Application of Chorion protein 36 in regulating the reproduction of female melon flies

Abstract

The present invention discloses the application of Chorion protein 36 protein in regulating the reproduction of female melon fruit flies. The encoding nucleotide sequence of the Chorion protein 36 protein is shown in SEQ ID NO.1. The present invention identifies a protein that regulates the reproduction of female melon fruit flies. After downregulating the expression of S36, the egg laying amount and hatching rate of female melon fruit flies that have emerged for 3 days are significantly reduced; and the eggs are messy and atrophied, and mature eggs cannot be produced, thereby achieving the purpose of pest control.

Description

Technical Field

[0001] The invention belongs to the field of pest control, and particularly relates to application of Chorion protein 36 protein in regulating the reproduction of female melon fruit flies. Background Art

[0002] Bactrocera cucurbitae (Coquillett) belongs to the family Tephritidae of the order Diptera. It is also known as the melon fruit fly, needle wasp, melon maggot, etc. It is an important quarantine pest in my country. It mainly harms Cucurbitaceae crops, such as cucumber, melon, pumpkin, loofah, zucchini, etc. The melon fruit fly is an important invasive pest, widely distributed in tropical and some subtropical countries and regions. In my country, it is mainly distributed in the area south of the Yangtze River (Zhang Quansheng, 2002). The melon fruit fly mainly feeds on larvae. The female adults lay eggs in fruits and vegetables. After the larvae hatch, they feed in the melons. The fruits and vegetables affected by the insects turn yellow in some parts, and then all rot and stink, causing a large number of fruits to fall. Even if they do not rot, the wounds are condensed with gum, and the fruits are deformed and sunken. The skin is hard and solid, which seriously affects the quality and yield of fruits and vegetables (Huang Nana et al., 2015).

[0003] In recent years, many literatures have reported that insect egg laying is regulated by a series of hormones and genes. The synthesis and absorption of vitellogenin Vg is a necessary condition for oocyte maturation and is comprehensively regulated by multiple signaling pathways, such as juvenile hormone (JH), ecdysone (20-hydroxyecdysone, 20E), target of rapamycin (TOR), insulin-like peptide (ILP) and other signaling pathways (Wang Zhijian, 2015). Juvenile hormone regulates oocyte maturation and the biosynthesis of vitellogenin in the fat body (Wyatt and Davey, 1996). Ecdysone is required for the normal development of Drosophila ovaries, and ecd-1 mutations lead to abnormal oogenesis in female insects (Auditlamour and Busson, 1981). In addition, neuropeptides can also participate in regulating the growth, development, reproduction and behavior of insects. Neuropeptides that regulate insect reproduction mainly include insulin-like polypeptides, Neuroparsins, neuropeptide F, lateral pharyngeal body neuropeptides, etc. In Drosophila, the proliferation of oocytes, vegetative cells, and somatic cells and the absorption of nutrients depend on IS and TOR signaling (Drummond-Barbosa and Spradling, 2001; Arsic and Guerin, 2008; Pritchett and Mc Call, 2012); the IS signaling pathway can also stimulate vitellogenesis in the fat body and the proliferation of oocytes (Richard et al., 2005; Badisco et al., 2011).

[0004] In the melon fruit fly, this research result is relatively rare. Xu Huiqian and others found that takeout is a secretory protein that can bind to small lipid particles and shows obvious expression bias in the male accessory glands of insects. During mating, male adults of melon fruit flies can transfer Zctakeout1 protein to female insects along with sperm, thereby affecting female egg laying (Xu Huiqian, 2022). Inhibiting the expression of ZcTSSK1 and ZcTSSK3 can significantly affect spermatogenesis in melon fruit flies, affecting the reproductive capacity of male adults by reducing the number of sperm (Zhang Suyun, 2021). Glutathione S-transferase can regulate the ovarian development of melon fruit flies by maintaining the dynamic balance of reactive oxygen in the ovaries (Ma Meng, 2023). Although some research results have preliminarily identified and analyzed the molecular mechanisms of ovarian development and reproduction of female melon fruit flies, exploring more ovarian-specific genes of melon fruit flies and analyzing their effects on melon fruit fly reproduction are the research basis for genetic control of melon fruit flies.

