Serum exosome tsRNA molecule tRF-1003 and application thereof

Abstract

The invention discloses a serum exosome tsRNA (Ribonucleic Acid) molecule tRF-1003 and an application of the serum exosome tsRNA molecule tRF-1003. The expression of the tRF-1003 in an R / RMM bone marrow specimen is prompted to be increased based on next-generation sequencing, the expression of the tRF-1003 is detected through qPCR, the result shows that the level of the tRF-1003 in an R / RMM serum exosome is remarkably increased compared with that of NDMM, the expression of the tRF-1003 in R / RMM and NDMM exosome-free serum is relatively low, the tRF-1003 is prompted to enter blood circulation mainly through exosome release, and the tRF-1003 can be used as a marker for R / RMM diagnosis or prognosis, so that the kit has a good application prospect. The tRF-1003 molecules and in-vitro endothelial cells are co-incubated, the tRF-1003 molecules have important significance in the field of promoting angiogenesis, and meanwhile, it is found that the inhibitor of the tRF-1003 can cause reduction of the proliferation rate of tumor cells.

Description

Technical Field

[0001] The present invention belongs to the technical field of tumor molecular biology, and specifically relates to a serum exosome tsRNA molecule tRF-1003 and an application thereof. Background Art

[0002] Multiple myeloma (MM) is a disease caused by abnormal proliferation of clonal plasma cells in the bone marrow and secretion of monoclonal globulin or its fragments. It is the second most common hematological malignancy, with a median age of 69 years. Its incidence has been on the rise in the past decade. In today's aging population, it is becoming an important clinical, social and economic burden. With the deepening understanding of the occurrence and development mechanism of MM, the treatment model based on proteasome inhibitors [bortezomib (BTZ) and immunomodulatory drugs has greatly improved the prognosis of patients. However, MM is still incurable. The median progression-free survival of newly diagnosed MM (NDMM) patients after standard treatment is 59.3 months, and patients inevitably face the dilemma of disease recurrence. Therefore, continuous exploration of the mechanism of MM progression will help provide more optimized treatment strategies and improve the prognosis of MM patients, which is of great clinical significance.

[0003] Recent studies have revealed the important functions of the bone marrow microenvironment in the progression and recurrence of MM. MM exosomes, as a new mode of intercellular communication, have received widespread attention for their significance in the MM bone marrow microenvironment. Angiogenesis, as a key marker of MM, is closely related to the recurrence and progression of MM disease, the mechanism of drug action, etc., and is also one of the important reasons restricting the efficacy of MM patients. Although a lot of exploration has been done on the mechanism of MM angiogenesis, directly targeting these angiogenic cytokines has not shown good efficacy in MM patients, which also suggests that the key mechanism of MM angiogenesis still needs to be further clarified.

[0004] tsRNA (tRNA derived small RNA) is a small RNA fragment derived from tRNA. It is divided into tRF-5, tRF-3, tRF-1, tRF-2 and tiRNA according to its tRNA source and specific cleavage site. It was originally regarded as a non-functional degradation fragment. In recent years, research has continued to deepen and found that its length is similar to microRNA, but its types in cells are more abundant. It plays a more diverse function by participating in RNA silencing, transcriptional regulation and epigenetic regulation. It plays an important role in pathological and physiological processes such as solid tumors, and also reveals the clinical application prospects of an efficient RNA interference therapy. Recent studies have shown that exosomal tsRNA plays an important role in the microenvironment of various solid tumors by participating in the regulation of pathological processes such as immune cell polarization. In the field of hematological tumors, only a small number of studies have shown the significance of bone marrow tsRNA in predicting the risk of progression of smoldering MM to MM and in the prognosis stratification of MM patients. The functional role and molecular mechanism of exosomal tsRNA in MM relapse and resistance are still unclear.

