% compared to the wild-type control, respectively. Furthermore, the number of cells in wheat stems also showed significant changes in transgenic plants. Figure 4 ).
[0105] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.
Claims
1. The application of an STS marker fully linked to wheat heading date and plant height in the breeding of wheat heading date and plant height, characterized in that, The STS markers indicate that a G base was inserted on wheat chromosome 7D between positions 68416769 and 68416770; the mutation site sequence for the G base insertion on wheat chromosome 7D between positions 68416769 and 68416773 is TGGGG, corresponding to a wheat mutant plant; the wild-type site sequence on wheat chromosome 7D between positions 68416769 and 68416772 is TGGG, corresponding to a wild-type wheat plant; the wheat genome version is the Chinese Spring Reference Genome 1.
0.
2. The application of the STS marker fully linked to wheat heading date and plant height according to claim 1 in the breeding of wheat heading date and plant height, characterized in that, The mutant wheat plants exhibited early heading and reduced plant height; the wild-type wheat plants exhibited late heading and increased plant height.
3. The application of a primer for amplifying the STS marker described in any one of claims 1-2 in breeding wheat heading stage and plant height, characterized in that, The primers include an upstream primer and a downstream primer, the nucleotide sequences of which are as shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.
4. A method for identifying the heading stage and plant height of wheat, characterized in that, The detection of the STS markers that are completely linked to wheat heading date and plant height as described in any one of claims 1-2 for the wheat material to be tested includes: performing PCR amplification on the DNA of the wheat material to be tested using primers for amplifying the STS markers that are completely linked to wheat heading date; performing first-generation sequencing on the PCR amplified DNA product; the forward and reverse sequences of the primers for amplifying and identifying the STS markers for wheat heading date and plant height are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The sequences of the sequencing primers for the first-generation sequencing are shown in SEQ ID NO:3; the results of the first-generation sequencing are as follows: the characteristic sequence of the mutant is shown in SEQ ID NO:4; the characteristic sequence of the wild type is shown in SEQ ID NO:5; The DNA of the wheat material to be tested was extracted from the roots, stems, leaves, flowers, ears, and grains of wheat.
5. The method according to claim 4, characterized in that, The PCR reaction system includes: 0.5 μL / μL 2×High-Fidelity Master Mix, 10 mM each of forward and reverse primers, 40 ng / μL of DNA from the wheat material to be tested, and the remainder being double-distilled water; the PCR reaction conditions are: 98℃ pre-denaturation for 2 min; one cycle consists of 98℃ denaturation for 10 s, 60℃ annealing for 10 s, and 72℃ extension for 120 s, for a total of 32 cycles; and a final extension at 72℃ for 5 min.
6. A molecular-assisted breeding method for wheat with controlled heading date and plant height, characterized in that, The method described in any one of claims 4-5 can be used to screen early-heading wheat varieties for breeding at any stage of the wheat growth cycle.
Citation Information
Patent Citations
CN102690818A
CN104372003A