Mutant strains and complemented strains lacking surface polysaccharide synthesis genes of Aeromonas dakar, and construction methods and applications thereof

Abstract

The present invention provides a mutant strain and complemented strain of Aeromonas dhakensis with a surface polysaccharide synthesis gene deletion, and a construction method and application thereof, wherein the Aeromonas dhakensis is A.dhakensis C160501, and the surface polysaccharide synthesis gene is one or more of ugd, ugd2 and cap1J genes, the nucleotide sequence of the ugd gene is shown in SEQ ID NO.1, the nucleotide sequence of the ugd2 gene is shown in SEQ ID NO.2, and the nucleotide sequence of the cap1J gene is shown in SEQ ID NO.3. By knocking out the relevant genes, a gene-deficient strain of Aeromonas dhakensis from crocodile is constructed, and the effects of different gene deletions on the Aeromonas dhakensis bacteria are compared and analyzed, so as to provide new ideas for the prevention and treatment of Aeromonas dhakensis-related diseases, and provide new targets and ideas for the development of drugs and vaccines.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and relates to a mutant strain and a complemented strain of Aeromonas dakar with a surface polysaccharide synthesis gene deletion, and a construction method and application thereof. Background Art

[0002] Aeromonas dhakaensis belongs to the phylum Pseudomonadota, class Gammaproteobacteria, order Aeromonadales, family Aeromonadaceae, and genus Aeromonas. The bacterium was first isolated from stool samples of children with diarrhea in Dhaka, the capital of Bangladesh, between 1993 and 1994. It was once classified as Aeromonas hydrophilasp.dhakensis or was considered a new species of Aeromonas and named Aeromonasaquariorum. It was officially confirmed as Aeromonas dhakaensis in 2013. Standard strain of Aeromonas dhakaensis (CIP 107500 T ) has flagella and motility, can be cultured at 28-41°C, and will not grow below 10°C. The bacteria are mainly distributed in tropical and subtropical areas, and are classified as Class III in the 2023 List of Pathogenic Microorganisms Transmitted in Humans.

[0003] According to the data in the KEGG (Kyoto Encyclopedia of Genes and Genomes) database (2024 / 3 / 10), the synthesis of UDP-glucuronic acid (UDP-GlcA) in Aeromonas dhakensis KN-Mc-6U21 is only related to UDP-glucuronic acid dehydrogenase (UDP-glucose 6-dehydrogenase, ugd gene encoding related proteins) and UDP-glucuronate 4-epimerase (UDP-glucuronate 4-epimerase, also known as UDP-glucuronic acid 4-epimerase, encoded by cap1J gene related proteins). UDP-glucuronic acid dehydrogenase (ugd) is an oxidoreductase that catalyzes the conversion of UDP-glucose (UDP-Glc) to produce UDP-GlcA. Uridine diphosphate glucuronide epimerase (cap1J) is a short-chain dehydrogenase / reductase that catalyzes the mutual conversion of UDP-GlcA and UDP-GalA. As early as 1999, studies on cap1J in type I Streptococcus pneumoniae were reported. This gene is related to the synthesis of bacterial capsular polysaccharides. Later, in related studies on Klebsiella pneumoniae, it was expressed with the symbol Gla kp It was shown that this gene is related to the biosynthesis of the core polysaccharide of LPS and plays a potentially important role in the stability of the bacterial outer membrane.

[0004] At present, there are no reports on the ugd gene and cap1J gene of Aeromonas dakar at home and abroad. Therefore, it is of great significance to study the related genes of Aeromonas dakar. Summary of the invention

[0005] The purpose of the present invention is to provide a mutant strain and a complemented strain of the surface polysaccharide synthesis gene of Aeromonas dakar, as well as a construction method and application thereof, to construct a gene-deficient strain of Aeromonas dakar from crocodile origin by knocking out relevant genes, to compare and analyze the effects of different gene deletions on the Aeromonas dakar bacteria, to provide new ideas for the prevention and treatment of Aeromonas dakar related diseases, and to provide new targets and ideas for the development of drugs and vaccines.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] The invention provides a mutant strain of Aeromonas dhakensis with a surface polysaccharide synthesis gene deletion. The Aeromonas dhakensis is A. dhakensis C160501, the surface polysaccharide synthesis gene is one or more of ugd, ugd2 and cap1J genes, the nucleotide sequence of the ugd gene is shown in SEQ ID NO.1, the nucleotide sequence of the ugd2 gene is shown in SEQ ID NO.2, and the nucleotide sequence of the cap1J gene is shown in SEQ ID NO.3.

[0008] The present invention also provides a method for constructing a mutant strain of Aeromonas dakar with a surface polysaccharide synthesis gene deletion, comprising:

[0009] Constructing the ugd2 gene recombinant suicide plasmid pRE112-△ugd2 by seamless cloning, and conjugating the Aeromonas dakar strain with E. coli WM3064 containing pRE112-△ugd2 to obtain the △ugd2 strain; and / or

[0010] The cap1J gene recombinant suicide plasmid pRE112-△cap1J was constructed by double restriction digestion method, and the Aeromonas dakar strain was conjugated with E. coli WM3064 containing pRE112-△cap1J to obtain the △cap1J strain.

[0011] Preferably, the seamless cloning method is used to construct the ugd2 gene recombinant suicide plasmid pRE112-△ugd2, which includes: using the genomic DNA of Aeromonas dakar as a template, using two pairs of primers ugd2-up-F / R and ugd2-down-F / R to amplify the upstream and downstream homologous arms of the ugd2 gene respectively; extracting pRE112 plasmid DNA, using primers reverse pRE112-F / R to perform PCR amplification to linearize the plasmid; using the linearized fragment of the pRE112 plasmid as a template, ugd2-up and ugd2-down as primers to perform a multi-fragment recombination reaction, and transforming; the primer sequences are as follows:

[0012] ugd2-up-F:TTCCCGGGAGAGCTCGCATATGACGCATTAATGAAATGC,

[0013] ugd2-up-R: TGCAGGTATTATTTCACCACAATGTAATATTAAACAAATAAATACTTAG;

[0014] ugd2-down-F:TGAAAATAATACCTGCAATAGTGTATGGGGC,

[0015] ugd2-down-R:CAAGCTTCTTCTAGAAGCGTTCAATCACCAGCC.

[0016] Preferably, the double enzyme digestion method is used to construct the cap1J gene recombination suicide plasmid pRE112-△cap1J, which includes: using the genomic DNA of Aeromonas dakar as a template, using two pairs of primers cap1J-up-F / R and cap1J-down-F / R to amplify the upper and downstream homologous arms of cap1J respectively; using the cap1J upper and downstream homologous arms as templates, first performing 10 cycles of amplification without adding primers, and then adding primers cap1J-up-F and cap1J-down-R for 25 cycles of amplification; double enzyme digestion of the pRE112 plasmid and the cap1J upper and downstream homologous arms, ligation, and transformation; the primer sequences are as follows:

[0017] cap1J-up-F:AACGAGCTCGGCATAGAAGGGCAGGTTCATG,

[0018] cap1J-up-R:GGCTGGGGTCCTGTGCAG;

[0019] cap1J-down-F: TGCACAGGACCCCAGCCCCATCCCGACCGGACACT,

[0020] cap1J-down-R: AGGCTCTAGACGACATGGATTCTTCTCCTGTTGGG.

[0021] Preferably, the construction method further comprises: using E. coli WM3064 containing pRE112-△cap1J as a donor bacterium and a mutant strain △ugd lacking the ugd gene as a recipient bacterium for conjugation transfer, screening strains carrying the plasmid by a primary homologous recombination, and then reversely screening strains without the plasmid by a secondary homologous recombination, and identifying to obtain the △ugd△cap1J strain.

[0022] Preferably, the construction method further comprises: respectively conjugating strains △ugd and △cap1J with E. coli WM3064 containing pRE112-△ugd2, and verifying to obtain △ugd△ugd2 and △cap1J△ugd2 strains.

[0023] More preferably, the construction method further comprises: combining the strain △ugd△ugd2 with E. coli WM3064 containing pRE112-△cap1J, and verifying to obtain the △ugd△cap1J△ugd2 strain.

[0024] The present invention further provides a method for constructing a complemented strain of the above mutant strain, comprising:

[0025] 1) Use primer seamless ugd-F / R to amplify the target fragment. The primer sequence is as follows:

[0026] Seamless ugd-F: ACACAGGAAACAGCTATGAACATTACTGTATTTGGAAGTGGCTACGTGG,

[0027] Seamless ugd-R: ACAAAATATTAACGCTTATTTCATTACCGATTCGCCCCG;

[0028] Use primer seamless cap1J-F / R to amplify the target fragment. The primer sequence is as follows:

[0029] Seamless cap1J-F:ACACAGGAAACAGCTATGAAGTATCTGGTCACCGGCG,

[0030] Seamless cap1J-R:ACAAAATATTAACGCCTACTCCAGCTCAGCGGGTTG;

[0031] Use primer seamless ugd2-F / R to amplify the target fragment. The primer sequence is as follows:

[0032] seamless ugd2-f:ACACAGGAAACAGCTATGAATATTACAATTGCAGGCACC,

[0033] seamless ugd2-r:ACAAAATATTAACGCTTAGTCGGATCCGAATAGATCCC;

[0034] 2) Activate E. coli DH5α carrying pBBR1MCS-2 plasmid, extract plasmid DNA, and use primers pBBR1MCS-2-F / R to amplify in the reverse direction to linearize the plasmid. The primer sequences are as follows:

[0035] Reverse pBBR1MCS-2-F: AGCTGTTTCCTGTGTGAAATTG,

[0036] Reverse pBBR1MCS-2-R: GCGTTAATATTTTGTTAAAATTCGCGT;

[0037] 3) The linearized fragment of pBBR1MCS-2 plasmid was subjected to single-fragment recombination reaction with the target gene fragment, and then transformed to obtain the complemented plasmids pBBR1MCS-2-△lacZα::ugd, pBBR1MCS-2-△lacZα::cap1J, and pBBR1MCS-2-△lacZα::ugd2;

[0038] 4) The activated △ugd, △cap1J, and △ugd2 were respectively conjugated with E. coli WM3064 carrying pBBR1MCS-2-△lacZα::ugd, pBBR1MCS-2-△lacZα::cap1J, and pBBR1MCS-2-△lacZα::ugd2 plasmids for identification.

[0039] The present invention further provides the use of the mutant strain in changing the virulence of bacteria and the sensitivity to polymyxin B.

[0040] Preferably, the above application includes the application of a mutant strain in which ugd, ugd2 and cap1J genes are simultaneously deleted as a live attenuated vaccine.

[0041] The beneficial effects of the present invention are:

[0042] The present application uses homologous recombination to successfully construct six related gene deletion mutant strains of Aeromonas dakar, namely △cap1J, △ugd2, △ugd△cap1J, △cap1J△ugd2, △ugd△ugd2, and △ugd△cap1J△ugd2; and uses the constitutive plasmid pBBR1MCS-2 to successfully construct three gene-complemented strains of the ugd gene and the cap1J gene: C△ugd, C△cap1J, C△ugd2 and four strains with empty plasmids (unedited pBBR1MCS-2): C4-1-pBBR1MCS-2, △ugd-pBBR1MCS-2, △cap1J-pBBR1MCS-2, and △ugd2-pBBR1MCS-2, and conducts phenotypic studies on the related strains and immune protection tests on zebrafish.

