Acinetobacter HUNAN-1 and application thereof in prevention and treatment of sogatella furcifera

Abstract

The invention relates to an acinetobacter strain HANN-1 and application thereof in prevention and treatment of sogatella furcifera, the culture process of the acinetobacter strain is simple, the acinetobacter strain has the advantage that a large number of acinetobacter strains can be obtained through culture in a short time, and the separated acinetobacter strain has remarkable insecticidal activity on sogatella furcifera and has a good application prospect. The invention further proves that the fermentation liquor of the bacillus subtilis has better insecticidal activity on sogatella furcifera, provides a new research thought for biological prevention and control of pests, and has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural microorganisms, and particularly relates to a strain of Acinetobacter HUNAN-1 and application thereof in preventing and controlling white-backed planthoppers. Background Art

[0002] Acinetobacter is a Gram-negative coccobacillus belonging to the family Moraxellaceae and the class γ-Proteobacteria. It was first isolated from soil and is commonly found in water and soil. In addition to the environment, Acinetobacter is also a symbiotic bacterium in insects, such as houseflies, Aedes albopictus, and planthoppers. Acinetobacter is also a common pathogen in hospitals, causing a variety of human diseases, such as sepsis, meningitis, urinary tract infections, skin infections, and gastroenteritis. Among them, Acinetobacter baumanni is a common pathogen in hospitals. In addition to its pathogenicity, Acinetobacter has the ability to degrade halogenated anilines, various chloroanilines, petroleum hydrocarbons, nitrobenzene, and phosphorus. In addition, Acinetobacter has been shown to have insecticidal activity. For example, it has been reported that a strain of Acinetobacter johnsonii MB44 has nematicidal activity.

[0003] White-backed planthoppers [Sogatella furcifera (Horváth)] belong to the Delphacidae family of the order Hemiptera of the class Insecta. They cause serious damage to rice and have occurred on a large scale in China, causing significant economic losses. Therefore, in 2020, the Ministry of Agriculture and Rural Affairs of my country included white-backed planthoppers in the "List of Class I Crop Pests and Diseases". Studies have found that Acinetobacter soli of the genus Acinetobacter exists in the intestines of white-backed planthoppers. It has also been proven that Acinetobacter in white-backed planthoppers can be cultured in vitro, which provides support for in vitro research on Acinetobacter.

[0004] At present, there are only reports on the in vitro culture of Acinetobacter soli, a symbiotic bacterium in white-backed planthoppers, and no research on the interaction between this strain and white-backed planthoppers. Summary of the invention

[0005] The present invention provides an Acinetobacter soli strain HUNAN-1, which has been deposited in the China Center for Type Culture Collection on September 11, 2024, with a deposit number of CCTCC M 20241953.

[0006] The present invention also provides a biocontrol agent for preventing and controlling white-backed planthoppers, comprising the Acinetobacter HUNAN-1 described in claim 1 or one or more of its spore suspension, culture solution, fermentation solution and fermentation supernatant.

[0007] Furthermore, the biocontrol agent also includes an acceptable auxiliary material or carrier.

[0008] The present invention also provides the use of the acinetobacter or the biocontrol agent in controlling white-backed planthoppers or in preparing products for controlling white-backed planthoppers.

[0009] The present invention also provides a method for preventing and controlling white-backed planthoppers, which comprises using the above-mentioned Acinetobacter HUNAN-1 or a biocontrol agent for treatment.

[0010] Furthermore, the Acinetobacter HUNAN-1 strain was enriched and cultured in LB medium until OD 600 =1.7, it can be used for the prevention and control of white-backed planthoppers.

[0011] Furthermore, the bacterial suspension was further centrifuged at 10000 r / min for 10 min, the supernatant was filtered with a 0.22 μm sterile filter membrane to obtain a bacterial fermentation liquid, and the obtained bacterial fermentation liquid was used for the prevention and treatment of white-backed plant hoppers.