[0005] Based on the previous second-generation sequencing results, the present invention further used ultra-high-speed centrifugation to extract serum exosomes from MM patients, detected the expression of tRF-1003 molecules by qPCR, and finally co-incubated with endothelial cells in vitro to identify the important significance of tRF-1003 molecules in promoting MM angiogenesis. Summary of the invention

[0006] The primary purpose of the present invention is to provide a new serum exosomal tsRNA molecule tRF-1003, the sequence of which is GCTAAGGAAGTCCTGTGCTCAGTTTT, which has great potential in the diagnosis and treatment of multiple myeloma.

[0007] The second aspect of the present invention aims to provide the use of an agent for inhibiting the expression of tRF-1003 in the preparation of an anti-tumor drug.

[0008] Furthermore, the agent for inhibiting the expression of tRF-1003 includes an inhibitor of tRF-1003.

[0009] Furthermore, the tumor includes multiple myeloma.

[0010] The third aspect of the present invention aims to provide use of an agent that overexpresses tRF-1003 in the preparation of an angiogenesis-promoting preparation.

[0011] Furthermore, the agent for overexpressing tRF-1003 includes tRF-1003 mimics.

[0012] The fourth aspect of the present invention aims to provide use of an agent for inhibiting the expression of tRF-1003 in the preparation of an angiogenesis inhibiting preparation.

[0013] Furthermore, the agent for inhibiting the expression of tRF-1003 includes an inhibitor of tRF-1003.

[0014] The fifth aspect of the present invention aims to provide a drug for treating tumors, which is an agent for inhibiting the expression of tRF-1003.

[0015] The sixth aspect of the present invention aims to provide a reagent for detecting the serum exosome tsRNA molecule tRF-1003 for use in preparing a diagnostic or prognostic preparation for relapsed or refractory multiple myeloma;

[0016] Preferably, the reagent for detecting the serum exosome tsRNA molecule tRF-1003 includes a PCR reagent.

[0017] The primer sequences are as follows:

[0018] F:5'-GCTAAGGAAGTCCTGTGCT-3',

[0019] R:5'-GTCCAGTTTTTTTTTTTTTTAAAACTGA-3'.

[0020] The present invention, based on the second generation sequencing, suggests that the expression of tRF-1003 is increased in R / RMM bone marrow specimens, and the expression of tRF-1003 is detected by qPCR. The results show that the level of tRF-1003 in R / RMM serum exosomes is significantly higher than that in NDMM, while the expression of tRF-1003 in R / RMM and NDMM exosome-free serum is relatively low, indicating that tRF-1003 is mainly released into the blood circulation through exosomes, and can be used as a marker for the diagnosis or prognosis of R / RMM. The tRF-1003 molecule is finally co-incubated with endothelial cells in vitro. The tRF-1003 molecule is of great significance in the field of promoting angiogenesis. At the same time, it is found that the inhibitor of tRF-1003 can cause a decrease in the proliferation rate of tumor cells, and has the potential to treat tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 : The effects of inhibiting or overexpressing tRF-1003 on multiple myeloma cells;

[0022] Figure 2 :Exosome extraction and identification;

[0023] Figure 3 :tRF-1003 is expressed in R / RMM serum exosomes;

[0024] Figure 4 :tRF-1003 enters endothelial cells via exosome delivery;

[0025] Figure 5 :Electron microscopic diagram of tRF-1003 entering endothelial cells;

[0026] Figure 6 :Scratch repair experiment verifies that tRF-1003 promotes endothelial cell migration;

[0027] Figure 7 :Transwell experiment verified that tRF-1003 promoted endothelial cell migration;

[0028] Figure 8 :Immunofluorescence staining verified that tRF-1003 promoted endothelial cell angiogenesis. DETAILED DESCRIPTION

[0029] The following examples are intended to further illustrate the present invention, but are not intended to limit the present invention.