[0005] Cucurbit fruit flies have a strong reproductive capacity, and are mainly harmed by female egg-laying and larvae feeding. Therefore, reducing or preventing female Cucurbit fruit flies from laying eggs is one of the effective ways to reduce harm. In natural environments, plant hosts expressing dsRNA can enter the bodies of Cucurbit fruit fly larvae through feeding and thus affect their reproduction and egg-laying, achieving the purpose of pest control. Summary of the invention

[0006] The first object of the present invention is to provide the application of Chorion protein 36 protein in regulating the reproduction of female melon fruit flies.

[0007] The nucleotide sequence of the Chorion protein 36 protein is shown in SEQ ID NO.1.

[0008] Preferably, the expression of Chorion protein 36 is down-regulated to reduce the egg-laying amount and / or hatching rate of female melon flies, causing abnormal ovarian development, disordered and atrophied eggs, and failure to produce mature eggs.

[0009] Preferably, the down-regulation of the expression of Chorion protein 36 protein is through dsRNA interference.

[0010] Preferably, the synthetic primers of the dsRNA are: F: 5'-ATGAACTGTTTCCTATTCAC-3'; R: 5'-CAGATGGTTTGATCTTGTAG-3'.

[0011] The second object of the present invention is to provide a method for controlling Cucurbit fruit fly, which is to reduce the egg laying amount and / or hatching rate of Cucurbit fruit fly by down-regulating the expression of Chorion protein 36 protein in female Cucurbit fruit fly.

[0012] The present invention has the following advantages and effects relative to all the technologies:

[0013] The present invention identifies a protein that regulates the reproduction of female melon fruit flies. After down-regulating the expression of S36, the egg-laying amount and hatching rate of female melon fruit flies that have emerged for 3 days are significantly reduced; and the eggs are messy and shrunken, and mature eggs cannot be produced, thereby achieving the purpose of pest control. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 is a graph of the expression levels of S36 in different tissues and age groups;

[0015] Figure 2 It is a statistical graph of the egg production and hatching rate of female melon flies that have emerged for 3 days after feeding with dsRNA of S36;

[0016] Figure 3 This is a diagram showing the ovarian development of a 3-day-old female Bactrocera melonensis after being fed with dsRNA of S36. DETAILED DESCRIPTION

[0017] A protein S36 (Chorion protein 36) that regulates the reproduction of female melon flies, the nucleotide sequence of the coding region is shown in SEQ ID NO.1, and the gray part is the dsRNA synthetic sequence:

[0018] 5’——ATGAACTGTTTCCTATTCACACTTTTCTTCGTTGCCGCACCGCTCGCAACGG CCTCTTATGGTTCGGCTTCGGGTGGCGGTAGTGGTGCTTCCTATCTGTCATCTGCCTCATCGAATGGTCTCGATGAGTTGGTACAGGCTGCTGCCGGTGGTGCTCAACAGGCTGGCGGTT CCATCACTCCCGCCAATGCTGAAATTCCCGTCTCACCCGCCGAAGTGGCTCGCCTCAGCCAAGTGCAAGCTCAATTGCAAGCGCTTAACTCCAACCCAGTCTATCGTAATTTGAAGAACTCCGATGCCATTGCAGAATCTTTGGCTGAATCTAACTTGGCTTCGAACATTCGTCAGGGCAATATCAATATTGTTGCACCCAATGTAGTGGATCAGGGTGTCTACCGTTCACTGTTGGTGCCATCGGGCCAAAACAATCATCAAGTGATCGCCACACAACCCTTGCCACCAATCATTGTCAATCAGCCCGCTTTACCACCCACCCAAATTGGTGGTGGACCAGCTGCCGTTGTAAAAGCCGCACCAGTCATCTACAAGATCAAACCATCTGTGATCTATCAGCAAGAAGTGATCAACAAGGTGCCAACTCCACTCAGCTTGAACCCCGTATACGTAAAAGTATACAAACCCGGCAAAAAGGTTGATGCTCCACTTGTGCCCGGTGTACAACAGAGCTATCAGGCTCCATCATATGGTGGTTCATCATACTCAGCACCAGCTCAATCTTATGAGGCAGCACCCGCACCATCTTATAGCGCTGCTCCTGCTCCATCATATGGTGCCGCACCAGCTGCATCTTACGGCGCAGCTCCTGCTCAAACTTATGATGCTGCTCCTGCTCCATCTTATAGCGCTGCTCCCTCATACGGCGCTGAAGCATCTTATGGTGCTGCCCCAAGCAGCAGCGGCTACGGCAGTGCCCCCCAATCATCGGGCTATTAA——3’

