Ester-producing saccharomyces cerevisiae and application thereof in fruit wine brewing

Abstract

The invention relates to saccharomyces cerevisiae and application thereof, and belongs to the technical field of microbial strain screening and application. According to the invention, a saccharomyces cerevisiae G1 is screened and separated from peels of passion fruits and is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC NO: M 2024815. The invention further discloses application of the saccharomyces cerevisiae in brewing of passion fruit wine. Experiments prove that compared with a commercial saccharomyces cerevisiae strain, the strain disclosed by the invention has stronger ester production, gas production and acid production capacity, weaker acid production capacity and stronger tolerance to SO2 in the environment, and can be used for brewing fruit wine and ensuring the flavor of the fruit wine.

Description

Technical Field

[0001] The invention relates to an ester-producing brewing yeast and application thereof in fruit wine brewing, belonging to the technical field of microbial strain screening and application. Background Art

[0002] Passion fruit is the fruit with the richest vitamin content among the fruits currently sold on the market. The passion fruit pulp contains many nutrients, including a large amount of protein, carotene, fat, sugar, various vitamins and a variety of trace elements required by the human body, as well as SOD effective enzymes, super fiber, phenols and other nutrients. Since passion fruit pulp is rich in vitamins and proteins, proper intake of passion fruit can improve the body's immunity and help the body detoxify and beautify.

[0003] At present, passion fruit is mainly sold as fresh fruit on the market, and there are also products such as passion fruit preserves and passion fruit juice. In recent years, products such as fruit wine and fruit vinegar produced by fruit fermentation have been popular among consumers. Fruit wine brewing uses fruit as raw materials and produces fruit wine through the physiological metabolism of yeast strains. Therefore, the quality of the wine is directly affected by the performance of the strains. At present, in the brewing of passion fruit wine, commercial strains such as wine brewing yeast are often used to brew passion fruit wine. There is no yeast strain specifically suitable for the brewing of passion fruit wine. It has poor fermentation ability and may not be able to adapt to the acidic environment of passion fruit itself, and cannot fully show the flavor of passion fruit wine. Summary of the invention

[0004] In view of this, in order to solve some technical problems existing in the prior art, the present invention provides an ester-producing Saccharomyces cerevisiae and its application in wine brewing, and particularly relates to Saccharomyces cerevisiae G1 and its application in passion fruit wine fermentation. The Saccharomyces cerevisiae strain of the present invention can be used for the fermentation of passion fruit wine, and has the advantages of strong ester production ability and weak acid production ability compared with commercially available Angel yeast, and has stronger tolerance to SO2 in the external environment.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention first provides a brewer's yeast, which is named Saccharomyces cerevisiae G1 (G1 for short), and is deposited in China Center for Type Culture Collection, the address of the depository is Wuhan University, Wuhan, China, the deposit date is April 30, 2024, and the deposit number is CCTCC NO: M 2024815.

[0007] Furthermore, the brewer's yeast is an ester-producing brewer's yeast, which is derived from the passion fruit epidermis, and its 26S sequence is shown in SEQ.ID.No:1.

[0008] The saccharomyces cerevisiae G1 of the present invention is obtained by screening from the epidermis of passion fruit by gradient dilution combined with plate coating method. The present invention also provides a screening method for the saccharomyces cerevisiae, which comprises:

[0009] The passion fruit peel washing liquid was used as the sample liquid. After 10-fold gradient dilution, the appropriate gradient dilution liquid was selected and spread on the solid culture medium respectively. Cultured for 48 hours, several single colonies with yeast colony morphology on the plate were selected and cultured separately, and streaked and purified multiple times until the colony morphology was consistent, and then morphological and molecular biological identification was performed.

[0010] The colony characteristics of the brewer's yeast G1 described in the present invention are as follows: on the YPD culture medium, the colony is milky white, spherical, opaque, has a protrusion in the center, and has a smooth surface, regular edges, and is easy to pick up; on the WL culture medium, the colony is green, spherical, has a smooth surface, regular edges, has a protrusion in the center, and the color gradually fades to milky white from the center to the edge; cells under microscopic examination are mostly oval or spindle-shaped, showing a bud reproduction state.

[0011] The present invention has also been verified through experiments that the gas production capacity of the brewer's yeast G1 of the present invention is stronger than that of the commercially available Angel yeast; the brewer's yeast G1 has a certain ability to produce metabolites such as alcohol and acid, and has a stronger ester production capacity than the commercial Angel yeast, and has stronger environmental tolerance.