[0030] method

[0031] 1. Clinical samples

[0032] A total of 52 patients with relapsed / refractory multiple myeloma (R / RMM) and 48 newly diagnosed MM (NDMM) from the Third Xiangya Hospital of Central South University from March 2016 to March 2020 were selected in the present invention. The diagnosis of multiple myeloma was based on the diagnostic criteria for symptomatic multiple myeloma defined by the National Comprehensive Cancer Network (NCCN) of the United States, and relevant clinical information of the subjects was collected.

[0033] ARP1 and MM.1S myeloma cell lines were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai).

[0034] 2. Exosome extraction and identification

[0035] Exosomes were purified from MM serum or cell culture medium by ultracentrifugation. First, a lower centrifugal force of 300g was applied to remove cells from the serum or cell culture medium, and then a higher centrifugal force of 20,000g was applied to the supernatant to remove large cell debris and broken organelles. Finally, high-speed 150,000g centrifugation was performed again to collect exosomes from the supernatant. All centrifugations were performed at 4°C, and the exosome morphology was observed by transmission electron microscopy.

[0036] 3. RNA Extraction

[0037] According to the kit procedure, TRIzol (Invitrogen, USA) was used to extract RNA from exosome samples. The specific procedure was as follows: (1) the exosome samples were placed on ice, Trizol was added to lyse for 5-10 minutes, and the liquid was aspirated and placed in an EP tube after gently blowing with a pipette tip;

[0038] (2) Add 1 / 5 volume of chloroform, mix the liquid up and down, and let it stand at 4°C for 10-15 minutes;

[0039] (3) Centrifuge at 4°C for 15 minutes. After centrifugation, the tube is separated into three layers. Gently remove the EP tube from the centrifuge, aspirate the supernatant, avoiding the lower precipitate, and place the liquid in a new EP tube.

[0040] (4) Add isopropanol at a rate of 0.5 ml isopropanol / ml Trizol, let stand for 10 min, then centrifuge at 12,000 rpm for 10 min at 4°C and discard the supernatant;

[0041] (5) Add 75% ethanol at a rate of 1 ml 75% ethanol / ml Trizol, centrifuge at 4°C for 5 min, and discard the supernatant;

[0042] (6) Place the EP tube in the centrifuge again and centrifuge for a short time, discard the residual liquid on the tube wall. Then place the EP tube in a clean bench to dry for 5-10 minutes. Add 50ul of DEPC-treated water and shake to fully dissolve the precipitate;

[0043] (7) The RNA concentration and activity were determined using NanoDrop ND-1000 (NanoDrop, USA), and the purity and integrity of the RNA were then tested using formaldehyde denaturing agarose gel electrophoresis. The extracted RNA was stored at -80°C.

[0044] 4. RNA interference

[0045] (1) Preparation of transfection complex

[0046] First, shake the GP-transfect-Mate transfection reagent at room temperature, then add 500μL serum-free medium and an appropriate amount of GP-transfect-Mate transfection reagent to a 1.5mL sterile centrifuge tube and mix well, let stand at room temperature for 5 minutes, and at the same time, add 500μL serum-free medium and an appropriate amount of tRF-1003mimics (5'-GCUAAGGAAGUCCUGUGCUCAGUUUU-3'), tRF-1003inhibitor (5'-AAAACUGAGCACAGGACUUCCUUAGC-3') or blank control to a new 1.5mL centrifuge tube and mix well, let stand at room temperature for 5 minutes. Mix the two and blow well, let stand at room temperature for 15-20 minutes before starting transfection;

[0047] (2) Cell transfection

[0048] When the transfection complex is at rest, take 1-2×10 6 Resuspend ARP1 or MM.1S cells to 4 mL in a 60 mm culture dish; add 1 mL of transfection complex to the culture dish, the final system is 5 mL, then gently shake the culture dish to mix the complex, culture the cells at 37°C, replace with complete culture medium after 4-6 hours, and verify the transfection efficiency by qPCR after 24 hours. Qualified ones can be used in subsequent functional experiments.