[0043] The results showed that Aeromonas dhaka also had a microcapsule structure when cultured normally on LB agar medium. When the ugd, cap1J, and ugd2 genes of the strain were deleted, the bacteria still retained the capsule structure, and the cell wall thickness did not change significantly. The deletion of these three genes did not cause Aeromonas dhaka to show visible self-agglutination. Compared with the wild-type strain, the hemolytic activity and hydrogen peroxide resistance of the gene-deficient strains did not change significantly; all ugd and ugd2 gene-deficient strains had increased sensitivity to polymyxin B, among which △ugd△ugd2 and △ugd△cap1J△ugd2 had a 64-fold increase in sensitivity to polymyxin B sulfate; △ugd, △ugd△ugd2, and △ugd△cap1J△ugd2 had enhanced biofilm formation ability, weakened clustering motility, and enhanced extracellular protease activity.

[0044] All ugd2 gene deletion strains except △ugd△ugd2 had reduced toxicity to zebrafish compared with wild-type strains, among which △ugd△cap1J△ugd2 had the largest decrease, which was 4.86 times. 4 After two intraperitoneal inoculations with a dose of CFU / fish, the relative immune protection rate reached 64% compared with the PBS group, which was better than that of the 2.42×10 6 The dose of CFU / fish was used for two immersion immunizations.

[0045] The deletion of ugd, cap1J, and ugd2 genes can change the virulence of the bacteria and its sensitivity to polymyxin B, which can provide ideas for the treatment of drug-resistant bacteria and the development of targeted drugs, and can provide a reference for the study of the pathogenic mechanism of Aeromonas dakar and the development of related vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 Partial information about the ugd gene in the whole genome analysis results of Aeromonas dakar C4-1.

[0047] Figure 2 Results of ugd2 gene comparison analysis. (A). Similar sequences of ugd2 genes between Aeromonas dhakaensis (GenBank: CP121800.1) and C4-1 and translation results of ugd2 gene sequences (all 6 frames); (B). Comparison results of ugd gene of KN with ugd and ugd2 genes of C4-1 (blue indicates consistency, yellow indicates conservation, and red indicates difference).

[0048] Figure 3Analysis results of ugd and ugd2 gene clusters. (A) Annotation results of C4-1 ugd gene cluster; (B) Annotation results of A. veronii B565 ugd2 gene cluster (partial); (C) Annotation results of C4-1 ugd2 adjacent genes. If there is no gene name for the related gene, it is annotated with the protein name. sigma-54-dependentFis familytranscriptional regulator: sigma54-dependent transcription initiation protein; fkpA: encoding FKBP-typepeptidyl-prolyl cis-trans isomerase, which can accelerate protein folding; hypotheticalprotein: hypothetical protein; slyX: unknown function; slyD: peptidyl-prolyl isomerase, which can accelerate protein folding; DNA-bindingprotein: DNA-binding protein; cheV: related to the chemotaxis system; hydrolase: hydrolase; arnA, arnB, arnC, arnD, arnE, arnF, arnT: related to LPS modification; prkB: ribulose kinase; DUF4136 domain-containingprotein: DUF4136 domain-containing protein, unknown function. sugartransporter protein (BexC_CtrB_KpsE familyprotein): polysaccharide membrane transport protein, may be related to the export of cell wall, plasma membrane and capsule polysaccharides; Glycosyltransferase: glycosyltransferase; galU: UDP-glucose pyrophosphorylase (UDP-glucosepyrophosphorylase).

[0049] Figure 4 Comparison results of cap1J gene encoding proteins of C4-1 and KN (98.82% consistency), amino acid comparison results marked in blue for consistency, yellow for conservation, and red for difference.

[0050] Figure 5The annotation results of C4-1 cap1J gene cluster information are as follows: iron-regulated protein: iron-regulated lipoprotein; cysteine ​​hydrolase: cysteine ​​hydrolase; hypothetical protein:; hutZ, hutX: heme utilization protein; hmuT: heme transport system substrate binding protein; hmuU: heme transport system permeabilization protein; hmuV: heme transport system ATP binding protein; ABC transporterubstrate-binding protein: polar amino acid transport system substrate binding protein; lytic transglycosylase: lytic transglycosylase; mut: adenylate homocysteine ​​nucleotidase; Crp / Fnr family transcriptional regulator: Crp / Fnr family transcriptional regulator, which may bind to cyclic nucleotides; ettA: energy-dependent translation throttling protein; pbuG: adenine / guanine / hypoxanthine permease; djlA: DNAJ-like molecular chaperone protein; murU: mannose-1-phosphate guanylyltransferase.

[0051] Figure 6 The present invention discloses the position distribution of ugd, ugd2 and cap1J genes in the genome of Aeromonas dakar C4-1.

[0052] Figure 7 Schematic diagram of the cap1J upstream and downstream homology arm fusion fragments of the present invention.

[0053] Figure 8 Plasmid maps of pRE112-△cap1J and pRE112-△ugd2 of the present invention.

[0054] Fig. 9Construction and verification of the suicide recombinant plasmid of the present invention. (A). Amplification of the upstream and downstream homology arms of cap1J and the PCR amplification results of the upstream and downstream homology arms overlap extension (1: cap1J homology arm fusion fragment; 2: cap1J upstream homology arm fragment; 3: cap1J downstream homology arm fragment); (B). Double enzyme digestion results of plasmid pRE112 and cap1J homology arm fusion fragment (1: plasmid digestion product; 2: untreated plasmid pRE112, hereinafter referred to as the original plasmid; 3. homology arm fusion fragment digestion product); (C). Positive recombinant transformation plasmid pRE112 - Screening of △cap1J (1: pRE112 original plasmid; 2-4: recombinant transformants, of which 3 and 4 are negative); (D). Reverse amplification of linearized fragment of plasmid pRE112; (E). Amplification of upstream and downstream homology arms of ugd2 (1: upstream homology arm of ugd2; 2: downstream homology arm of ugd2); (F). Verification of positive recombinant transformation plasmid pRE112-△ugd2 (1-2: screened pRE112-△ugd2; 3: pRE112 original plasmid); M: Marker.

[0055] Fig.10 Verification results of gene deletion mutants of the present invention. Correspondence between strains and lanes: 1-3: C4-1; 4-6: △ugd; 7-9: △cap1J; 10-12: △ugd2; 13-15: △ugd△cap1J; 16-18: △cap1J△ugd2; 19-21: △ugd△ugd2; 22-24: △ugd△cap1J△ugd2; Correspondence between verified genes and lanes: Lanes No. 1, 4, 7, 10, 13, 16, 19, 22 verify whether there is ugd gene; Lanes No. 2, 5, 8, 11, 14, 17, 20, 23 verify whether there is cap1J gene; Lanes No. 3, 6, 9, 12, 15, 18, 21, 24 verify whether there is ugd2 gene; M: Marker.

[0056] Fig.11 Schematic diagram of the pBBR1MCS-2-△lacZα::mCherry plasmid of the present invention.

[0057] Fig.12The construction and verification of pBBR1MCS-2-△lacZα::mCherry of the present invention. (A). Amplification results of mCherry gene fragment; (B). Reverse amplification results of plasmid pBBR1MCS-2; (C). Screening of positive recombinant transformants (1: pBB1MCS-2 original plasmid; 2: blank control; 3-4: recombinant transformants); M: Marker; (D) Verification results of C4-1 strain containing pBBR1MCS-2-△lacZα::mCherry plasmid. Correspondence between samples and lanes: 1: original plasmid pBBR1MCS-2; 5, 9, 13: C4-1; 2, 6, 10, 14: blank control; 3-4, 7-8, 11-12, 15-16: C4-1 strain with target plasmid; Correspondence between verified genes and lanes: 1-4: mcherry; 5-8: ugd; 9-12: cap1J; 13-16: ugd2; M: Marker.

[0058] Fig.13 The present invention discloses visual differences in strains containing the mCherry gene.

[0059] Fig.14 Verification results of the gene complementation strain of the present invention. Correspondence between samples and lanes: 1: original plasmid pBBR1MCS-2; 2-5: C△ugd; 6-9: C△cap1J; 10-13: C△ugd2; Correspondence between verified content and lanes: 1, 5, 9, 13: whether the inserted target gene fragment is carried; 2, 6, 10: ugd; 3, 7, 11: cap1J; 4, 8, 12: ugd2; M: Marker.

[0060] Fig.15 The construction verification result of the strain containing the empty vector pBBR1MCS-2 of the present invention. The corresponding relationship between samples and swimming lanes: 1: original plasmid pBBR1MCS-2; 2-5: C4-1-pBBR1MCS-2; 6-9: △ugd-pBBR1MCS-2; 10-13: △cap1J-pBBR1MCS-2; 14-17: △ugd2-pBBR1MCS-2; the corresponding relationship between the verified content and the swimming lanes is as follows: 1, 5, 9, 13, 17: whether it carries pBBR1MCS-2; 2, 6, 10, 14: ugd; 3, 7, 11, 15: cap1J; 4, 8, 12, 16: ugd2; M: Marker.

[0061] Fig.16 A summary diagram of the growth curves of the strains of the present invention.

[0062] Fig.17Bacterial generation time and average growth constant analysis of the present invention. (A). Schematic diagram of calculating bacterial generation time using R language (taking single C4-1 sample data as an example); (B). Result analysis diagram of average growth constant rate of each strain, the generation time marked in the picture shall prevail in the figure, the generation time calculation marked at the top of the chart shall prevail in time point, and the marking in the picture shall prevail in selected OD value. Significance description: ns, P>0.05; *, P≤0.05; **, P≤0.01; ***, P≤0.001; ****, P≤0.0001.

[0063] Fig.18 Capsule staining results of the strains of the present invention. AO is strain C4-1, △ugd, △cap1J, △ugd2, △ugd△cap1J,

[0064] Capsule staining results of △cap1J△ugd2, △ugd2△cap1J, △ugd△cap1J△ugd2, C△ugd, C△cap1J, C△ugd2, C4-1-pBBR1MCS-2, △ugd-pBBR1MCS-2, △cap1J-pBBR1MCS-2, and △ugd2-pBBR1MCS-2.

[0065] Fig.19 Electron microscopic observation results of the bacterial cell wall structure of the present invention. (A) to (C) are the electron microscopic observation results of C4-1, △cap1J, △ugd△cap1J△ugd2 strains, a: outer membrane; b: cell wall; c: periplasm; d: cytoplasmic membrane; Bar = 100nm.

[0066] Fig. 20 The result diagram of the self-agglutination test of the strain of the present invention, the LB medium with clear liquid is the blank control.

[0067] Fig.21 Determination of biofilm of each strain of the present invention. The right figure shows the observation results before and after staining with crystal dye and dissolving with anhydrous ethanol. Significance explanation: ns, P>0.05; *, P≤0.05; **, P≤0.01; ***, P≤0.001; ****, P≤0.0001.

[0068] Fig. 22 Results of motility test of each strain of the present invention. (A): Test results of group swimming ability of experimental strains; (B): Test results of swimming ability of experimental strains. Significance description: ns, P>0.05; *, P≤0.05; **, P≤0.01; ***, P≤0.001; ****, P≤0.0001.

[0069] Fig.23Detection and analysis of extracellular protease activity of the strain of the present invention. Significance: ns, P>0.05; *, P≤0.05; **, P≤0.01; ***, P≤0.001; ****, P≤0.0001. Bar=1cm.