[0019] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0020] Example 1

[0021] 1. The insect sources used are collected from the wild and placed in a laboratory environment for long-term breeding. The temperature is set at 26±2 degrees Celsius, the indoor humidity is controlled at about 65%, and the photoperiod L:D=14:10h to ensure that the melon fruit fly is in the best growth environment and accelerate its growth and reproduction. The larvae are raised in zucchini or bitter melon of appropriate age, and the adults are raised with artificial feed mixed with 4g OXOID yeast extract and 12g anhydrous glucose, and water is required.

[0022] 2. Extraction of total RNA: The fat bodies, midgut, epidermis, ovaries, Malpighian tubules of 100 30-day-old female adults of Bactrocera melonensis and 5 30-day-old male adults, as well as 2h and 24h-old eggs, 3d and 6d-old larvae, 4d and 12d-old pupae, and 1d, 3d, 5d, 7d, 9d, 11d, 13d, 15d, and 30d-old female adults were collected and ground in liquid nitrogen, and total RNA was extracted using the TRIzol method.

[0023] 3. Synthesis of the first strand of cDNA: 1 ug of total RNA was reverse transcribed into cDNA using a reverse transcription kit (PrimeScriptTM RT reagent Kit) to produce the first strand template for quantitative PCR.

[0024] 4. Quantitative PCR detection: qPCR detection was performed using KAPA SYBR FAST Universal qPCR Kit, with cDNA as the template. The amplification primers for S36 and the internal reference gene RPS3 are as follows:

[0025] F: 5'-AGCACCCGCACCATCTTATA-3'

[0026] S36

[0027] R: 5'-AGATGCTTCAGCGCCGTAT-3'

[0028] F: 5'-TAAGTTGACCGGAGGTTTGG-3'

[0029] RPS3

[0030] R: 5'-TGGATCACCAGAGTGGATCA-3'

[0031] 5. The results showed that the expression level of S36 in the ovary of female B. cucurbitae was significantly higher than that in the epidermis, midgut, malariae, fat body and male B. cucurbitae ( Figure 1A); At the same time, S36 was highly expressed in all developmental stages 5 days after the female adult emerged, reaching its peak at 7 days ( Figure 1 B).

[0032] Example 2

[0033] (1) The gene sequence of Bactrocera melonensis S36 was downloaded (GenBank accession number: LOC105210599), and the target gene sequence (562 bp) was selected from the conserved region and the main functional region to design and synthesize the dsRNA (dsS36) primers of the gene; the dsRNA (dsGFP) primers of the green fluorescent protein GFP gene were designed using the sequence of the GFP gene (GenBank accession number: AF324407.1).

[0034] F: 5'-ATGAACTGTTTCCTATTCAC-3'

[0035] DsS36

[0036] R: 5'-CAGATGGTTTGATCTTGTAG-3'

[0037] F: 5'-CACTGGAGTTGTCCCAATTC-3'

[0038] dsGFP

[0039] R: 5'-TCCCAGCAGCTGTTACAAAC-3'

[0040] (2) Using the cDNA of Example 1 as a template and the primers of step (1) as primers, the target fragment was amplified and constructed on a T vector. After transformation, plaque picking and bacterial shaking, positive clones were selected and sent to the company for sequencing, and the bacteria with correct sequencing were kept for future use.

[0041] (3) Activate the stored bacteria by shaking, extract the plasmid, and use the plasmid as a template for subsequent steps.