[0049] 5. Real-time fluorescence quantitative PCR

[0050] (1) Reaction system configuration

[0051] Real-time fluorescence quantitative PCR reaction system: 2×Master Mix 5μL, 10μM forward primer 0.5μL, 10μM reverse primer 0.5μL, cDNA 2μL, water 2μL.

[0052] The tRF-1003 primer sequence is:

[0053] F:5'-GCTAAGGAAGTCCTGTGCT-3',

[0054] R:5'-GTCCAGTTTTTTTTTTTTTTAAAACTGA-3'

[0055] The U6 primer sequence is:

[0056] F:5'-GCTTCGGCAGCACATATACTAAAAT-3',

[0057] R:5'-CGCTTCACGAATTTGGCGTGTCAT-3'

[0058] (2) Real-time fluorescence quantitative PCR

[0059] Add the mixture to the corresponding wells of the 384-PCR plate, affix the sealing film, centrifuge briefly to mix, then place the PCR plate in the Realtime PCR instrument and set the PCR amplification conditions: 95°C, 10 min, 1 cycle; 95°C, 10 s, 60°C, 60 s, 40 cycles. Calculate the expression level using the 2-ΔΔCt method.

[0060] 6. CCK-8 detection of cell proliferation

[0061] Take logarithmic phase ARP1 or MM.1S cells, count them, resuspend them in fresh complete medium to the appropriate density, and add 100 μL of cell suspension to each well of a 96-well plate (the general number of cells is about 1000-10000, which is determined according to the corresponding cell size, proliferation rate, intervention conditions, etc.); give the preset interference measures of the experiment (i.e., transfection of tRF-1003mimics, tRF-1003inhibitor), and culture for the corresponding time as needed; after the intervention is completed, the test is performed by adding 10 μL of CCK-8 solution to each well, paying attention to avoid the generation of bubbles as much as possible to affect the OD value, gently shaking and incubating for 1-4 hours; turn on the microplate reader, select 450nm wavelength, measure the absorbance of each well on the machine, and then calculate the cell proliferation rate.

[0062] 7. Cell Co-culture

[0063] Take logarithmic phase growing ARP1 cells (1x10 5 ) and HUVEC cells (1x10 5 ), placed in a 6-well plate containing 3 mL of F12K complete medium, and cultured in a 37°C, 5% CO2 incubator. After 24 h, the supernatant cell suspension was removed, the cells were rinsed with PBS, and finally the adherent HUVEC cells were collected by trypsin digestion for subsequent experiments.

[0064] 8. Detection of exosome uptake by fluorescence microscopy

[0065] The exosomes in the supernatant of APR1 cells were extracted and stained with PKH67 markers. The cells were stained at room temperature and away from light for 30 minutes. The stained exosomes were added to the HUVEC culture dish in logarithmic growth. After 12 hours, the treated cells were collected, washed once with PBS, and centrifuged at 1000rpm for 5 minutes; fixed with 4% paraformaldehyde, and paid attention to light protection during this process; treated with Triton, and permeabilized at 37℃ for 30 minutes; washed with PBS three times, and centrifuged at 1000rpm for 5 minutes; added 2ulDAPI staining working solution, stained at room temperature and away from light for 20 minutes; washed with PBS three times, and the cell fluorescence was checked under a fluorescence microscope, and photographed and recorded.

[0066] 9. Transwell experiment

[0067] (1) Matrigel plating

[0068] Thaw Matrigel at 4°C overnight and transfer to an ice box before the experiment. First, add 8 μL of Matrigel to a pre-cooled 1.5 ml EP tube, then add 64 μL of pre-cooled serum-free culture medium, and mix thoroughly by blowing with a pipette tip; draw 60 μL of diluted Matrigel, add it vertically to the upper chamber of the transwewll, spread it evenly on the bottom, and incubate it in an incubator (37°C, 5% CO2) for 3 hours to allow the Matrigel to polymerize into a thin film; after incubation, aspirate the excess liquid in the upper chamber, add 100 μL of serum-free culture medium to each well, and place it in the incubator for 30 minutes to hydrate the basement membrane; aspirate the liquid in the upper chamber and check whether there is liquid passing through the small chamber into the lower chamber. If not, cells can be inoculated.