[0070] Fig.24 Hemolytic activity test results of the strains of the present invention. (A). Analysis of hemolytic activity differences of each strain after culturing the experimental strain for 24 hours; (B): Comparison of hemolytic activity differences of each experimental strain after culturing for 24 hours, 48 ​​hours, and 72 hours (blood plate serial number annotation: 1: C4-1; 2: △ugd; 3: △cap1J; 4: △ugd2; 5: △ugd△cap1J; 6: △cap1J△ugd2; 7: △ugd△ugd2; 8: △ugd△cap1J△ugd2; 9: C△ugd; 10: C△cap1J; 11: C△ugd2; 12: C4-1-pBBR1MCS-2; 13: △ugd-pBBR1MCS-2; 14: △cap1 J-pBBR1MCS-2; 15: △ugd2-pBBR1MCS-2. )Significance: ns, P>0.05; *, P≤0.05; **, P≤0.01; ***, P≤0.001; ****, P≤0.0001.

[0071] Fig.25 The strain H of the present invention 2 O 2 Resistance test results. Significance: ns, P>0.05; *, P≤0.05; **, P≤0.01; ***, P≤0.001; ****, P≤0.0001. Bar=1cm.

[0072] Fig.26 Minimum inhibitory concentration of polymyxin B of each strain of the present invention is detected. 1: C4-1; 2: △ugd; 3: △cap1J; 4: △ugd2; 5: △ugd△cap1J; 6: △cap1J△ugd2; 7: △ugd△ugd2; 8: △ugd△cap1J△ugd2; 9: C4-1-pBBR1MCS-2; 10: △ugd-pBBR1MCS-2; 11: △cap1J-pBB R1MCS-2; 12: △ugd2-pBBR1MCS-2; 13: C△ugd; 14: C△cap1J; 15: C△ugd2.

[0073] Fig. 27The results of the cell adhesion experiment of C4-1 and its gene deletion mutant strains of the present invention. The left figure is the statistical analysis result of colony count, and the right figure is the result of collecting the lysate from the cell culture plate after cell lysis and diluting it 10 times continuously and then spotting it on LB agar medium. Significance description: ns, P>0.05; *, P≤0.05; **, P≤0.01; ***, P≤0.001; ****, P≤0.0001.

[0074] Fig.28 The results of the sensitivity test of the strains of the present invention to the crocodile-derived antimicrobial peptides (the dilution gradient from left to right is 10 -1 Up to 10 -6 ), the left one is the sensitivity of E. coli ATCC25922 to crocodile-derived antimicrobial peptides Leucrocin I (upper) and Leucrocin II (lower); the left two are from top to bottom: C4-1, △ugd, △cap1J, △ugd2, △ugd△cap1J, △cap1J△ugd2, △ugd△ugd2, △ugd△cap1J△ugd2; the right picture is from top to bottom: C4-1-pBBR1MCS-2, △ugd-pBBR1MCS-2, △cap1J-pBBR1MCS-2, △ugd2-pBBR1MCS-2, C△ugd, C△cap1J, C△ugd2. The experimental strain part only shows the results of crocodile-derived antimicrobial peptide Leucrocin I.

[0075] Fig.29 Observation results of clinical indicators and symptoms after mice of the present invention were challenged with C4-1. (A). Changes in weight of mice within seven days after challenge with C4-1; (B). Gelatinous feces; (C). Mucus around the liver portal; (D). Bleeding in the corners of the eyes; (E). Loose feces around the liver portal. (D) and (E) are clinical symptoms after challenge with C4-1 carrying a fluorescent plasmid, which are not described in detail herein. ).

[0076] Fig.30 Clinical symptom observation results of zebrafish challenged with the experimental strain of the present invention. (A). Normal zebrafish in the PBS group; (B). The most acutely dead fish; (C). Bleeding in the pectoral fins and eyes of the fish; (D). Bleeding in the abdomen of the fish; (E). Bleeding in the brain of the fish; (F). Swelling of the abdomen of the fish; (G). Edema of the brain of the fish; (H). Bleeding in the abdomen of the fish; (I). Emaciation of the fish.

[0077] Fig.31H&E staining observation results of zebrafish pathological tissue sections of the present invention. (A) and (C) are the staining results of zebrafish intestine and liver tissue sections in the PBS group, respectively; (B) and (D) are the staining results of zebrafish intestine and liver tissue sections in the △ugd△cap1J△ugd2 group, respectively. Figure (A) and (B): Bar = 50μm; Figure (C) and (D): Bar = 20μm.

[0078] Fig.32 The zebrafish survival curve of the present invention. DETAILED DESCRIPTION

[0079] In order to explain the present invention more clearly, the present invention is further described in detail below in conjunction with embodiments and with reference to the accompanying drawings.

[0080] Example

[0081] 1. Experimental Materials

[0082] 1. Strains and plasmids: In this application, the wild strain of Aeromonas dhaka C160501 used was isolated from farmed Siamese crocodiles in Hainan Province, recorded in the literature (Pu, W., G. Guo, N. Yang, Q. Li, F. Yin, P. Wang, J. Zheng, and J. Zeng. "Three Species of Aeromonas (A. Dhaken sis, A. Hydrophila and A. Jandaei) Isolated from Freshwater Crocodiles (Crocodylus Siamensis) with Pneumonia and Sep ticemia." Lett Appl Microbiol 68, no. 3 (2019): 212-18.), and was isolated and preserved by this laboratory. E. coli WM3064 (Δasd, conjugative transfer); E. coli ATCC25922 (drug-sensitive, extracellular protease quality control strain); pRE112 suicide plasmid (sacB, Cmr); pBBR1MCS-2 (constitutive, low copy).

[0083] 2. Primers: The primers used in this experiment were designed based on the whole genome sequence of Aeromonas dakar C4-1 and in combination with the literature using Snapgene (version 6.0.2) and Primer Premier 6.0, and were sent to Beijing Qingke Biotechnology Co., Ltd. Hainan Branch for synthesis, see Table 1.

[0084] Table 1 Primers used in this application

[0085]

[0086] Note: The length of the fragment amplified by the corresponding primers is the size of the corresponding fragment on the original plasmid or strain (C4-1); when the △cap1J verification-F / R primer was used to verify the cap1J gene, there was a mixed band, so the primer n△cap1J verification-F / R was redesigned.

[0087] 3. Experimental animals and cells

[0088] Kunming mice: purchased from Guangzhou Yancheng Biological, about 3 weeks old, with unlimited supply of mouse food (Synergy Biological: SPF-grade experimental maintenance mouse food) and drinking water, and the bedding was changed every week. Toxicology experiments were conducted when they were raised to about 7 weeks of age.

[0089] Experimental zebrafish were purchased from Shanghai Experimental Zebrafish Model Center, about 4 months old, and the feces at the bottom of the tank were sucked out by a fish tank aspirator every day. The water replacement volume was about 30% of the total water volume, and the zebrafish were fed at 3% of their body weight every day (Pridgeon JW, Klesius PH. Development and efficacy of novobiocin andrifampicin-resistant Aeromonas hydrophila as novel vaccines in channel catfish and Nile tilapia [J]. Vaccine, 2011, 29 (45): 7896-7904.) (yee: a special feed for small fish, without probiotics and antibiotics). Subsequent experiments were conducted after the fish could survive stably for 14 days.

[0090] Epithelioma Papulosum Cyprinid (EPC) cells were provided by Professor Li Xuesong from the Infection and Immunity Laboratory, School of Life Sciences and Health Sciences, Hainan University.

[0091] 2. Experimental Methods

[0092] In this application, GraphpadPrism was used to analyze the experimental data. The sample analysis between the two groups was analyzed using the t-test; the inter-group statistical value of an independent variable between multiple samples was compared using the univariate method; the Mann-Whitney rank sum test was used for non-parametric tests of two independent samples. The median lethal dose was calculated using SPSS based on the Bliss method.

[0093] 2.1 Bioinformatics analysis of ugd and cap1J genes of strain C4-1

[0094] In the present invention, the nucleotide sequence of the ugd gene is shown as SEQ ID NO.1, the nucleotide sequence of the ugd2 gene is shown as SEQ ID NO.2, and the nucleotide sequence of the cap1J gene is shown as SEQ ID NO.3.

[0095] (1) Correlation analysis of the ugd gene of Aeromonas dakar C4-1

[0096] According to the results of whole-genome comparison analysis, it was found that C4-1 has two ugd genes ( Figure 1 ). After comparing the ugd2 gene sequence of C4-1 with NCBI, it was found that among all the gene sequences of Aeromonas dakar, only a fragment of the complete genome sequence of Aeromonas dakar submitted by a hospital in Taiwan, China in May 2023 (GenBank: CP121800.1) had a 76.41% consistency with the ugd2 gene sequence of C4-1. This fragment is not a complete gene (the gene is not annotated and has multiple stop codons. The fragment of the gene that can translate protein is shown in Figure 2 ).

[0097] To further understand the gene functions of ugd and ugd2 genes, the gene clusters of KN, A.hydrophilaATCC 7966, and A.veronii B565 in KEGG (SSDB Gene Cluster Search Result) were compared and the gene clusters of C4-1 related genes were drawn ( Figure 3 ). From the annotation results, it can be seen that the gene cluster where the ugd gene of C4-1 is located is mainly related to the modification of bacterial lipopolysaccharide; the genes adjacent to C4-1 ugd2 mainly encode glycosyltransferase-related proteins, and glycosyltransferase family proteins are related to the synthesis of oligosaccharides, polysaccharides and glycoconjugates, and may be involved in the synthesis of bacterial cell walls and cell membranes.

[0098] (2) Correlation analysis of the cap1J gene of Aeromonas dakar C4-1

[0099] The genome analysis results of C4-1 did not directly indicate the relevant information of cap1J. According to the sequence information provided by the KEEG website, it was confirmed that there was a cap1J gene in the C4-1 genome (protein sequence comparison with KN). The results are as follows Figure 4 . Compare the search results of Aeromonas dakar gene cluster in KEGG to draw the gene cluster related to cap1J of C4-1 ( Figure 5 ). From the annotation results, it can be seen that the C4-1 cap1J gene cluster is mainly related to heme uptake and utilization.

[0100] The location distribution of ugd, ugd2, and cap1J genes in the genome of Aeromonas dakar C4-1 is as follows Figure 6 shown.

[0101] 2.2 Activation, cultivation and identification of strains

[0102] Select the appropriate culture medium, temperature environment and culture time according to the growth of the strain and the purpose of the experiment. In the experiment, the activation of Aeromonas dakar was cultured using LB liquid / agar medium. When culturing E.coli WM3064, DAP was added (100 μL per 100 mL, 50 μg / mL). When culturing strains with pRE112 plasmid, chloramphenicol storage solution was added (100 μL per 100 mL, 25 μg / mL), and when culturing strains with pBBR1MCS-2, kanamycin storage solution was added (100 μL per 100 mL, 50 μg / mL).

[0103] Strain identification: Aeromonas dhaka was verified using primers for the three genes ugd, cap1J and ugd2 - △ugd verification, △cap1J verification (n△cap1J verification), △ugd2 verification. In this experiment, strain identification that does not require sequencing uses 2×Taq Plus Master MixⅡ (Dye Plus) or 2×Rapid Taq Master Mix for PCR reaction. Samples that require sequencing use the former for PCR reaction and will be sent to Hainan Nanshan Biotechnology Co., Ltd. for testing. 2×RapidTaqMaster Mix has a faster amplification speed. The extension step within the PCR reaction program cycle is set to (72℃, 15sec / kb). The PCR reaction system and reaction program for the relevant experiments below only show the relevant data including 2×TaqPlus Master MixⅡ.