[0012] The 26S rDNA D1 / D2 sequence of the saccharomyces cerevisiae G1 of the present invention has a similarity of more than 99% with the 26S rDNA D1 / D2 sequences of most reported saccharomyces cerevisiae.

[0013] The present invention also provides application of the brewing yeast G1 in fruit wine brewing, and the fruit wine includes passion fruit wine.

[0014] When the brewer's yeast G1 of the present invention is used for passion fruit fermentation, the ester content in the passion fruit wine can be increased, and the flavor of the passion fruit wine can be increased.

[0015] The present invention also provides a method for brewing passion fruit wine, which comprises:

[0016] Sample pretreatment → pectinase hydrolysis → filtration → adjustment of sugar-acidity → inoculation of yeast → temperature-controlled fermentation → filtration and centrifugation → passion fruit wine → sterilization and disinfection.

[0017] Wash the passion fruit, cut it open and collect the pulp and seeds (or passion fruit pulp); add appropriate amount of water and enzyme to the passion fruit pulp, stir well and perform enzymolysis; filter and remove the seeds after enzymolysis; add baking soda to the pulp after removing the seeds to adjust the pH value and add white sugar to adjust the sugar content; add potassium metabisulfite and inoculate brewer's yeast for fermentation; filter the fermentation product, centrifuge it, take the supernatant and sterilize it to obtain passion fruit wine.

[0018] Wherein, the volume ratio of the passion fruit pulp to water is 3:1;

[0019] Furthermore, the dosage ratio of the enzyme to passion fruit pulp is: 0.4g:200mL, the enzyme is a mixture of cellulase and pectinase, and the mass ratio of the cellulase to pectinase is 1:5.

[0020] Furthermore, the enzymolysis is carried out in a 40° C. water bath for 2 hours with stirring every 15 minutes.

[0021] Furthermore, the baking soda is used to adjust the pH value to 3.5, and the white sugar is used to adjust the sugar content to 21.8°Bx.

[0022] Furthermore, the amount of potassium pyrosulfite added is such that the concentration of sulfur dioxide is 150 mg / L after adding potassium pyrosulfite.

[0023] Furthermore, the inoculation amount of the activated brewer's yeast is 2%.

[0024] Furthermore, the fermentation conditions are to control the fermentation temperature to 30° C. and ferment for 10 days.

[0025] More preferably, the filtration is performed using a 200-mesh filter, and the centrifugation is preferably performed at 8000 r / min and 4° C. for 15 min.

[0026] Further preferably, sterilization and disinfection is carried out using a quantitative amount of SO2.

[0027] The passion fruit wine brewing method of the present invention is briefly described as follows:

[0028] Further preferably, the brewer's yeast may be pretreated before inoculation, and the pretreatment method includes:

[0029] The preserved brewer's yeast was placed in a constant temperature incubator for activation culture and then inoculated into a YPD liquid culture medium for culture to obtain a seed solution; the seed solution was inoculated into a YPD liquid culture medium and cultured to the late logarithmic stage to obtain a fermentation solution; under a sterile state, the fermentation solution was centrifuged to collect the precipitate and then resuspended with sterile physiological saline to obtain a bacterial suspension for inoculation.

[0030] According to an embodiment of the present invention, the activation culture in the constant temperature incubator is an activation culture in a constant temperature incubator at 30°C for 48 hours, and the inoculation into YPD liquid culture medium is cultured at 30°C for 24 hours to obtain a seed liquid; the inoculation amount of the seed liquid inoculated into the YPD liquid culture medium is 1% (V / V), and the culture is carried out at 30°C to the late logarithmic stage as a fermentation liquid.

[0031] According to an embodiment of the present invention, the centrifugation is preferably performed at 8000 r / min for 15 min, and the amount of the precipitate and sterile saline is required to be resuspended with 2 mL of sterile saline for every 100 mL of fermentation liquid obtained by centrifugation.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] The present invention provides a yeast strain G1 obtained by screening, the screening source is passion fruit peel, and the strain has stronger gas production ability, stronger ester production ability, weaker acid production ability and stronger environmental tolerance compared with commercial Angel Yeast. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is the colony morphology of Saccharomyces cerevisiae on YPD solid culture medium; in the figure, A is the front colony image, and B is the side colony image.