[0069] (2) Inoculation of HUVEC cells

[0070] Add 500 μL of 10% FBS culture medium and 100 μL of MM-derived exosomes (exosomes from the culture medium of MM.1S cell line transfected with tRF-1003mimics) to the lower chamber of the 24-well plate; then use tweezers to place the Transwell chamber in the 24-well plate; inoculate HUVECs in the upper chamber containing 100 μL of 10% FBS F12-K culture medium in each well; after incubation at 37°C and 5% CO2 for 24 hours, remove the non-migrating HUVECs on the upper side of the membrane, stain the migrating cells on the lower side of the membrane with crystal violet, and count them under an optical microscope.

[0071] 10. Scratch repair experiment

[0072] (1) Cell plating

[0073] HUVEC cells were digested with trypsin to prepare cell suspension. After counting the cells, the cells were plated to ensure that the cell density of each group was consistent. 10×10 5 cells;

[0074] (2) Making scratches

[0075] After the cells are fully spread, use a ruler to measure and use a 20uL pipette tip to make cell scratches perpendicular to the well plate and the line, so that the scratches intersect with the marked line; wash the cells, remove the scratched cells, change the medium, aspirate the old medium, and then use sterile PBS to wash the cells 3 times to wash away the scratched cells so that the gaps left are clearly visible to the naked eye; then add fresh serum-free medium and MM-derived exosomes (tRF-1003mimics transfected MM.1S cell line culture medium exosomes);

[0076] (3) Take photos and observe

[0077] The cells were cultured in a 37°C, 5% CO2 incubator. After 24 hours, the width of the scratch was observed under a microscope and photographed.

[0078] 11. Immunofluorescence detection of HUVEC cell angiogenesis

[0079] (1) Production

[0080] The exosomes from the culture fluid of MM.1S cell line transfected with tRF-1003mimics were co-incubated with HUVEC cells seeded in Matrigel for 24 hours, and the logarithmically growing HUVEC cells were digested with 0.25% trypsin to prepare a single cell suspension. The cells were seeded into a culture flask or dish with a 6×22mm cover glass placed in advance, and cultured in a carbon dioxide incubator for 1-3 days. When the cells are close to growing into a monolayer, the cover glass was removed, washed twice with PBS, and then the cells were fixed with 95% ethanol;

[0081] (2) Thermal antigen retrieval

[0082] Add blocking permeabilization solution (40mL PBS+120uL TritonX-100+400uL 30% H2O2) dropwise, block at room temperature for 30 minutes, and wash with PBS. Soak the slices in 0.01M sodium citrate buffer, place in a microwave oven at high heat for 4 minutes until boiling, then take out and cool naturally, repeat 2 times for antigen repair, and wash with PBS after completion;

[0083] (3) Antibody incubation

[0084] Add serum from the same source as the secondary antibody, incubate at 37°C for 30 minutes to block non-specific binding sites. Add primary antibody diluent, incubate at 37°C for 1-2 hours, and wash with PBS. Add secondary antibody, incubate at 37°C for 1-2 hours (keep away from light during immunofluorescence staining), and wash with PBS after staining;

[0085] (4) Nuclear counterstaining

[0086] DAPI was added dropwise in the dark for 10 min to color the cell nuclei, followed by washing with PBS;

[0087] (5) Dehydration and sealing

[0088] The slides were placed in PBS (PH 7.4) and washed on a decolorizing shaker for 3 times, 5 min each time. The sections were slightly dried and then sealed with anti-fluorescence quenching sealing medium.

[0089] (6) Microscopic examination and photography

[0090] Observe and collect images under a fluorescence microscope.