[0104] 2.3 Construction of gene deletion mutants

[0105] (1) Construction of cap1J gene recombination suicide plasmid pRE112-△cap1J (double restriction enzyme digestion)

[0106] ① Amplification of the upstream and downstream homology arms of the cap1J gene: The activated Aeromonas dakar was inoculated into LB liquid medium, cultured overnight at 37°C and 180rpm, and the bacterial genomic DNA was extracted according to the instructions of the FastPure Bacteria DNA Isolation Mini Kit. Using the genomic DNA of C4-1 as a template, the upstream and downstream homology arms of cap1J were amplified using two pairs of primers, cap1J-up-F / R and cap1J-down-F / R. The PCR reaction system and procedure are shown in Table 2.

[0107] Table 2 PCR reaction system and procedure for cap1J upstream (downstream) homology arm amplification

[0108]

[0109]

[0110] ② Fusion of upstream and downstream homology arms (overlap extension PCR): Using cap1J upstream and downstream homology arms as templates, perform 10 cycles of amplification without adding primers, and then add primers cap1J-up-F and cap1J-down-R for 25 cycles of amplification. The PCR reaction system and procedure are shown in Table 3, and the schematic diagram of the fusion fragment is shown in Figure 7 According to the instructions of FastPure GelDNAExtraction Mini Kit, the cap1J upstream and downstream homology arm fusion fragments after electrophoresis were cut and recovered.

[0111] Table 3 Cap1J upstream and downstream homology arm overlap extension PCR reaction system and procedure

[0112]

[0113] ③ Preparation of super competent cells: follow the instructions of the super competent cell preparation kit (Biogen).

[0114] ④ Enzyme digestion and ligation: Extract the pRE112 plasmid (suicide plasmid, sacB, Cm r ). Use SacI-HF and XbaI to perform double enzyme digestion reaction on the pRE112 plasmid and the upstream and downstream homology arms of cap1J (use PCR tubes, place in a low-temperature circulating water bath, 37°C, overnight enzyme digestion). The enzyme digestion system is shown in Table 4. The next day, place the enzyme digestion system in a 65°C water bath for 20 minutes to inactivate the enzyme. After inspection by agarose gel electrophoresis, purify the product according to the instructions of the FastPure Gel DNA Extraction Mini Kit. Use T4 DNA ligase to connect the linearized plasmid pRE112 with the upstream and downstream homology arm fragments of cap1J (16°C, overnight connection). The next day, heat inactivate at 65°C for 10 minutes. The connection system is shown in Table 4. The pRE112-△cap1J plasmid after successful connection is as follows Figure 8 .

[0115] Table 4 pRE112 plasmid and homology arm fusion fragment double restriction enzyme digestion system and ligation system

[0116]

[0117] ⑤ Transformation of recombinant DNA: Follow the standard transformation steps of the super competent cell preparation kit (Sangong). Introduce the recombinant plasmid into the super competent E. coli WM3064 by heat shock. After transformation, the cultured bacterial solution is spread on LB agar medium containing chloramphenicol and DAP at three different concentrations and cultured at 37°C overnight.

[0118] ⑥ Identification and preservation of recombinant transformants: Pick a single colony, number it in sequence and store it in 20 μL sterile water (mix by blowing), take 1 μL as a template and use the outer primer pRE112-F / R of the inserted fragment on the plasmid to perform PCR identification on the recombinant transformant (1% agarose gel electrophoresis), the PCR reaction system and procedure are shown in Table 5. After screening the positive recombinant transformant, inoculate the remaining bacterial solution into liquid culture containing chloramphenicol and DAP, culture overnight at 37°C, repeat the inoculation three times to stabilize the plasmid. Extract plasmid DNA, use primers pRE112-F / R to sequence and identify the cap1J upstream and downstream homology arm fusion fragments on the plasmid (see Table 5 for PCR reaction system and procedure, amplify 30 cycles). Add the bacterial solution of the strain with correct sequencing results to a cryopreservation tube and store it at -80°C.

[0119] Table 5 PCR reaction system and procedure for colony and sequencing

[0120]

[0121] (2) Construction of ugd2 gene recombination suicide plasmid pRE112-△ugd2 (seamless cloning)

[0122] ① Amplification of the upstream and downstream homology arms of the ugd2 gene: Use two pairs of primers, ugd2-up-F / R and ugd2-down-F / R, and follow the same method as 2.3(1)①. Reaction procedure: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 55℃ (up) / 60℃ (down) annealing for 15 s, 72℃ extension for 40 s, 30 cycles; finally 72℃ extension for 5 min, and storage at 4℃.

[0123] ② Reverse amplification of pRE112 plasmid: Extract pRE112 plasmid DNA and use primers pRE112-F / R to perform PCR amplification to linearize the plasmid. The reaction system and procedure are shown in Table 6.

[0124] Table 6 Reverse PCR amplification system and procedure

[0125]

[0126] ③ Recombination reaction (seamless cloning): refer to the instructions of Universal One Step Cloning Kit to carry out multi-fragment recombination reaction (in a PCR instrument, 50°C for 10 min). The recombination reaction system is shown in Table 7. The plasmid map of pRE112-△ugd2 is shown in Figure 8 .

[0127] Table 7 Multi-fragment recombination reaction system

[0128]

[0129] ④Transformation of recombinant DNA: The method is the same as 2.3(1)⑤.

[0130] ⑤Identification and preservation of recombinant transformants: the method is the same as 2.3(1)⑥.

[0131] Plasmids pRE112-△cap1J and pRE112-△ugd2 were successfully constructed (PCR verification results were as follows Fig. 9 As shown). The sizes of the amplified fragments of the cap1J upstream and downstream homology arms are 560bp and 640bp, respectively. The size of the cap1J upstream and downstream homology arm fusion fragments is 1183bp. The sizes of the amplified fragments of the ugd2 upstream and downstream homology arms are 551bp and 548bp, respectively. The size of the plasmid pRE112 after double enzyme digestion is 5736bp. The size of the reverse amplified linearized plasmid pRE112 is 5742bp. The sizes of the positive recombinant transformants containing the cap1J and ugd2 gene upstream and downstream fusion fragments screened using primers pRE112-F / R are 1638bp and 1527bp, respectively. In this experiment, the double enzyme digestion method was used to construct the recombinant plasmid, and 4 of the 48 recombinant transformants picked were positive; the recombinant plasmid was constructed using the reverse amplification of the linearized plasmid fragment and seamless cloning method, and 7 of the 9 recombinant transformants picked were positive. The plasmid that was cultured for three generations with antibiotics and stabilized was sent to the company for sequencing. After comparison, the sequence of the inserted fragment in the plasmid was correct and no mutation occurred.

[0132] (3) Construction of △cap1J and △ugd2 related gene deletion mutants

[0133] ① Construction of △cap1J and △ugd△cap1J strains:

[0134] A. Conjugation transfer, screening of strains carrying plasmids (one homologous recombination): strains C4-1, Δugd (C4-1 knocked out ugd gene, the specific construction method is disclosed in CN117535214A, Aeromonas dakar ugd and phoB gene single and double deletion mutants, complemented strains and their construction methods and applications) and E. coli WM3064 containing pRE112-Δcap1J were activated, and 50 μL of each was inoculated into LB liquid culture medium, and cultured at 37°C with shaking until OD 600 ≈0.5 (C4-1 and △ugd require about 2 hours, and E.coliWM3064 requires 4 to 5 hours). Take 3×2mL of E.coli WM3064 (donor bacteria), 1mL of C4-1 and △ugd (recipient bacteria) and put them into a 1.5mL centrifuge tube. Centrifuge at 5000rpm for 5 minutes and discard the supernatant. Add fresh LB liquid culture medium, mix well by pipetting, and centrifuge at 5000rpm for 5 minutes, and discard the supernatant (this step is for washing to wash away the antibiotics in the original culture medium). Repeat this step twice, and keep a small amount of supernatant culture medium for the last time. There is about 100μL of supernatant left in 1 tube of donor bacteria and 3 tubes of recipient bacteria. Mix E.coli WM3064 with C4-1 and △ugd respectively at a ratio of donor bacteria: recipient bacteria = 1:3, and then add them dropwise to LB agar culture medium containing DAP. Culture upright at 37℃ for 24h. Use a spreader and a small amount of LB liquid medium to scrape the bacterial moss on the plate and collect it in a 1.5 mL centrifuge tube. Centrifuge at 5000 rpm for 5 minutes, discard the supernatant, wash twice (to remove DAP), and resuspend the precipitated bacteria in 1 mL of LB liquid medium as the stock solution. Take 100 μL of the stock solution and add 900 μL of fresh LB liquid to dilute to 10 -1 , and then dilute to 10 -2 100 μL of each of the original solution and the diluted solution was spread on LB plates containing chloramphenicol and cultured at 37°C overnight.

[0135] B. Reverse screening of strains without plasmids (secondary homologous recombination): Use an inoculation loop to pick up a single colony on the LB plate (containing chloramphenicol), spot it on the LB plate containing chloramphenicol, and streak it on a 20% sucrose plate (culture at 30°C for 18-24 hours). Incubate the LB plate at 37°C overnight and store it in a 4°C refrigerator for later use: If the corresponding gene deletion strain is not screened out from the sucrose plate, streak it on the sucrose plate again.

[0136] C. Screening and preservation of gene-deficient strains: Pick a single colony, number it in sequence and store it in 20 μL sterile water (mix by blowing), take 1 μL as a template and use △cap1J verification-F / R to perform PCR identification on the strain (1% agarose gel electrophoresis), the PCR reaction system and program are the same as Table 5 (the extension time is set to 2 minutes). After the gene-deficient strain is screened, the remaining bacterial liquid is spread on LB agar medium (purification to avoid a trace of wild-type strain mixed in a single colony), and a single colony is selected again for PCR identification, and this step is repeated twice. The purified strain is inoculated into LB liquid culture medium and cultured overnight at 37°C. Extract bacterial genomic DNA, use △cap1J verification-F / R primers for detection sequencing (see Table 5 for reaction system and program settings, set 30 cycles), use △ugd verification-F / R, △cap1J verification-F / R, △ugd2 verification-F / R to verify the strain, and the reaction system and program are shown in Table 8. The strains with correct verification results were stored in a -80°C ultra-low temperature refrigerator.

[0137] Table 8 PCR reaction system and procedure for strain verification

[0138]

[0139] ② Construction of △ugd2, △ugd△ugd2, △cap1J△ugd2 strains: strains C4-1, △ugd and △cap1J were joined with E. coli WM3064 containing pRE112-△ugd2, and primers △ugd2-F / R were used to screen gene deletion mutants (PCR extension time was set to 2 minutes), and △ugd-F / R, △cap1J-F / R, and △ugd2-F / R were used to verify the strains. The method is the same as 2.3(3)①.

[0140] ③ Construction of △ugd△cap1J△ugd2 strain: The strain △ugd△ugd2 was conjugated with E. coli WM3064 containing pRE112-△cap1J, and the gene deletion mutant was screened using △cap1J verification-F / R (PCR extension time was set to 2 minutes), and the strain was verified using △ugd verification-F / R, △cap1J verification-F / R, and △ugd2 verification-F / R. The method is the same as 2.3(3)①.

[0141] The verification primers of ugd, cap1J, and ugd2 genes were designed outside the upstream and downstream homology arms of the relevant genes. When the verification primers were used for verification, the fragment size of the amplified product of the ugd gene before knockout was 3437bp, and the fragment size after knockout was 2090bp; the fragment size of the amplified product of the cap1J gene before knockout was 2430bp, and the fragment size after knockout was 1410bp; the fragment size of the amplified product of the ugd2 gene before knockout was 2497bp, and the fragment size after knockout was 1330bp.