[0042] (4) Using the plasmid as a template, PCR amplifies the target gene using forward and reverse primers with T7 promoters connected to the 5' end to obtain a target gene fragment with T7 promoter sequences connected to both ends, which is used as a template for dsRNA synthesis.

[0043] (5) Synthesize double-stranded RNA according to the instructions of the Promege T7 transcription kit (T7 RiboMAXTM Express RNAi System).

[0044] Thus, dsRNA and dsGFP of Chorion protein 36 (S36) protein were obtained.

[0045] Example 3

[0046] (1) Take 100 3-day-old female B. melonis, stun them with CO2, and place them on an agar plate for injection. The dsRNA concentration of Chorion protein 36 was diluted to 5 μg / μL, and 0.2 μL was injected per insect. The injected B. melonis was raised in a population cage (15 cm × 15 cm). The population cage was filled with wet cotton balls and artificial feed with a ratio of 1:3 of yeast extract and glucose. The feed was changed every two days, and the number of deaths of B. melonis was observed and recorded every day. At the same time, 3-day-old female B. melonis injected with dsGFP was set as a control. The 15-day-old female B. melonis was placed in a cylindrical breeding box (diameter × height, 7 cm × 12 cm) with wild-type males in a ratio of 1:3. Single-head pairing was repeated for 15 times. The box was filled with wet cotton balls and artificial feed with a ratio of 1:1 of yeast extract and glucose. The feed was changed every two days, and the number of deaths was observed and recorded every day (data of dead B. melonis were excluded). Two days after mating, 1 cm thick zucchini slices were placed in the box to allow the females to lay eggs. The slices were replaced every two days, and the egg-laying of the females within five days after mating was counted. The experimental results showed that compared with the control group injected with dsGFP, the egg-laying amount of the cucurbit fruit fly with S36 silenced was significantly reduced ( Figure 2 A), and the larval hatching rate also decreased significantly ( Figure 2 B) showed that down-regulating the expression of S36 could significantly inhibit the reproduction of B. cucurbitae.

[0047] (2) Take 100 3-day-old female B. melonis, stun them with CO2, and place them on an agar plate for injection. The dsRNA concentration of Chorion protein 36 was diluted to 5 μg / μL, and 0.2 μL was injected per insect. The injected B. melonis was raised in a population cage (15 cm × 15 cm). The population cage was filled with wet cotton balls and artificial feed with a ratio of 1:3 of yeast extract: glucose, which was changed every two days. At the same time, 3-day-old female B. melonis injected with dsGFP was set as a control. The 15-day-old female B. melonis was placed in a cylindrical breeding box (diameter × height, 7 cm × 12 cm) with wild-type males in a ratio of 1:3. They were paired individually. The box was filled with wet cotton balls and artificial feed with a ratio of 1:1 of yeast extract: glucose, which was changed every two days. After 5 days, the ovaries of the female B. melonis were dissected and their development was observed and counted. The experimental results showed that compared with the control group injected with dsGFP, the ovaries of the melon fruit fly with S36 silenced developed abnormally, the eggs were messy and atrophied, and could not produce mature eggs ( Figure 3 ), indicating that S36 can regulate the egg development of Bactrocera melonensis.

[0048] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention are all included in the protection scope of the present invention because of equivalent replacement methods.

Claims

1. A method for controlling melon fruit flies, characterized in that: The method down-regulates the expression of Chorion protein 36 protein in female cucurbit fruit flies, thereby reducing the egg-laying amount and / or hatching rate of the cucurbit fruit flies, causing abnormal ovarian development, disordered and atrophied eggs, and failure to produce mature eggs. The encoding nucleotide sequence of the Chorion protein 36 protein is shown in SEQ ID NO.

1.

2. The method according to claim 1, characterized in that The down-regulation of the expression of Chorion protein 36 protein is achieved by down-regulating the expression of Chorion protein 36 protein through dsRNA interference.

3. The method according to claim 2, characterized in that The synthetic primers of the dsRNA are: F: 5'-ATGAACTGTTTCCTATTCAC-3'; R: 5'-CAGATGGTTTGATCTTGTAG-3'.

Images