[0091] 12. Statistical Analysis

[0092] SPSS23.0 software was used for statistical analysis, and the qPCR values ​​were taken as mean ± standard deviation. The KS test was used to determine whether the data conformed to normal distribution. For data that conformed to normal distribution, a two-tailed unpaired t-test was used for statistical analysis, otherwise a nonparametric test (Mann-Whitney test) was selected, and a P value < 0.05 was considered statistically significant. Data visualization was achieved using GraphPad8.4.3 and Adobe Illustrater software.

[0093] result

[0094] 1. tRF-1003 promotes the proliferation of multiple myeloma

[0095] We first performed in vitro experiments to identify the effect of tRF-1003 on MM cell proliferation. In MM.1S cells overexpressing tRF-1003, CCK-8 showed that the cell proliferation rate in the mimics group increased ( Figure 1 A), while transfection of inhibitor in APR1 inhibited tRF-1003, leading to a decrease in tumor cell proliferation rate ( Figure 1 B). This phenomenon suggests a positive correlation between tRF-1003 levels and MM proliferation, and inhibition of tRF-1003 has the potential to treat tumors.

[0096] 2. Extraction and identification of exosomes

[0097] To further explore the mechanism of action of tRF-1003, we first separated the exosome components from peripheral blood samples of R / RMM and NDMM patients by ultra-high-speed centrifuge and observed the exosome morphology under transmission electron microscopy, indicating that the exosome separation was successful ( Figure 2 ).

[0098] 3. tRF-1003 is significantly increased in R / RMM serum exosomes

[0099] In the early stage, the second generation sequencing revealed that tRF-1003 was expressed in R / RMM bone marrow specimens. We further collected peripheral blood samples from 52 R / RMM and 48 NDMM patients, separated serum exosomes, and detected the expression of tRF-1003 (base sequence: 5'-GCTAAGGAAGTCCTGTGCTCAGTTTT-3') by qPCR. The results showed that the level of tRF-1003 in R / RMM serum exosomes was significantly higher than that in NDMM ( Figure 3 A), ROC curve showed that exosomal tRF-1003 levels have good diagnostic value for distinguishing R / RMM from NDMM ( Figure 3 B), while the expression of tRF-1003 in R / RMM and NDMM exosome-free serum was relatively low ( Figure 3C), suggesting that tRF-1003 is mainly released into the blood circulation through exosomes.

[0100] 4. Co-culture of exosome tRF-1003 and endothelial cells

[0101] To explore whether MM exosome tRF-1003 is involved in the regulation of angiogenesis, we studied its association with endothelial cells in vitro. ARP1 multiple myeloma cells with relatively high tRF-1003 expression were directly co-cultured with human umbilical vein endothelial cells HUVEC, and HUVEC cells were collected and tRF-1003 expression was detected. The results showed that the expression level of tRF-1003 in HUVEC was significantly increased, while the addition of exosome production inhibitor GW4869 to the co-culture system reduced the increase in tRF-1003 in HUVEC ( Figure 4 A). To further verify that the increase of tRF-1003 in HUVEC was transmitted by exosomes, we extracted exosomes from ARP1 cell culture medium and incubated them with HUVEC cells. qPCR showed that the expression level of tRF-1003 in HUVEC was significantly increased ( Figure 4 B).

[0102] 5. Electron microscopy of exosome tRF-1003 entering cells

[0103] To further verify that exosome tRF-1003 enters endothelial cells to exert regulatory functions, we extracted exosomes from the supernatant of APR1 cells, stained the extracted exosomes with PKH67 marker, stained them at room temperature and away from light, added the stained exosomes to HUVEC culture dishes in logarithmic growth, and photographed the uptake of exosomes by endothelial cells using a fluorescence microscope ( Figure 5 ).