[0142] The verification results of screening △cap1J, △ugd△cap1J, △ugd2, △ugd△ugd2, △cap1J△ugd2, and △ugd△cap1J△ugd2 strains in sequence are not shown here one by one. When picking single colonies for secondary recombination, there is at least one positive strain (target gene deletion strain) in 20 single colonies and at most one positive strain in 200 single colonies. After purifying the screened strains twice, the genomic DNA was extracted and sequenced for verification. After comparison, the sequences of the relevant fragments were correct. The PCR verification results for the construction of all gene deletion strains are shown as follows. Fig.10 As shown, the electrophoresis results of the PCR products proved that the deletion mutation of the target gene had been successfully completed and the desired gene deletion mutant strain had been successfully constructed.

[0143] 2.4 Construction of complementation strains

[0144] (1) Construction of complement expression plasmid pBBR1MCS-2-△lacZα::mCherry

[0145] Insert the mCherry gene fragment into the plasmid that will be used to construct the complementing plasmid to verify whether the inserted gene fragment can be expressed:

[0146] ① Amplification of target gene: Activate E. coli DH5α carrying mCherry gene plasmid, extract plasmid DNA, and use primers seamless mCherry-F / R to amplify the mCherry gene fragment. The PCR reaction system and procedure are shown in Table 9.

[0147] Table 9 Target gene amplification PCR reaction system and procedure

[0148]

[0149] ② Reverse amplification of pBBR1MCS-2 plasmid: Activate E. coli DH5α carrying pBBR1MCS-2 plasmid and extract plasmid DNA using a kit. Use primers reverse pBBR1MCS-2-F / R for PCR amplification (set annealing temperature to 55°C and extension time to 23 seconds) to linearize the plasmid. Refer to 2.3(2)② for the method.

[0150] ③ Recombination reaction: Refer to the instructions of ClonExpress Ultra One Step Cloning Kit for single fragment recombination reaction (plasmid linearized fragment: 96.2ng, target fragment 28.44ng, in PCR instrument, 50℃ for 5min), the recombination reaction system is shown in Table 10. The schematic diagram of the recombinant plasmid is shown in Fig.11 .

[0151] Table 10 Single fragment recombination reaction system

[0152]

[0153] ④ Transformation of recombinant DNA: Introduce the recombinant plasmid into E. coli WM3064 super competent cells according to the procedures of the super competent cell preparation kit. Spread the cultured bacterial liquid after transformation on LB agar medium containing kanamycin and DAP at three different concentrations and culture at 37°C overnight.

[0154] ⑤ Identification and preservation of recombinant transformants: Pick a single colony, number it in sequence and store it in 20 μL sterile water (mix by blowing), take 1 μL as a template and use the outer primer pBBR1MCS-2-F / R of the inserted fragment on the plasmid to perform PCR identification on the recombinant transformant. The PCR reaction system and procedure are shown in Table 5. After screening the positive recombinant transformant, inoculate the remaining bacterial solution into liquid culture containing kanamycin and DAP, culture overnight at 37°C, and repeat the inoculation three times to stabilize the plasmid. Extract plasmid DNA, and use primer pBBR1MCS-2-F / R to sequence and identify the target gene fragment on the plasmid (see Table 5 for PCR reaction system and procedure, extension time 1.4 minutes, amplification 30 cycles). Add the bacterial solution of the strain with correct sequencing results to a cryopreservation tube and store it at -80°C.

[0155] ⑥ Expression verification of inserted gene: C4-1 carrying pBBR1MCS-2-△lacZα::mCherry plasmid was inoculated into LB liquid culture medium and cultured at 37℃ overnight with shaking. 600 = 0.5, then add 2 μL of IPTG (50 mg / mL) and continue culturing. The other group does not add IPTG. Centrifuge at 5000 rpm for 5 minutes, collect the bacteria into a 1.5 mL centrifuge tube, and wash with PBS three times. Use PBS as a blank control, and C4-1 containing pBBR1MCS-2-△lacZα::mCherry as an experimental group. Take 200 μL of each and add it to a 96-well plate, with 3 replicates per group. Use a full-function microplate reader to measure OD 600The concentration of bacterial solution at 570nm was measured, and the fluorescence intensity was detected by 570nm excitation light and 610nm emission light. GraphPadprism was used to analyze the C4-1 frozen samples (-20℃) cultured with / without IPTG using the Mann-Whitney U test. After confirming that the target fragment inserted in the plasmid can be expressed, the remaining complementing plasmids were constructed in the same way.

[0156] The size of the amplified product of the mCherry gene fragment was 741bp, and the size of the reverse amplified fragment of plasmid pBBR1MCS-2 was 4782bp. The verification primers were designed outside the insertion target gene. The size of the amplified product without the inserted fragment was 969bp; the size of the amplified product with the mCherry gene segment was 1314bp. All 9 recombinant transformants were positive. The PCR verification results are as follows Fig.12 As shown in (A)-(C), the sequencing verification analysis results were correct.

[0157] The successfully constructed E. coli WN3064 carrying pBBR1MCS-2-△lacZα::mCherry plasmid was combined with the C4-1 strain. The strain screening and verification results were as follows Fig.12 (D) as shown.

[0158] The strain carrying the pBBR1MCS-2-△lacZα::mCherry plasmid was screened out and enriched with C4-1, and the expression of the inserted target gene (mCherry) was verified by comparing the fluorescence intensity differences of the strains. The results are shown in Table 11.

[0159] Table 11 Fluorescence intensity analysis results

[0160]

[0161] PBS solution has no fluorescence, while C4-1 with plasmid pBBR1MCS-2-△lacZα::mCherry has fluorescence. According to the Mann-Whitney rank sum test, there was no significant difference in fluorescence intensity between frozen samples C4-1 and C4-1(IPTG) (P=0.1000). This indicates that the constructed plasmid can express the target gene fragment inserted in the plasmid in the bacteria without adding IPTG. The higher fluorescence intensity of frozen samples than that of fresh samples may be related to the fact that fresh samples are viable bacteria and frozen samples are stored at -20℃ for a long time, resulting in a large amount of protein exposure in the cells.

[0162] Aeromonas dakar containing / without mCherry were streaked on LB agar plates. According to the changes in fluorescence intensity of the strains carrying the mCherry gene fragment plasmid and the color changes of the strains under naked eye observation, the strains from left to right are C4-1 (A), C4-1-pBBR1MCS-2 (B), and C4-1-pBBR1MCS-2-△lacZα::mCherry (C). The strain containing the mCherry plasmid is reddish in color. Fig.13 It can be confirmed that the pBBR1MCS-2 plasmid itself carries a constitutive promoter and can be used to construct a complementing strain.

[0163] (2) Construction of complementation plasmids pBBR1MCS-2-△lacZα::ugd, pBBR1MCS-2-△lacZα::cap1J, and pBBR1MCS-2-△lacZα::ugd2

[0164] Use primers seamless ugd-F / R, seamless cap1J-F / R, and seamless ugd2-F / R to amplify the target fragments respectively. Adjust the reaction procedure and system appropriately according to the primers and the length of the target fragment. The method is the same as 2.4(1)①-⑤.

[0165] (3) Construction of complementation strains C△ugd, C△cap1J, and C△ugd2

[0166] After activation, the cells were grown to OD 600 △ugd, △cap1J, and △ugd2, which are approximately equal to 0.5, were conjugated with E. coli WM3064 carrying pBBR1MCS-2-△lacZα::ugd, pBBR1MCS-2-△lacZα::cap1J, and pBBR1MCS-2-△lacZα::ugd2 plasmids (donor bacteria: recipient bacteria = 1:3), and added dropwise to LB agar medium containing DAP. Incubate at 37°C for 24 hours, collect the bacterial lawn on the plate and wash it three times with fresh LB liquid medium. Resuspend the precipitated bacteria in 1 mL of LB liquid medium as the stock solution, and dilute it 10 times to 10 -3 From 10 -1 , 10 -2 , 10 -3 100 μL of each dilution was spread on an LB plate containing kanamycin and cultured at 37°C overnight.

[0167] Pick a single colony, use the outer primer pBBR1MCS-2-F / R of the inserted fragment on the plasmid to perform colony PCR to verify whether it carries the plasmid (the PCR reaction system and program are appropriately adjusted according to Table 5), and use the identification primer of the strain to verify the strain (the PCR reaction system and program are appropriately adjusted according to Table 7). Passage the positive strain in LB liquid medium containing kanamycin for 3 times, extract the plasmid DNA and send it to the detection sequence. After the plasmid and strain are identified, store the strain in an ultra-low temperature refrigerator.

[0168] When using the verification primer pBBR1MCS-2-F / R for verification, the amplified size of the original plasmid target fragment was 969bp; the amplified size of the C△ugd target fragment was 1950bp; the amplified size of the C△cap1J target fragment was 1623bp; and the amplified size of the C△ugd2 target fragment was 1770bp. The construction process of the plasmid and the screening results of the positive recombinant transformants are not shown here one by one. The PCR verification results of the successful construction of each target gene complementation strain are shown in the figure below. Fig.14 shown.

[0169] 2.5 Construction of strains containing empty vectors

[0170] C4-1, △ugd, △cap1J, and △ugd2 were respectively joined with E. coli WM3064 carrying the pBBR1MCS plasmid using the same method as 2.4 (5). Fig.15 ) and sequencing verification, the C4-1 strain containing the empty vector was successfully constructed.

[0171] 2.6 Determination of the standard curve of C4-1 strain

[0172] Referring to the method of Wang Xiaoxu et al. (Wang Xiaoxu, Xu Feng, Shen Liping, et al. Spectrophotometric determination of Streptococcus suis suspension concentration [J]. Shanghai Animal Husbandry and Veterinary Newsletter, 2017 (5): 40-41.), 500 μL of activated C4-1 was inoculated into 50 mL of LB liquid culture medium and cultured at 37°C overnight. 8 mL of bacterial solution was centrifuged at 5000 rpm for 5 min, the bacteria were collected and washed 3 times with PBS. The bacteria were resuspended in 4 mL of PBS and mixed thoroughly. PBS was used as a blank control to detect OD 600 , take 2 mL of concentrated bacterial solution and adjust OD 600 Dilute the remaining 2 mL of concentrated bacterial solution in the same way in the clean bench, mix well (take out 2.5 mL each and use a spectrophotometer to further confirm the OD 600 100 μL of bacterial solution at each OD value was taken and diluted 10 times to 10 -6 . Take 10 respectively -4 -10-6 The bacterial solution was spread on 3 LB agar media (100 μL / plate), cultured at 37°C overnight, and the plates with colony counts between 20 and 300 were counted. The bacterial solution concentrations corresponding to different OD values ​​were calculated based on the dilution.