[0035] Figure 2 This is the colony morphology of Saccharomyces cerevisiae on WL medium; in the figure, A is the front colony image, and B is the side colony image.

[0036] Figure 3 is the phylogenetic tree of Saccharomyces cerevisiae G1.

[0037] Figure 4 This is a comparison chart of the alcohol production capacity of Saccharomyces cerevisiae G1 and Angel Yeast.

[0038] Figure 5 This is a comparison chart of the ester production capacity of Saccharomyces cerevisiae G1 and Angel Yeast.

[0039] Figure 6 This is a comparison chart of the acid production capacity of Saccharomyces cerevisiae G1 and Angel Yeast.

[0040] Figure 7 This is a comparison chart of the gas production capacity of Saccharomyces cerevisiae G1 and Angel Yeast.

[0041] Figure 8 This is a comparison chart of the acid resistance of Saccharomyces cerevisiae G1 and Angel Yeast.

[0042] Fig. 9 This is a comparison chart of the SO2 tolerance of Saccharomyces cerevisiae G1 and Angel Yeast.

[0043] Fig.10This is a comparison chart of the alcohol tolerance of Saccharomyces cerevisiae G1 and Angel Yeast.

[0044] Fig.11 is the growth curve of Saccharomyces cerevisiae G1.

[0045] Fig.12 It is passion fruit wine fermented by Saccharomyces cerevisiae G1. DETAILED DESCRIPTION

[0046] The present invention is further explained below in conjunction with the examples, which are only used to illustrate the present invention and are not used to limit the scope of the present invention. For those skilled in the art, any modifications made without departing from the content, spirit and scope of the present invention are within the scope of protection of the present invention. The experimental methods in the examples where specific conditions are not indicated are all in accordance with conventional conditions; the reagents and biological materials, unless otherwise specified, can be obtained from commercial sources.

[0047] The culture medium used in the embodiments of the present invention includes the following:

[0048] YPD liquid medium: 10 g / L yeast powder, 20 g / L peptone, 20 g / L glucose, fixed to volume with distilled water. YPD solid medium is supplemented with 20 g / L agar.

[0049] WL medium: purchased from Beijing Solebow Technology Co., Ltd.

[0050] TTC upper culture medium: TTC (triphenyltetrazolium hydrochloride) 0.5 g / L, glucose 5 g / L, agar 15 g / L, distilled water to volume.

[0051] TTC lower layer culture medium: glucose 10g / L, peptone 2g / L, yeast powder 1.5g / L, dipotassium hydrogen phosphate 1g / L, MgSO4·7H2O 4g / L, agar 20g / L, distilled water to volume.

[0052] Example 1: Isolation and purification of yeast

[0053] Passion fruit peel was washed with sterile saline to obtain washing solution, which was diluted 10 times to obtain dilutions of different concentrations. The dilutions of different concentrations were evenly coated on the solid culture medium, and 3 parallels were made for each dilution gradient. The coated culture medium plate was placed in a 30°C constant temperature incubator for 48 hours and the colony state was observed; the dilution of 10 was selected to obtain the dilution of 10. -6 The colonies on the plate coated with the dilution solution are spherical, milky white, opaque single colonies. They are streaked individually and purified by multiple streaking on YPD solid medium until the bacterial morphology is consistent. The purified strains are stored in a 4° refrigerator for later use.

[0054] Example 2: Storage of yeast

[0055] The yeast isolated in Example 1 was stored in the following manner:

[0056] (1) Storage on plates or slants: The yeast isolated in Example 1 was inoculated onto a YPD plate or slant medium, cultured in a 30°C constant temperature incubator for 48 h, and then stored in a 4°C refrigerator for short-term use.

[0057] (2) Glycerol storage: The yeast isolated in Example 1 was inoculated onto a YPD plate medium, cultured at 30°C for 48 h, and then inoculated onto a YPD liquid medium and cultured for 18-20 h. The liquid culture medium was mixed with sterile 30% glycerol at a ratio of 1:1 and stored in a -80°C refrigerator.