[0104] 6. Exosome tRF-1003 promotes endothelial cell migration and scratch repair experiment

[0105] To explore whether exosome tRF-1003 promotes angiogenesis, we conducted preliminary in vitro experiments. We established an MM.1StRF-1003 mimics transfected cell line, separated the culture supernatant, extracted MM-derived exosomes, and co-incubated them with endothelial cells. The endothelial cell migration ability was tested by scratch repair experiment. The results showed that the scratch repair ability of the tRF mimics group was significantly enhanced compared with the control group ( Figure 6 A). On the contrary, the ARP1 MM cell line was transfected with tRF-1003 inhibitor, and then the exosomes were extracted and co-incubated with endothelial cells. The results showed that the scratch repair ability of endothelial cells in the tRF-1003 inhibition group was lower than that in the control group ( Figure 6 B).

[0106] 7. Exosome tRF-1003 promotes endothelial cell migration in transwell experiment

[0107] We further performed transwell experiments to verify the effect of tRF-1003 on endothelial cells. Similarly, MM.1StRF-1003 mimics transfected cell lines were established, culture supernatant was separated, and MM-derived exosomes were extracted and co-incubated with endothelial cells. The cell migration ability was detected by transwell experiments. The results showed that the migration of endothelial cells in the tRF mimics group was significantly increased ( Figure 7 A). ARP1 MM cell line was transfected with tRF-1003 inhibitor, and exosomes were extracted and co-incubated with endothelial cells. The results showed that the migration of endothelial cells in the tRF-1003 inhibition group was decreased compared with the control group ( Figure 7 B).

[0108] 8. Exosomal tRF-1003 promotes endothelial cell angiogenesis

[0109] We also detected the expression of CD34 in endothelial cells to explore the effect of tRF-1003 on endothelial cell angiogenesis. Exosomes from the culture fluid of MM.1S cell lines transfected with control or tRF-1003 mimics were collected and co-incubated with HUVEC cells seeded on matrix gel for 24 hours. CD34 was detected by immunofluorescence. The results showed that the expression of CD34 in the tRF mimics group increased ( Figure 8 A). When the ARP1 MM cell line was transfected with tRF-1003 inhibitor, the exosomes were extracted and co-incubated with endothelial cells. The expression of CD34 in endothelial cells in the tRF-1003 inhibition group was lower than that in the control group ( Figure 8 B).

[0110] in conclusion:

[0111] This invention proposes for the first time that the content of tRF-1003 in R / RMM serum exosomes is significantly increased, and is delivered into endothelial cells through exosomes. In vitro co-culture functional experiments suggest that exosome tRF-1003 promotes endothelial cell VEGF signaling and angiogenesis. This discovery provides a potential new strategy for overcoming MM recurrence and progression by regulating angiogenesis in the clinic. At the same time, it was found that the inhibitor of tRF-1003 can lead to a decrease in the proliferation rate of tumor cells.

Claims

1. A serum exosomal tsRNA molecule tRF-1003, the sequence is: GCTAAGGAAGTCCTGTGCTCAGTTTT.

2. Use of an agent for inhibiting the expression of tRF-1003 in claim 1 in the preparation of an anti-tumor drug.

3. The use according to claim 2, It is characterized in that Agents that inhibit the expression of tRF-1003 include inhibitors of tRF-1003.

4. The use according to claim 2 or 3, It is characterized in that Tumors include multiple myeloma.

5. Use of an agent that overexpresses the tRF-1003 of claim 1 in the preparation of an angiogenesis-promoting preparation.

6. The use according to claim 5, It is characterized in that Agents that overexpress tRF-1003 include tRF-1003 mimics.

7. Use of an agent for inhibiting the expression of tRF-1003 in claim 1 in the preparation of an angiogenesis inhibiting agent.

8. The use according to claim 7, It is characterized in that Agents that inhibit the expression of tRF-1003 include inhibitors of tRF-1003.

9. A drug for treating tumors, It is characterized in that An agent that inhibits the expression of tRF-1003.

10. Use of a reagent for detecting the serum exosomal tsRNA molecule tRF-1003 according to claim 1 in the preparation of a diagnostic or prognostic preparation for relapsed or refractory multiple myeloma; Preferably, the reagent for detecting the serum exosome tsRNA molecule tRF-1003 includes a PCR reagent.

Images