[0173] 2.7 Strain phenotypic analysis

[0174] (1) Determination of strain growth curve

[0175] All strains (C4-1, △ugd, △cap1J, △ugd2, △ugd△cap1J, △cap1J△ugd2, △ugd2△cap1J, △ugd△cap1J△ugd2, C△ugd, C△cap1J, C△ugd2, C4-1-pBBR1MCS-2, △ugd-pBBR1MCS-2, △cap1J-pBBR1MCS-2, △ugd2-pBBR1MCS-2, hereinafter referred to as all strains or strains) were activated on LB agar medium, inoculated into 5 mL of liquid medium, and cultured overnight at 37°C (180 rpm). Fresh LB medium was used to adjust the OD 600 The adjusted bacterial solution was added to 200 μL fresh LB liquid medium (using a 96-well plate) at 1% of the adjusted bacterial solution. No bacteria were inoculated in the blank control. Three parallel cultures were cultured at 37°C with shaking. The OD of the bacterial solution was detected every 1 hour using an ELISA reader. 600 , until 24h of culture, after 24h of culture, the OD of each strain 600 There are some differences ( Fig.16 ). Compared with the C4-1 strain, the OD of △ugd△ugd2 in the gene deletion strain 600 The measurement results were significantly higher than those of C4-1 (P≤0.0001); they were △ugd△cap1J△ugd2, △ugd2, △cap1J△ugd2, △cap1J (P≤0.0001). However, there was no significant difference between △ugd and C4-1. The OD of the strain carrying plasmid pBBR1MC-2 was measured after 24 hours of culture. 600 Both were higher than those of strains not carrying plasmids (such as △ugd and C△ugd).

[0176] The offline data were analyzed, and the growth curves of each strain were plotted using R language and the generation time was calculated (https: / / www.cnblogs.com / Xeonilian / p / growth-curve-specific-growth-rate-generation-time.html.), see Fig.17The results showed that under non-restrictive conditions, the relevant gene deletion, complementation and introduction of empty plasmid did not significantly affect the growth rate of the strain compared with the C4-1 strain.

[0177] (2) Bacterial capsule staining

[0178] Refer to the method of Zhang Lixia et al. (Zhang Lixia, Murcher, Zhang Lihua. Comparison of the method of cleaning slides with detergent and potassium dichromate cleaning solution [J]. Chinese and Foreign Medical Treatment, 2007 (21): 39.) to treat the slides. Soak the slides in a cleaning solution containing detergent, wipe the surface of the slides with gauze, rinse them thoroughly with tap water, rinse them with deionized water three times, dry them in a 60°C oven, and soak them in 95% ethanol for later use. Before capsule staining, take out the slides and dry them with an alcohol lamp, and use them after cooling.

[0179] All the revived strains were inoculated on LB solid agar medium, BHI agar medium, sheep blood agar plate, and skim milk agar plate, and the single colonies grown in the above culture media were stained using the Anthony's capsule staining procedure.

[0180] Capsule staining showed that all strains grown on LB solid agar medium, BHI agar medium, sheep blood agar plate, and skim milk agar plate had capsule structures. The capsule area of ​​all strains was measured by Image J software and found that the thickness of the capsule was less than 0.2 μm, which was a microcapsule. The capsule staining results are shown in Fig.18 There was no significant difference in the capsule structure of each strain, and the deletion of ugd gene and cap1J gene had no significant effect on the capsule structure.

[0181] (3) Transmission electron microscopy observation of bacterial cell wall

[0182] Three strains of bacteria, C4-1, △cap1J, △ugd△cap1J△ugd2, were selected to observe the differences in bacterial membranes: fresh bacterial samples were centrifuged at 4°C, 3000rpm for 5 minutes, washed twice with PBS, and then fixed with 2.5% glutaraldehyde electron microscope fixative precooled at 4°C. The samples were then fixed with 1% natriuretic acid solution for 1-2 hours. Rinse three times with 0.1M phosphate buffer PB (pH7.4). Dehydrate by gradient, and finally dehydrate twice with 100% acetone. After infiltration and embedding, ultrathin sections were performed, stained with uranyl acetate for 8-15 minutes, lead citrate for 5-10 minutes, and observed with a transmission electron microscope after drying.

[0183] Visual observation showed no significant difference among the three strains ( Fig.19The thickness of the bacterial cell wall was measured using software (the results are shown in Table 12). Using one-way analysis of variance, there was no statistical difference in the thickness of the cell wall among the three (P=0.3934).

[0184] Table 12 Measurement results of bacterial cell wall thickness

[0185]

[0186] Note: The average thickness measurement results are mean ± standard deviation.

[0187] The experimental results show that the deletion of ugd, cap1J, and ugd2 genes will not have a significant effect on the cell wall structure of the C4-1 strain.

[0188] (4) Strain autoagglutination test

[0189] Referring to the method of Xu Ying, Yuanzhi Lv et al. (Lv Y, Zheng J, Yang M, et al. An Edwardsiella tarda mutant lacking UDP-glucose dehydrogenase shows pleiotropic phenotypes, attenuated virulence, and potential as a vaccine candidate [J]. Veterinary Microbiology, 2012, 160 (3): 506-512., Xu Ying. Functional study of capsule-related genes of Edwardsiella tarda [D]. Ocean University of China, 2014 [2023-10-23]), all strains were revived on LB plates, and single colonies were picked and inoculated into glass test tubes containing 5 mL LB liquid culture medium, and cultured at 37 ° C with shaking (180 rpm) until OD 600 The concentration of the culture medium was 0.2 (200 μL was taken for detection using an ELISA reader), placed in a 4°C refrigerator, and observed once at 3h, 6h, and 18h ​​to check the agglutination of the bacteria with the naked eye.

[0190] Add 1 mL of fresh LB liquid medium to a 2 mL centrifuge tube and inoculate the strain at 1% (OD 600 ≈0.2, 10μL), take 1 tube without inoculation of strain as blank control, divide into two groups, one group is statically cultured in a constant temperature incubator at 30℃, and the other group is statically cultured in a constant temperature incubator at 37℃. Observe once at 3h, 6h, and 18h ​​respectively, and check the agglutination of bacteria with naked eyes. Repeat three times for each group.

[0191] Whether the bacterial solution OD 600Adjusted to 0.2 and cultured in a 4℃ refrigerator or in a 30℃ / 37℃ constant temperature incubator, all strains showed no obvious self-agglutination phenomenon by naked eye observation ( Fig. 20 ).

[0192] (5) Determination of strain biofilm

[0193] The OD value of the revived bacterial solution was 600 Adjust to about 0.5, inoculate 1% into a 96-well plate, replicate 3 times per group, culture at 37°C for 36 hours, take out and record the bacterial concentration. Discard the bacterial solution and wash with saline 3 times, fix with methanol for 15 minutes, place at 37°C for 15 minutes, and dry. Use 0.1% crystal violet stain for 15 minutes, discard the stain, wash with saline 3 times, place at 37°C for 15 minutes, take pictures and record, and dissolve with 95% ethanol to measure OD 590 .

[0194] In a 96-well plate, after culturing in LB liquid medium for 36 h, the biofilm formed by the △ugd, △ugd△cap1J, △ugd△ugd2, and △ugd△cap1J△ugd2 strains increased significantly compared with C4-1 ( Fig.21 ).

[0195] (6) Strain motility detection

[0196] The motility of each strain was detected with reference to the method of Dae-Gon Ha, Tien-Tien Vicky Lau, Debra L. Milton et al. (Ha D-G, Kuchma SL, O'Toole GA. Plate-based assay for swimming motility in Pseudomonas aeruginosa [J]. Methods in Molecular Biology (Clifton, NJ), 2014, 1149: 59-65., Tv L, Sm P, Jma T, et al. Flagellar motility mediates biofilm formation in Aeromonas dhakensis [J]. Microbial pathogenesis, 2023, 177., Milton DL, O'Toole R, Horstedt P, et al. Flagellin A is essential for the virulence of Vibrio anguillarum [J]. Journal of Bacteriology, 1996, 178 (5): 1310-1319.).

[0197] Swarming motility test: After all strains were revived on LB plates, a single colony was picked up using a 200 μL yellow pipette tip and placed in the center of a 0.5% TSA plate (TSA used for complemented strains and strains containing an empty plasmid was supplemented with 0.1% kanamycin, and each strain was repeated three times). The plate was incubated upright at 30°C in a constant temperature incubator for 72 hours, and the bacterial diffusion diameter was measured using a vernier caliper.

[0198] Swimming motility test: Use 0.3% TSA plate, and the specific operation is the same as above.

[0199] In the motility test of bacteria, it was found that there was no significant difference in the swimming ability of each strain compared with the wild strain C4-1. Compared with C4-1, the swarming ability of the gene-deficient strains △ugd△cap1J△ugd2 and △ugd△ugd2 was most significantly reduced (P≤0.0001); followed by △ugd2 (P≤0.001); the swarming ability of the △cap1J△ugd2 strain was extremely significantly reduced (P≤0.01), and the swarming ability of the △ugd strain was significantly reduced (P≤0.05). Compared with C4-1, there was no significant change in the swarming ability of the △cap1J and △ugd△cap1J strains. There was no significant change in the swarming ability of the complemented strains of each gene compared with C4-1. The results are as follows Fig. 22 shown.

[0200] (7) Detection of extracellular protease activity of strains

[0201] Referring to the method of Zhang Hongsheng, Marie-Hélène Corre et al. (Corre MH, Bachmann V, Kohn T. Bacterial matrix metalloproteases and serine proteases contribute to the extra-host inactivation of enteroviruses in lake water [J]. The ISME Journal, 2022, 16 (8): 1970-1979., Zhang Hongsheng, Xu Zhigang, Fang Zhongda. Determination of extracellular protease activity of rice bacterial blight bacteria by skim milk plate method [J]. Journal of Nanjing Agricultural University, 1989 (3): 92-93.), wild strains of Aeromonas dakar, gene-deficient strains, complemented strains and strains containing empty plasmids were streaked and revived on LB solid medium (strains containing plasmids were revived on LB solid agar plates containing kanamycin), and E. coli ATCC 25922 and E. coli were used. DH5α was used as the control strain. A single colony was picked up with a 200 μL yellow pipette tip and placed in the center of a skim milk plate (the skim milk solid medium used for the complemented strain and the strain containing the empty plasmid was supplemented with 0.1% kanamycin). Each strain was repeated three times. The plates were inverted and cultured in a 30°C constant temperature incubator for 72 hours. The diameter of the transparent area where the protein was decomposed was measured with a vernier caliper and photographed for record.

[0202] Compared with C4-1, the extracellular protease activity of △ugd, △ugd△ugd2 and △ugd△cap1J△ugd2 strains was significantly enhanced ( Fig.23 ).

[0203] (8) Detection of hemolytic activity of strains

[0204] Referring to the method of Hong Wang et al. (Wang H, Lin-Zhao Z, Jie-An D, et al. The lipgene contributes to the virulence of Aeromonas veronii strain TH0426 [J]. Microbial Pathogenesis, 2022, 167: 105566.), use a 200 μL yellow pipette tip to pick up each strain after recovery and inoculate it into sheep blood agar plate medium and invert it at 37 ° C for 24 hours. Use E. coli ATCC 25922 as a negative control strain. Repeat three times, use a vernier caliper to record the diameter of the hemolysis zone of each strain and take pictures.

[0205] Aeromonas dakarii showed β-hemolysis on the sheep blood plate, and there was no significant difference in hemolytic activity among the experimental strains. The diameter of the hemolytic zone of the strain increased significantly after 24 hours of culture compared with 48 hours and 72 hours of culture, but the difference in hemolytic activity among the strains was still not significant. Fig.24 .