[0058] Example 3: Rescreening of yeasts with strong ester production ability

[0059] The strain screened in Example 1 and commercial Angel Yeast were inoculated into the treated passion fruit pulp at an inoculation rate of 2%, respectively, and fermented at a constant temperature of 30°C for 10 days, and the determination was carried out with reference to the indicator method in GB / T10345-2022 "Analysis Method for Liquor". The results are as follows Figure 5 As shown, taking the commercially available Angel yeast as a control, the present invention further screened out a yeast strain with significantly higher ester production ability than Angel yeast. The ester production in the wine fermented by the yeast strain G1 screened by the present invention was 2.29 g / L, which was 18% higher (0.35 g / L higher) than the ester production in the wine fermented by the commercial Angel yeast (1.94 g / L).

[0060] Among them, the processing method of passion fruit pulp is:

[0061] Select passion fruits with fresh and ripe stalks, wash them, cut them open and collect the pulp and seeds inside to make passion fruit pulp. Add an appropriate amount of water (the volume ratio of pulp to water is 3:1) to the processed passion fruit pulp, add 0.2% enzyme (mass volume percentage, the ratio of enzyme to passion fruit pulp is: 0.4g:200mL, the enzyme is a mixture of cellulase and pectinase, the mass ratio of the two is 1:5, dissolved in a small amount of water and added), and stir evenly. Enzymolysis in a 40℃ water bath for 2h, stirring every 15min. Filter the passion fruit after the water bath with a 400-mesh filter to remove the pulp and seeds of the passion fruit. Use baking soda to adjust the pH value of the passion fruit pulp to 3.5, and use white sugar to adjust its sugar content to 21.8°Bx. Potassium pyrosulfite is added to the pulp after adjusting the sugar and acidity (the amount of potassium pyrosulfite added is such that the sulfur dioxide concentration is 150 mg / L after adding potassium pyrosulfite) to obtain treated passion fruit pulp.

[0062] Furthermore, the screened yeasts were identified by morphology and molecular biology.

[0063] Step 1: Morphological identification

[0064] (1) Colony morphology under YPD medium: The strain obtained after purification in Example 1 was inoculated on YPD solid medium, and its colony morphology was observed after 48 hours. Figure 1 This is the colony morphology diagram under YPD solid culture medium; Figure 1 As shown, the colonies are milky white, spherical, opaque, with a bulge in the center, a smooth surface, regular edges and are easy to pick up.

[0065] (2) Colony morphology under WL medium: The strain obtained after purification in Example 1 was inoculated on WL solid medium, and its colony morphology was observed after 3-5 days. Figure 2 This is the colony morphology under WL medium; Figure 2 As shown, the colonies are green, spherical, smooth in surface, with regular edges and a bulge in the center, and the color gradually fades to milky white from the center to the edge.

[0066] Step 2: Molecular Biology Identification

[0067] In order to identify the species of the yeast strains, molecular biology experiments were performed on them. The specific steps are as follows:

[0068] (1) Bacterial Activation

[0069] The yeast strain in Example 1 was inoculated into YPD solid culture medium and cultured in a constant temperature incubator at 30° C. for 48 h.

[0070] (2) PCR amplification

[0071] Colony PCR was performed on the yeast strain cultured in step (1). The primers used for yeast strain identification in the present invention are yeast 26S rDNA gene D1 / D2 region sequence amplification primers, and the sequence thereof is:

[0072] ①Forward primer NL1: 5′-GCATATCAATAAGCGGAGGAAAAG-3′;

[0073] ②Reverse primer NL4: 5′-GGTCCGTGTTTCAAGACGG-3′.

[0074] The PCR reaction system is as follows: DNA template is a small amount of bacteria picked up by the tip of the gun (20 μL of the tip), 0.8 μL of forward primer, 0.8 μL of reverse primer, Premix Taq TM 15 μL of ddH2O to make up to 30 μL of total system.

[0075] The PCR amplification program was as follows: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 35 s, for a total of 34 cycles, and finally extension at 72°C for 7 min.

[0076] Agarose gel electrophoresis: The PCR amplification product was verified by 1% agarose gel electrophoresis, and the yeast band was found to be located at about 600 bp.

[0077] (3) Sequence analysis and phylogenetic tree construction

[0078] The PCR amplification products that were qualified by agarose gel electrophoresis were sent to Shanghai Jieli Biotechnology Co., Ltd. for sequencing. The sequencing results were compared and analyzed by the BLAST program in NCBI, and the similarity with the 26SrDNA D1 / D2 region sequences of other reported Saccharomyces cerevisiae strains was more than 99%; in order to further show the relationship between the sequenced strains and the known Saccharomyces cerevisiae, the phylogenetic tree was constructed using MEGA 11 biological software, as shown in Figure 4 As shown, the bacteria was identified as Saccharomyces cerevisiae G1.