[0012] Beneficial effects: The culture process of the Acinetobacter strain of the white-backed planthopper of the present invention is simple, and has the advantage of obtaining a large number of Acinetobacter strains in a short time; the isolated Acinetobacter strain has insecticidal activity against the white-backed planthopper, which further proves that the fermentation liquid of the Acinetobacter strain has insecticidal activity against the white-backed planthopper. It provides a new research idea for the biological control of pests and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0014] Figure 1 This is the appearance of the colony of Acinetobacter sphaeroides HUNAN-1;

[0015] Figure 2 This is the Gram staining image of Acinetobacter solvatus HUNAN-1;

[0016] Figure 3 This is the appearance of the bacteria of Acinetobacter furciferum HUNAN-1 (photographed by scanning electron microscope);

[0017] Figure 4 This is the growth curve of Acinetobacter furciferum HUNAN-1;

[0018] Figure 5 The insecticidal activity of Acinetobacter HUNAN-1 against white-backed planthoppers;

[0019] Figure 6 The insecticidal activity of crude HUNAN-1 extract of Acinetobacter against white-backed planthopper. DETAILED DESCRIPTION

[0020] The following examples are only used to more clearly illustrate the technical scheme of the present invention, and are therefore only used as examples, and cannot limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise stated, the reagents and materials used in the following examples are commercially available.

[0021] Example 1 Acinetobacter soli HUNAN-1 strain acquisition and identification

[0022] 1. Morphological characteristics of bacteria:

[0023] Take 20 white-backed planthopper nymphs, soak them in 75% ethanol for 3 minutes, and then rinse them with sterile deionized water five times. Put the white-backed planthopper in a centrifuge tube, add 1 mL of sterile deionized water and homogenize, and centrifuge the homogenized sample at 5000r / min for 5 minutes. Add the supernatant to a conical flask containing 100 mL of inorganic salt culture medium, with acetamiprid as the only carbon source. Culture at 200rpm / min and 37°C for 2 days. Spread the cultured bacterial solution on a solid inorganic salt culture medium, and collect the colonies after culturing in an incubator at 37°C for 24 hours. The colonies are white, round, smooth, and have neat edges ( Figure 1 ); Gram staining was negative ( Figure 2 ); the bacteria are short rod-shaped, without spores and flagella ( Figure 3 ).

[0024] Among them, the formula of inorganic salt culture medium is as follows:

[0025] Magnesium sulfate heptahydrate (MgSO4·7H2O): 0.2g

[0026] Ammonium sulfate ((NH4)2SO4): 0.5g

[0027] Potassium dihydrogen phosphate (KH2PO4): 0.5g

[0028] Sodium chloride (Nacl): 1.0g

[0029] Potassium hydrogen phosphate (K2HPO4): 1.5g

[0030] Distilled water: 1000mL

[0031] Add 1.5%-2% agar to the solid culture medium and sterilize at 121°C for 30 min.

[0032] 2. Scanning electron microscopy (HITACHI Regulus 8100) characterization

[0033] After enriching the HUNAN-1 strain of Acinetobacter using LB liquid medium, the bacteria were centrifuged (10,000 r / min), washed twice with PBS, and stored in electron microscope fixative. After dehydration, drying, gold spraying, etc., scanning electron microscopy (HITACHI Regulus 8100) was performed for characterization. Figure 3 Shown: The bacteria are rod-shaped and of size (1.2-2.5 μm in length and 0.5-0.8 μm in width).

[0034] 3.16S rRNA sequence analysis

[0035] The bacterial liquid of Acinetobacter HUNAN-1 was amplified with 16S rRNA universal primers (27F: AGAGTTTGATCCTGGCTCAG; 1492R: GGTTACCTTGTTACGACTT), and the product was sequenced on a machine to obtain the 16S rRNA sequence of Acinetobacter solvator HUNAN-1; DNA sequencing analysis: the 16S rDNA sequence of the bacterium consists of 1462 bases. The nucleotide homology of the 16S rDNA sequence of Acinetobacter HUNAN-1 and the 16S rDNA sequence registered in GenBank was compared using the BLAST program, and the result showed that the sequence homology with the reported Acinetobacter soli reached 100%, indicating that the isolate was Acinetobacter soli of the genus Acinetobacter.

[0036] Based on the morphological characteristics, Gram staining results and 16S rRNA sequence analysis results of the Acinetobacter soli HUNAN-1 strain, it was identified as Proteobacteria, Moraxellaceae, γ-Proteobacteria, and Acinetobacter genus, and was named Acinetobacter soli HUNAN-1. It was deposited in the China Center for Type Culture Collection on September 11, 2024, with the preservation number CCTCC M 20241953.