[0206] (9) Detection of strain resistance to hydrogen peroxide

[0207] Refer to the methods of Chao-Jung Wu, Shengcen Zhang et al. (Wu CJ, Chiu TT, Lin YT, et al. Role of smeU1VWU2X Operon in Alleviation of Oxidative Stresses and Occurrence of Sulfamethoxazole-Trimethoprim-Resistant Mutants in Stenotrophomonas maltophilia[J]. Antimicrobial Agents and Chemotherapy,2018,62(2):e02114-17.,Zhang S,Zhang Q,Huang J,et al.Epidemic Potential ofEscherichiacoli O16:H41-ST131:Compared with Pandemic O25b:H30-ST131 Lineage[J].Infectionand Drug Resistance,2021,Volume 14:2625-2632.) All strains were revived on LB solid medium and inoculated into LB liquid culture at 37°C with shaking at 180 rpm. Escherichia coli was used. The bacterial solution OD was adjusted to 600to 0.5, take 100 μL of bacterial solution and apply it on MH solid medium. After the bacterial solution is completely absorbed by the medium, place a drug-sensitive paper containing hydrogen peroxide (3% H 2 O 2 , 13 μL / piece) was attached to the center of the MH medium and inverted for culture at 37°C for 16 h. The diameter of the inhibition zone was measured with a vernier caliper and photographed for record.

[0208] In this experiment, E. coli ATCC 25922 was used as the control. The hydrogen peroxide resistance of Aeromonas dakar was significantly higher than that of E. coli ATCC 25922 (P ≤ 0.0001), while there was no significant difference in hydrogen peroxide resistance among Aeromonas dakar strains. Fig.25 shown.

[0209] (10) Polymyxin B sensitivity test of strains

[0210] Refer to the instructions of CLSIM45-Ed3, CLSIM100-Ed33, CLSIM07-A9 and the methods of Emilisa Frirdich, Laurent Poirel, Zhang Xiaohua et al. (Frirdich E, Bouwman C, Vinogradov E, et al. The role of galacturonic acid in outer membrane stability in Klebsiellapneumoniae [J]. The Journal of Biological Chemistry, 2005, 280 (30): 27604-27612., Poirel L, Jayol A, Nordmann P. Polymyxins: Antibacterial Activity, Susceptibility Testing, and Resistance Mechanisms Encoded by Plasmids or Chromosomes [J]. Clinical Microbiology Reviews, 2017, 30(2): 557-596. Zhang Xiaohua, Tao Guanhong, Zhou Guangsheng, et al. TTC colorimetric determination of the in vitro antibacterial activity of thiamphenicol / florthiamphenicol-hydroxypropyl-β-cyclodextrin inclusion complex [J]. Science and Technology Information, 2009(35): 75-76.), all strains were revived on LB solid medium and inoculated into MH liquid culture at 37°C, 180 rpm shaking culture until the logarithmic growth phase, and the OD was adjusted. 600 After the concentration is reduced to 0.5, the mixture is diluted 100-fold for later use. The Ecoli ATCC25922 strain is used as a control / quality control.

[0211] Minimum inhibitory concentration of polymyxin B:

[0212] ① Add 100 μL of MH broth containing 0.02% TTC to the first to eleventh columns of the 96-well plate, and add 200 μL of MH broth containing 0.02% TTC to the twelfth column as a blank control.

[0213] ② Add 100 μL of polymyxin B diluted to 256 μg / mL to the first column of the 96-well plate, replace the pipette tip and use a pipette to repeatedly pipette and mix.

[0214] ③ Pipette 100 μL of drug solution from the first column and add it to the wells in the second column of the same row. After changing the pipette tip, use a pipette to repeatedly pipette and mix. Repeat this process until the tenth column. Pipette 100 μL of drug solution from the wells in the tenth column and discard it. Do not add antibiotics to the eleventh column as a positive control.

[0215] ④ For each strain, three parallels were made, each occupying three rows. 100 μL of diluted bacterial solution was added to each well from the first to the eleventh column (the concentration of polymyxin B from the first to the tenth column was 128-0.25 μg / mL, with two-fold dilutions).

[0216] ⑤ Place the 96-well plate on a horizontal shaker and shake to mix, then place it in a 37°C constant temperature incubator for 16 hours, observe and record the results, as shown in Table 13 and Fig.26 shown.

[0217] Table 13 Minimum inhibitory concentration test results of experimental strain Polymyxa B

[0218]

[0219] Note: The minimum inhibitory concentration of polymyxin B against the quality control strain E.coliATCC7966 is 0.25-2μg / mL.

[0220] Polymyxin B is a cationic antimicrobial peptide. Bacterial resistance to polymyxin is usually acquired by modifying lipid A on the cell wall, which is related to the ugd and cap1J genes in this application. After testing, it was found that compared with C4-1, the sensitivity of △ugd△cap1J△ugd2 and △ugd△ugd2 strains to polymyxin B (PB) was the highest (the minimum inhibitory concentration of PB for the strain was 2μg / mL), which was increased by 64 times. In addition, the sensitivity of the △ugd strain to PB was increased by 4 times.

[0221] The results showed that the knockout of ugd, cap1J, and ugd2 genes did not have a serious impact on the bacterial cell wall structure. The ugd gene was the main factor affecting the sensitivity of the C4-1 strain to PB, followed by the ugd2 gene. The sensitivity of the strain to PB was greatly improved by knocking out both the ugd and ugd2 genes. The knockout of the cap1J gene had no effect on the sensitivity of the strain to PB.

[0222] (11) Carp epithelial tumor cell adhesion test

[0223] The carp epithelial tumor cells were revived; all gene deletion mutants were revived on LB solid culture medium and inoculated into LB liquid culture at 37°C, 180rpm overnight shaking culture; the cells in the cell culture plate were washed 3 times with preheated PBS, 400 μL of cell culture medium without double antibody was added to each well, and the plate was placed in a 37°C constant temperature incubator for use; the OD of the bacterial solution was measured. 600 Adjust to about 0.5, centrifuge at 5000rpm for 5min to collect bacterial precipitate, and wash 3 times with PBS. Take 100μL and add it to the cell culture plate, with three replicates for each strain; place the cell culture plate on a horizontal shaker and shake for 5min, then move it into a constant temperature incubator and culture it at 37℃ for 2h; discard the culture medium in the cell culture plate and wash it 3 times with PBS. Add 1mL Trition X-100 (1%) to each well to lyse the cells for 10min, blow it 3 times with a pipette tip in the middle, and collect the lysate into a 1.5mL centrifuge tube; dilute the lysate tenfold with PBS and spread it on LB agar medium, and count the colonies after culturing at 37℃ for 16h.

[0224] The results are as follows Fig. 27 As shown, the adhesion rate of △ugd△ugd2 strain to cells was significantly higher than that of C4-1 (P=0.04), and the adhesion rate of △ugd△cap1J△ugd2 was extremely significantly higher than that of C4-1 (P=0.0013)%. This may be related to the enhanced biofilm formation ability and weakened swarming ability of △ugd△ugd2 and △ugd△cap1J△ugd2 strains.

[0225] (12) Alligator-derived antimicrobial peptide sensitivity test

[0226] Refer to the method of Supawadee Pata, Liqing Chen et al. (Pata S, YaraksaN, DaduangS, et al. Characterization of the novel antibacterial peptide Leucrocin from crocodile (Crocodylus siamensis) white blood cell extracts [J]. Developmental and Comparative Immunology, 2011, 35 (5): 545-553., Chen L, Wang Y, Fan L,et al.Responseregulator KdpE contributes to Aeromonas dhakensis virulence[J].Aquaculture,2023,568:739298.):

[0227] ① All strains were revived on LB solid medium and inoculated into LB liquid culture at 37°C with shaking at 180 rpm. Escherichia coli ATCC 2599 was used as the control strain.

[0228] ② Add 100 μL of LB liquid culture medium containing 50 μg / mL crocodile-derived antimicrobial peptide Leucrocin I or crocodile-derived antimicrobial peptide Leucrocin II into a 96-well plate (a total of 16 strains, 48 ​​wells for each antimicrobial peptide).

[0229] ③ Adjust the bacterial solution OD 600 After the concentration reached 0.5, 100 μL was taken out and added to a 96-well plate. The same antimicrobial peptide was repeated three times for each strain (the final concentration of the crocodile-derived antimicrobial peptides Leucrocin I and Leucrocin II was 25 μg / mL).

[0230] ④ Place the 96-well plate on a horizontal shaker, shake and mix, and then incubate at 37°C for 2 h.

[0231] ⑤ Pipette 100 μL of bacterial solution from each well of the 96-well plate and dilute it 10-fold using PBS (dilute to 10 -6 ).

[0232] ⑥ Take 2 μL of each gradient dilution and spot it on LB agar medium. Incubate at 37°C for 16 hours and then observe and record the results.

[0233] like Fig.28As shown, the results showed that compared with C4-1, only △ugd△ugd2 and △ugd△cap1J△ugd had enhanced sensitivity to the antimicrobial peptide Leucrocin I, while the sensitivity of other strains showed no significant change.

[0234] 2.8 Analysis of strain virulence and immune protection

[0235] (1) Determination of the median lethal dose of C4-1 in mice and analysis of tissue loading

[0236] According to routine operation, the newly purchased mice were isolated and observed for 14 days and then randomly divided into seven groups. The OD value of the resuscitated C4-1 bacterial solution was 600 Adjust to about 1.5 (the number of colonies is 1.5×10 9 The diluted bacterial solution was intraperitoneally injected into each group at a dose of 0.2 mL per mouse. The health status of the mice was observed and the weight was recorded every day for seven consecutive days. Water and food were provided normally during the experiment. Fresh tissue samples of dead mice were collected aseptically (the weight of each sample tissue and 2.0 mL EP tube was recorded), and an appropriate amount of PBS was added to homogenize the tissue. The diluted homogenate was diluted 10 times continuously (diluted to 10 -6 ), and then take each gradient of dilutions and apply them to Aeromonas selective culture medium in turn, culture them at 37℃ overnight and count the number of colonies.

[0237] The median lethal dose of Aeromonas dakar C4-1 to Kunming mice is about 4.89×10 6 CFU / tail, the challenge dose is less than 3.4×10 6 None of the mice infected with CFU / tail died. All the mice that died died acutely (within two days after infection), and the fastest one began to die 5 hours after infection. The tissues and organs of the dead mice were removed and analyzed for tissue load. The results showed that the bacteria were distributed in the heart, liver, spleen, lung, kidney, and brain of the mice, with the largest amount in the liver, about 4.9×10 7 CFU / g. The weight of mice recorded during the experiment was analyzed ( Fig.29 ), and found that intraperitoneal injection of PBS and the challenge dose of 3.5×10 4 The body weight of mice with ≥10 CFU / tail increased steadily, and the body weight of the remaining surviving mice began to gradually increase two days after the infection.

[0238] (2) The median lethal dose (LD50) of wild type and gene deletion mutant strains 50 )

[0239] Referring to the method of Jihong Li et al. (JL, SM, ZL, et al. Construction and Characterization of an Aeromonas hydrophila Multi-Gene Deletion Strain and Evaluation of Its Potential as a Live-Attenuated Vaccine in Grass Carp[J]. Vaccines, 2021, 9(5).), 10 zebrafish were included in each group and intraperitoneally injected with 10-fold diluted bacterial suspension resuspended in PBS. Each zebrafish was injected with 10 μL, and PBS was used as the control group. The group was observed for 7 consecutive days and the median lethal dose was calculated.

[0240] Compared with the PBS group, the strains in the other groups showed pathological characteristics from the most acute infection to the chronic infection. Some of the fish that died most acutely showed no pathological changes in visual observation; the fish with acute infection had congestion and swelling in the abdomen, red fins, bloodshot eyes, congestion and edema in the brain; and the fish with chronic infection had loss of appetite, slumped, and weight loss. Fig.30 shown.