[0079] The 26S sequence of Saccharomyces cerevisiae G1 is shown in SEQ.ID.No:1:

[0080] caagacgggc ggcatataac cattatgcca gcatccttga cttacgtcgc agtcctcagtcccagctggc agtattccca

[0081] caggctataa tacttaccga ggcaagctac attcctatgg atttatcctg ccaccaaaactgatgctggc ccagtgaaat gcgagattcc

[0082] cctacccaca aggagcagag ggcacaaaac accatgtctg atcaaatgcc cttccctttcaacaatttca cgtacttttt cactctcttt

[0083] tcaaagttct tttcatcttt ccatcactgt acttgttcgc tatcggtctc tcgccaatatttagctttag atggaattta ccacccactt

[0084] agagctgcattcccaaacaa ctcgactctt cgaaggcact ttacaaagaa ccgcactcctcgccacacgg gattctcacc ctctatgacg

[0085] tcctgttcca aggaacatag acaaggaacg gccccaaagt tgccctctcc aaattacaactcgggcaccg aaggtaccag atttcaaatt

[0086] tgagcttttg ccgcttcact cgccgttat aaggcaatcc cggttggttt cttttcctcc gaa

[0087] The strain was sent to the China Center for Type Culture Collection for preservation on April 30, 2024, with the address: Wuhan University, Wuhan, China, and the preservation number is: CCTCC NO:M 2024815.

[0088] Example 4: Physiological and biochemical characteristics of Saccharomyces cerevisiae G1

[0089] In this example, the wine, ester, acid and gas production capabilities of Saccharomyces cerevisiae G1 in the process of preparing passion fruit wine were investigated, and the acid resistance, SO2 resistance, alcohol resistance, bacterial growth curve and bacterial toxicity of Saccharomyces cerevisiae G1 were investigated. The relevant methods and results are as follows:

[0090] (1) Alcohol production capacity

[0091] The screened strains and commercial Angel Yeast were inoculated into the processed passion fruit pulp at a 2% inoculation rate, and fermented at a constant temperature of 30℃ for 10 days. The alcohol content was measured using a refractometer. The commercial strain Angel Yeast was used as a control, and each group was measured in parallel for 3 times. Figure 4 As shown, with the commercially available Angel yeast as the control, the alcohol production performance of Saccharomyces cerevisiae G1 is as stable as that of Angel yeast, and the alcohol content is around 9.8°.

[0092] Among them, the processing method of passion fruit pulp is:

[0093] Select passion fruits with fresh and ripe stalks, wash them, cut them open and collect the pulp and seeds inside to make passion fruit pulp. Add an appropriate amount of water (the volume ratio of pulp to water is 3:1) to the processed passion fruit pulp, add 0.2% enzyme (mass volume percentage, the ratio of enzyme to passion fruit pulp is: 0.4g:200mL, the enzyme is a mixture of cellulase and pectinase, the mass ratio of the two is 1:5, dissolved in a small amount of water and added), and stir evenly. Enzymolysis in a 40℃ water bath for 2h, stirring every 15min. Filter the passion fruit after the water bath with a 400-mesh filter to remove the pulp and seeds of the passion fruit. Use baking soda to adjust the pH value of the passion fruit pulp to 3.5, and use white sugar to adjust its sugar content to 21.8°Bx. Potassium pyrosulfite is added to the pulp after adjusting the sugar and acidity (the amount of potassium pyrosulfite added is such that the sulfur dioxide concentration is 150 mg / L after adding potassium pyrosulfite) to obtain treated passion fruit pulp.

[0094] (2) Acid production capacity

[0095] The selected strains and commercial Angel Yeast were inoculated into the processed passion fruit pulp at a 2% inoculation rate, and fermented at a constant temperature of 30°C for 10 days. The total acid determination direct titration method in accordance with GB / T15038-2006 "General Analytical Methods for Grape and Fruit Wine" was used for detection. Figure 6 As shown, with the commercially available Angel yeast as the control, the acid production ability of the brewing yeast G1 of the present invention is significantly weaker than that of Angel yeast. The total acidity of the fruit wine fermented by Angel yeast is 23.92 g / L, and the total acidity of the wine fermented by the brewing yeast G1 of the present invention is 22.28 g / L. The acidity of the passion fruit wine prepared by the brewing yeast G1 of the present invention is more suitable.