[0037] Example 2 Insecticidal effect of Acinetobacter soli HUNAN-1 on white-backed planthopper

[0038] 1. Verify the insecticidal effect of the bacterial solution of Acinetobacter HUNAN-1 on white-backed planthoppers, including the following steps:

[0039] 1) The above-mentioned Acinetobacter HUNAN-1 strain was enriched and cultured in LB medium, and the bacterial solution was cultured to OD 600 =1.7.

[0040] 2) Wrap the roots of 20 rice seedlings of uniform growth with absorbent cotton and soak them, place them in a disposable plastic cup, and inoculate 20 4N nymphs of uniform size and good growth condition.

[0041] 3) Spray 2 mL of HUNAN-1 bacterial solution of Acinetobacter spp. and use Escherichia coli bacterial solution with the same OD value as a control. Repeat each treatment 4 times / cup. Place in an incubator at 26±1℃ and observe and record the number of deaths at 24h, 48h, and 72h.

[0042] The results showed that compared with the control, the white-backed planthoppers treated with the bacterial solution of Acinetobacter spp. HUNAN-1 showed obvious mortality (see Figure 5 ), with a mortality rate of up to 99%, proving that the bacterial liquid of Acinetobacter HUNAN-1 has significant insecticidal activity against white-backed planthoppers.

[0043] 2. Verify the insecticidal effect of the fermentation liquid of the Acinetobacter HUNAN-1 strain on white-backed planthoppers, including the following steps:

[0044] 1) The above-mentioned Acinetobacter HUNAN-1 strain was enriched and cultured in LB medium, and the bacterial solution was cultured to OD 600 =1.7. The bacterial suspension was centrifuged at 10000r / min for 10min, and the supernatant was filtered with a 0.22μm sterile filter membrane to obtain bacterial fermentation broth; PBS buffer was added to the precipitated bacteria at the bottom of the tube, ultrasonically disrupted, and filtered with a 0.22μm sterile filter membrane to obtain cell disruption liquid.

[0045] 2) Wrap the roots of 20 rice seedlings of uniform growth with absorbent cotton and soak them, place them in a disposable plastic cup, and inoculate 20 4N nymphs of uniform size and good growth condition.

[0046] 3) Spray 2 mL of bacterial fermentation liquid and cell disruption liquid respectively, use LB medium and PBS buffer as blank control respectively, repeat each treatment 4 times / cup. Place in a 26±1℃ incubator, observe and record the number of deaths at 24h, 48h, and 72h.

[0047] The results showed that compared with the control, the fermentation liquid of Acinetobacter HUNAN-1 had a lethal effect on white-backed planthoppers, while the cell lysate had no obvious lethal effect on white-backed planthoppers (see Figure 6 ), which proved that the fermentation liquid of Acinetobacter HUNAN-1 had insecticidal activity against white-backed planthoppers.

[0048] The above experiments show that Acinetobacter HUNAN-1 has a significant insecticidal effect on white-backed planthoppers, and the fermentation liquid of the strain also has a good insecticidal effect on white-backed planthoppers.

[0049] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. A strain of Acinetobacter soli HUNAN-1 was deposited in the China Center for Type Culture Collection on September 11, 2024, with the deposit number CCTCC M 20241953.

2. A biocontrol agent for controlling white-backed planthopper, characterized in that: Contains the Acinetobacter HUNAN-1 described in claim 1 or one or more of its spore suspension, culture liquid, fermentation liquid and fermentation supernatant.

3. The biocontrol agent according to claim 2, characterized in that The biocontrol agent also includes acceptable adjuvants or carriers.

4. Use of the Acinetobacter described in claim 1 or the biocontrol agent described in any one of claims 2-3 in controlling white-backed planthoppers or in preparing products for controlling white-backed planthoppers.

5. A method for controlling white-backed planthoppers, characterized in that: The treatment is carried out using the Acinetobacter HUNAN-1 described in claim 1 or the biocontrol agent described in any one of claims 2-3.

6. The method according to claim 5, characterized in that The Acinetobacter HUNAN-1 strain was enriched and cultured in LB medium until OD 600 =1.7, it can be used for the prevention and control of white-backed planthoppers.

7. The method according to claim 6, characterized in that The bacterial suspension was further centrifuged at 10000 r / min for 10 min, and the supernatant was filtered with a 0.22 μm sterile filter membrane to obtain a bacterial fermentation liquid, which was used for the prevention and treatment of white-backed plant hoppers.

Images