[0241] The data of median lethal dose were statistically analyzed, and the results showed that the LD of C4-1, △ugd, △cap1J, △ugd2, △ugd△cap1J, △cap1J△ugd2, △ugd△ugd2, △ugd△cap1J△ugd2 50 They are 6.89×10 5 4.30×10 5 , 2.40×10 5 ,8.82×10 5 , 6.46×10 5 , 1.88×10 6 4.09×10 4 , 3.35×10 6 CFU / fish. Compared with the wild-type Aeromonas dakar strain C4-1, the virulence of △ugd, △cap1J, △ugd△cap1J, and △ugd△ugd2 increased by 1.60, 2.87, 1.06, and 16.85 times, respectively; the virulence of △ugd2, △cap1J△ugd2, and △ugd△cap1J△ugd2 decreased by 1.28, 2.73, and 4.86 times, respectively. Except for △ugd△ugd2, the virulence of all strains with the △ugd2 gene knocked out was reduced.

[0242] (3) Preparation of zebrafish pathological tissue sections

[0243] Refer to the method provided by the Zebrafish International Resource Center website (Recipes and Protocols [ZIRCPublic Wiki] [EB / OL]. (2023-10-07) [2022-10-01]. https: / / zebrafish.org / wiki / health / disease_manual / recipes_and_protocols.). H&E tissue section staining was performed on the zebrafish PBS group and △ugd△cap1J△ugd2 group. Fig.31 As shown in the results, it was found that zebrafish in the △ugd△cap1J△ugd2 group were injected with a dose lower than the half-lethal dose (1.44×10 6 ) in the dead fish, there are still obvious pathological changes in the intestines and livers - the villi in the small intestine fall off and the liver has severe vacuolar degeneration.

[0244] (4) Determination of immune protection rate of gene deletion mutants

[0245] Referring to the method of Hai-peng Zhang et al. (Zhang HP, Chen MY, Xu YX, et al. An effective live attenuated vaccine against Aeromonas veroniiinfection in the loach (Misgurnus anguillicaudatus) [J]. Fish & Shellfish Immunology, 2020, 104: 269-278.), zebrafish were immunized by immersion immunization and intraperitoneal injection, with 40 zebrafish in each group, and the control group was intraperitoneally injected with an equal volume of PBS (10 μL), wherein the immersion group was continuously supplied with oxygen during the immersion period of 10 min. A secondary immunization was performed 14 days after the first immunization. On the 28th day, the wild strain of Aeromonas dakar was used for attack, and the relative immune protection rate (RPS) was calculated.

[0246] And draw the survival curve.

[0247] Two strains with the weakest virulence were selected from each gene knockout strain, namely △cap1J△ugd2 and △ugd△cap1J△ugd2, to conduct experimental research on the immune protection effect of zebrafish. The △cap1J△ugd2 and △ugd△cap1J△ugd2 strains were used for intraperitoneal inoculation and immune soaking of zebrafish, respectively, and PBS was used for intraperitoneal injection of the control group. △cap1J△ugd2 strain was used twice before and after 1.92×10 6 CFU / mL and 1.96×106 CFU / mL for immersion immunization, using 1.92×10 4 CFU / fish and 1.96×10 6 CFU / fish were injected intraperitoneally; 2.41×10 CFU / fish were used for the △ugd△cap1J△ugd2 strains before and after each injection. 6 CFU / mL and 2.42×10 6 CFU / mL for immersion immunization, using 2.41×10 4 CFU / fish and 2.42×10 6 CFU / fish were injected intraperitoneally. After two immunizations, the concentration used was 1.94×10 8 The virus was challenged with C4-1 at a concentration of CFU / mL. The results are shown in Table 14.

[0248] There is no difference in the immune protection effect of △cap1J△ugd2 and △ugd△cap1J△ugd2 on fish by immersion immunization (the relative immune protection rate is 36%). Although the concentration of bacteria used in immersion immunization is high, the immune protection effect on fish is not as good as that of intraperitoneal inoculation. This is related to the fact that immersion immunization mainly captures antigens (here refers to bacteria) through the gills of fish, while intraperitoneal injection directly exposes the antigen to the fish. After two intraperitoneal injections of △cap1J and △ugd△cap1J△ugd2, the relative protection rates of △cap1J and △ugd△cap1J△ugd2 on zebrafish can reach 44% and 64%, respectively. In terms of results, the immune protection effect of the △ugd△cap1J△ugd2 strain is better than that of △cap1J△ugd2, but this may also be affected by the concentration of the strain during immunization.

[0249] Table 14 Zebrafish immune protection test

[0250]

[0251] Note: When immunizing zebrafish, the immunization methods are divided into intraperitoneal injection (ip) and immersion immunization. The groups marked as ip in the table chose intraperitoneal injection for both immunizations.

[0252] The survival curve of zebrafish in this experiment is as follows Fig.32 shown.

[0253] The above embodiments of the present invention are merely examples to more clearly illustrate the present invention, and are not intended to limit the implementation methods of the present invention. Any obvious changes or modifications derived from the technical solutions of the present invention are still within the protection scope of the present invention.

Claims

1. A mutant strain of Aeromonas dhakensis with a missing surface polysaccharide synthesis gene, wherein the Aeromonas dhakensis is A. dhakensisC160501, the surface polysaccharide synthesis gene is one or more of the ugd, ugd2 and cap1J genes, the nucleotide sequence of the ugd gene is shown in SEQ ID NO.1, the nucleotide sequence of the ugd2 gene is shown in SEQ ID NO.2, and the nucleotide sequence of the cap1J gene is shown in SEQ ID NO.

3.

2. The method for constructing a mutant strain of Aeromonas dakar with a gene deletion for surface polysaccharide synthesis according to claim 1, comprising: Constructing the ugd2 gene recombinant suicide plasmid pRE112-△ugd2 by seamless cloning, and conjugating the Aeromonas dakar strain with E. coli WM3064 containing pRE112-△ugd2 to obtain the △ugd2 strain; and / or The cap1J gene recombinant suicide plasmid pRE112-△cap1J was constructed by double restriction digestion method, and the Aeromonas dakar strain was conjugated with E. coli WM3064 containing pRE112-△cap1J to obtain the △cap1J strain.

3. The construction method according to claim 2, characterized in that: The seamless cloning method is used to construct the ugd2 gene recombinant suicide plasmid pRE112-△ugd2, which includes: using the genomic DNA of Aeromonas dakar as a template, using two pairs of primers ugd2-up-F / R and ugd2-down-F / R to amplify the upstream and downstream homologous arms of the ugd2 gene respectively; extracting the pRE112 plasmid DNA, using the primers reverse pRE112-F / R to perform PCR amplification to linearize the plasmid; using the linearized fragment of the pRE112 plasmid as a template, ugd2-up and ugd2-down as primers to perform a multi-fragment recombination reaction and transformation; the primer sequences are as follows: ugd2-up-F:TTCCCGGGAGAGCTCGCATATGACGCATTAATGAAATGC, ugd2-up-R: TGCAGGTATTATTTCACCACAATGTAATATTAAACAAATAAATACTTAG; ugd2-down-F:TGAAAATAATACCTGCAATAGTGTATGGGGC, ugd2-down-R:CAAGCTTCTTCTAGAAGCGTTCAATCACCAGCC.

4. The construction method according to claim 2, characterized in that: The double enzyme digestion method is used to construct the cap1J gene recombination suicide plasmid pRE112-△cap1J, which includes: using the genomic DNA of Aeromonas dakar as a template, using two pairs of primers cap1J-up-F / R and cap1J-down-F / R to amplify the upper and downstream homology arms of cap1J respectively; using the upper and downstream homology arms of cap1J as templates, firstly performing 10 cycles of amplification without adding primers, and then adding primers cap1J-up-F and cap1J-down-R for 25 cycles of amplification; double enzyme digestion, connection, and transformation of the pRE112 plasmid and the upper and downstream homology arms of cap1J; the primer sequences are as follows: cap1J-up-F:AACGAGCTCGGCATAGAAGGGCAGGTTCATG, cap1J-up-R:GGCTGGGGTCCTGTGCAG; cap1J-down-F: TGCACAGGACCCCAGCCCCATCCCGACCGGACACT, cap1J-down-R: AGGCTCTAGACGACATGGATTCTTCTCCTGTTGGG.

5. The construction method according to claim 2, characterized in that: Also includes: E. coli WM3064 containing pRE112-△cap1J was used as the donor strain and the mutant strain △ugd with ugd gene deletion was used as the recipient strain for conjugation transfer. The strains carrying the plasmid were screened by a single homologous recombination, and the strains without the plasmid were reversely screened by a secondary homologous recombination. The △ugd△cap1J strain was obtained by identification.

6. The construction method according to claim 2, characterized in that: Also includes: The strains △ugd and △cap1J were respectively conjugated with E. coli WM3064 containing pRE112-△ugd2 and verified to obtain the △ugd△ugd2 and △cap1J△ugd2 strains.

7. The construction method according to claim 6, characterized in that: Also includes: The strain △ugd△ugd2 was conjugated with E. coli WM3064 containing pRE112-△cap1J and verified to obtain the △ugd△cap1J△ugd2 strain.

8. The method for constructing a complemented strain of a mutant strain lacking a surface polysaccharide synthesis gene of Aeromonas dakar according to claim 1, comprising: 1) Use primer seamless ugd-F / R to amplify the target fragment. The primer sequence is as follows: Seamless ugd-F: ACACAGGAAACAGCTATGAACATTACTGTATTTGGAAGTGGCTACGTGG, seamless ugd-R: ACAAAATATTAACGCTTATTTCATTACCGATTCGCCCCG; Use primer seamless cap1J-F / R to amplify the target fragment. The primer sequence is as follows: Seamless cap1J-F:ACACAGGAAACAGCTATGAAGTATCTGGTCACCGGCG, Seamless cap1J-R:ACAAAATATTAACGCCTACTCCAGCTCAGCGGGTTG; Use primer seamless ugd2-F / R to amplify the target fragment. The primer sequence is as follows: seamless ugd2-f:ACACAGGAAACAGCTATGAATATTACAATTGCAGGCACC, seamless ugd2-r:ACAAAATATTAACGCTTAGTCGGATCCGAATAGATCCC; 2) Activate E. coli DH5α carrying pBBR1MCS-2 plasmid, extract plasmid DNA, and use primers pBBR1MCS-2-F / R to amplify in the reverse direction to linearize the plasmid. The primer sequences are as follows: Reverse pBBR1MCS-2-F: AGCTGTTTCCTGTGTGAAATTG, Reverse pBBR1MCS-2-R: GCGTTAATATTTTGTTAAAATTCGCGT; 3) The linearized fragment of pBBR1MCS-2 plasmid was subjected to single-fragment recombination reaction with the target gene fragment, and then transformed to obtain the complemented plasmids pBBR1MCS-2-△lacZα::ugd, pBBR1MCS-2-△lacZα::cap1J, and pBBR1MCS-2-△lacZα::ugd2; 4) The activated △ugd, △cap1J, and △ugd2 were respectively conjugated with E. coli WM3064 carrying pBBR1MCS-2-△lacZα::ugd, pBBR1MCS-2-△lacZα::cap1J, and pBBR1MCS-2-△lacZα::ugd2 plasmids for identification.

9. Use of the mutant strain of Aeromonas dakar with a deletion gene for surface polysaccharide synthesis as claimed in claim 1 in changing the virulence of the bacteria and the sensitivity to polymyxin B.

10. The use according to claim 9, characterized in that: Includes the use of mutant strains in which ugd, ugd2 and cap1J genes are simultaneously deleted as live attenuated vaccines.

Images