[0096] (3) Gas production capacity

[0097] The Duroc tube fermentation method was selected to determine the gas production ability of yeast. The gas production ability of yeast can characterize the growth rate of the strain. Referring to the method of Xie Xinyu et al. (Xie Xinyu et al., Research on Screening of Strawberry Wine Strawberry Strain and Sequential Mixed Fermentation Technology. Fuyang Normal University, 2024. DOI: 10.27846 / d.cnki.gfysf.2022.000288.), a single activated strain (activated and cultured in a constant temperature incubator at 30°C for 48 hours) was picked, and cultured in YPD liquid culture medium at 30°C for 24 hours. The seed liquid was inoculated into a test tube containing YPD liquid culture medium at an inoculation rate of 2% (V / V). An inverted Duroc tube without bubbles was placed at the bottom of the test tube, and cultured at a constant temperature of 30°C. The start time of gas production of the yeast strain and the full time of the Duroc tube were observed, and 3 groups of replicates were set up for each group. The height of the gas produced in the Duroc tube was recorded every 1 hour, and yeast with excellent gas production ability was screened according to the start time of gas production and the full time of the Duroc tube. The results are as follows Figure 7As shown, taking the commercially available Angel yeast as the control, the duocupancy tube fermentation started at 4.5 hours and the duocupancy tube was full at 10 hours, while the strain G1 screened by the present invention started at 5.5 hours and the duocupancy tube was full at 11 hours, which proved that the gas production ability of the brewer's yeast G1 of the present invention is stronger than that of the commercially available Angel yeast.

[0098] (4) Acid resistance

[0099] After sterilizing the glass bottles filled with YPD liquid culture medium, citric acid was added, and the concentration of citric acid in the culture medium was adjusted to 15g / L, 18g / L, 21g / L, 24g / L, and 27g / L, respectively. The activated yeast (activated and cultured in a constant temperature incubator at 30°C for 48h) was inoculated into the glass bottles at a 2% (V / V) inoculation rate. Three replicates were set up for each group. After constant temperature culture at 30°C for 10h, the absorbance was measured at a wavelength of 600nm using an enzyme marker. The results are as follows Figure 8 As shown, with commercial Angel yeast as the control, the acid resistance of strain G1 is as stable as that of commercial Angel yeast.

[0100] (5) SO2 resistance

[0101] Potassium pyrosulfite was added to a sterilized glass bottle containing YPD liquid culture medium, so that the SO2 concentration in the culture medium was adjusted to 100 mg / L, 150 mg / L, 200 mg / L, 250 mg / L, and 300 mg / L. The activated yeast was inoculated into the glass bottle at a 2% (V / V) inoculation rate. Three replicates were set up for each group. After constant temperature cultivation at 30°C for 10 hours, the absorbance was measured at a wavelength of 600 nm using an ELISA reader. The results are as follows: Fig. 9 As shown, taking the commercially available Angel Yeast as the control, when the SO2 concentration is 0-250 mg / L, the growth state of the brewer's yeast G1 of the present invention is more stable.

[0102] (6) Alcohol resistance

[0103] Anhydrous ethanol was added to the sterilized glass bottles containing YPD liquid medium, so that the volume fraction of ethanol in the medium was 8%, 10%, 12%, 14%, and 16%, respectively. The activated yeast was inoculated into the glass bottles at a 2% (V / V) inoculation rate, and 3 replicates were set up for each group. After constant temperature culture at 30°C for 10 hours, the absorbance was measured at a wavelength of 600nm using an enzyme marker. The results are shown in Figure 2. Fig.10 As shown, with commercial Angel yeast as the control, the alcohol tolerance of strain G1 was as stable as that of commercial Angel yeast.

[0104] (7) Growth curve

[0105] The growth curve is a standard curve that describes the delay phase, logarithmic phase and stable phase under certain culture conditions, which can provide a theoretical basis for subsequent experiments. The specific steps of the growth curve determination are: take a single colony from the solid culture medium stored at 4°C and streak it on the YPD solid culture medium, place it in a 30°C constant temperature incubator for activation and culture for 48 hours, then pick a single yeast colony from the activated solid culture medium and inoculate it into the YPD liquid culture medium, and culture it at 30°C for 24 hours as the seed liquid. Use YPD liquid culture medium as the fermentation medium, inoculate it at a 1% inoculation rate, and culture it at a constant temperature of 30°C. From the beginning of inoculation, take 200uL from the fermentation liquid every 2 hours, use the blank culture medium as the control, and measure its absorbance at 600nm.

[0106] The growth curve of the above-mentioned Saccharomyces cerevisiae G1 was plotted with the above-mentioned absorbance value as the ordinate and the culture time as the abscissa. Fig.11 As shown in the figure, the growth of yeast showed typical microbial growth characteristics. It was in the growth lag phase from 0 to 4 hours, and entered the logarithmic growth phase after 4 hours. The OD value of Saccharomyces cerevisiae G1 was the largest at the 14th hour. At this time, the bacterial concentration was the highest and the activity was the strongest. After that, it gradually entered the stable growth phase. When brewing passion fruit wine subsequently, Saccharomyces cerevisiae G1 was selected to be cultured to the 14th hour and the bacterial cells were collected.

[0107] (8) Acute toxicity test of Saccharomyces cerevisiae G1

[0108] The culture medium of Saccharomyces cerevisiae G1 was collected and centrifuged at 4°C and 8000 rpm for 15 min. The collected bacteria were washed and centrifuged twice and then sent to Qingdao Kechuang Quality Inspection Co., Ltd. for acute toxicity test.

[0109] The test adopted the limit method, and the bacteria were prepared as the test substance by adding pure water. The test animals were 20 KM mice, half of which were male and half were female (the females had not mated and were not pregnant). They were given a single oral gavage at a dose of 10,000 mg / kg·bw, and the gavage volume was 20 mL / kg·bw. The animals were required to fast before the test. The KM mice fasted for 4 hours and had free access to water. They continued to fast for 1 hour after being given the test substance of brewer's yeast G1. After 14 days of observation, the KM mice did not show any abnormal symptoms or death within 14 days of being given the test substance. The changes in body weight are shown in Table 1. After the end of the test observation, all animals were killed and a gross anatomical examination was performed, and no abnormalities were found. The test results proved that the animals did not produce toxic reactions, no signs of poisoning were observed, and no deaths occurred.

[0110] Table 1. Body weight changes of animals in acute oral toxicity test

[0111]

[0112] No mice died in the 14-day acute oral toxicity test, indicating that the acute oral toxicity LD50 of Saccharomyces cerevisiae G1 to KM mice 50 ≥10000mg / kg, according to GB15193.3-2014 National Food Safety Standard Acute Oral Toxicity Test, when LD 50 When the concentration is ≥5000 mg / kg, the test substance is practically non-toxic, which indicates that the toxicity level of Saccharomyces cerevisiae G1 is practically non-toxic.

[0113] Example 5: Brewing of passion fruit wine using Saccharomyces cerevisiae G1

[0114] The cerevisiae yeast G1 separated and screened by the present invention may be pretreated before inoculation, and the pretreatment method includes:

[0115] Pick a single colony from the solid culture medium stored at 4°C and streak it on the YPD solid culture medium, place it in a constant temperature incubator at 30°C for activation and culture for 48 hours, then pick a single yeast colony from the activated solid culture medium and inoculate it into the YPD liquid culture medium, and culture it at 30°C for 24 hours as the seed liquid. The seed liquid is inoculated into the YPD liquid culture medium at an inoculation rate of 1% (V / V), and cultured at 30°C until the late logarithmic stage as the fermentation liquid.

[0116] Under sterile conditions, the fermentation liquid cultured to the late logarithmic stage was transferred to a sterile centrifuge tube, centrifuged at 8000r / min for 15min, the supernatant was discarded and the precipitate was collected, and the precipitate obtained by centrifugation of each 100mL fermentation liquid was resuspended with 2mL of sterile saline to obtain a bacterial suspension and count the viable bacteria. According to a certain ratio of viable bacteria, the fermentation was carried out to prepare passion fruit wine.

[0117] The preparation method of passion fruit wine comprises:

[0118] Sample pretreatment → Pectinase hydrolysis → Filtration → Adjust sugar acidity → Inoculate yeast → Temperature control fermentation → Filtration centrifugation → Passion fruit wine → Sterilization and disinfection

[0119] Sample pretreatment: Select passion fruits with fresh and ripe stalks, wash them, cut them open and collect the pulp and seeds inside.

[0120] Enzyme hydrolysis: Add an appropriate amount of water to the processed passion fruit pulp (the volume ratio of pulp to water is 3:1), add 0.2% enzyme (mass volume percentage, the ratio of enzyme to passion fruit pulp is: 0.4g:200mL, the enzyme is a mixture of cellulase and pectinase, the ratio of cellulase and pectinase is 1:5, dissolved in a small amount of water and added), stir evenly. Enzyme hydrolyze in a 40℃ water bath for 2h, stirring every 15min.

[0121] Filtration: Use a 400-mesh filter to filter the passion fruit after the water bath to remove the pulp and seeds of the passion fruit.

[0122] Adjust sugar and acidity: Use baking soda to adjust the pH value of passion fruit pulp to 3.5, and use white sugar to adjust its sugar content to 21.8°Bx.

[0123] Inoculating yeast: After adding potassium pyrosulfite (the amount of potassium pyrosulfite added is such that the sulfur dioxide concentration is 150 mg / L after adding potassium pyrosulfite), the pretreated yeast is inoculated into the passion fruit pulp at an inoculation amount of 2%.

[0124] Temperature-controlled fermentation: The fermentation temperature is controlled at 30°C and fermented for 10 days.

[0125] Filtration and centrifugation: Filter the fermented passion fruit wine with a 200-mesh filter, centrifuge at 8000r / min and 4°C for 15min, and take the supernatant.

[0126] Sterilization: Use a certain amount of SO2 to sterilize the centrifuged passion fruit wine.

[0127] Passion fruit wine fermented with Saccharomyces cerevisiae G1 was sterilized and disinfected. Fig.12 At the same time, the alcohol content was measured by a refractometer, which was about 9.8°.

[0128] The above embodiments are detailed descriptions of the preferred embodiments of the present invention, but the embodiments are not intended to limit the scope of the patent application of the present invention. For those skilled in the art, any modifications made without departing from the content, spirit and scope of the present invention are within the protection scope of the present invention.

Claims

1. A brewer's yeast, It is characterized in that The brewer's yeast is classified and named Saccharomyces cerevisiae G1, and is deposited in the China Center for Type Culture Collection. The address of the depository is Wuhan University, Wuhan, China. The deposit date is April 30, 2024, and the deposit number is CCTCC NO: M 2024815.

2. The saccharomyces cerevisiae according to claim 1, It is characterized in that The brewer's yeast is derived from passion fruit peel.

3. The brewer's yeast according to claim 1, It is characterized in that The Saccharomyces cerevisiae is an ester-producing Saccharomyces cerevisiae, and its 26S sequence is shown in SEQ.ID.No:

1.

4. A product containing the brewer's yeast according to any one of claims 1 to 3.

5. Use of the brewing yeast according to any one of claims 1 to 3 or the product according to claim 4 in fruit wine brewing.

6. The use according to claim 5, wherein the fruit wine is passion fruit wine.

7. A method for preparing passion fruit wine, It is characterized in that Brewing using the brewing yeast described in any one of claims 1 to 4 or the product described in claim 4.

8. The method according to claim 7, It is characterized in that Wash the passion fruit, cut it open and collect the passion fruit pulp; add appropriate amount of water and enzyme to the passion fruit pulp, stir well and perform enzymolysis; filter to remove seeds after enzymolysis; adjust the pH value and sugar content of the pulp after removing seeds; add potassium metabisulfite, inoculate brewer's yeast for fermentation; filter the fermentation product, centrifuge it, take the supernatant and sterilize it to obtain passion fruit wine.

9. The method according to claim 8, It is characterized in that The dosage ratio of the enzyme to passion fruit pulp is: 0.4 g: 200 mL, the enzyme is a mixture of cellulase and pectinase, and the mass ratio of the cellulase to the pectinase is 1:5; The enzymolysis was carried out in a water bath at 40° C. for 2 h, with stirring every 15 min.

10. The method according to claim 8, It is characterized in that The pH value and sugar content are adjusted with baking soda and white sugar respectively; The amount of potassium pyrosulfite added is such that the sulfur dioxide concentration is 100-250 mg / L, preferably 150 mg / L. The inoculation amount of the saccharomyces cerevisiae is 2%; The fermentation condition is to ferment at a constant temperature of 30° C. for 10 days.

Images