Application of desaturated acid lipase in resisting rice black-streaked dwarf virus

Abstract

The invention discloses a plant desaturation acid lipase OsFAD7 gene and application thereof, and through a genetic engineering technology, overexpression OsFAD7 transgenic rice capable of being inherited stably is obtained. Phenotypic observation shows that the transgenic OsFAD7 gene has no significant influence on the growth and development of rice; artificial inoculation of the RBSDV shows that the OsFAD7 gene can enhance the resistance of the rice to the RBSDV after overexpression. The invention provides an important gene pool and a new germplasm resource for rice breeding for disease resistance.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of desaturated acid lipase in resistance to rice black-streaked dwarf virus, and in particular to application of plant desaturated acid lipase OsFAD7 in resistance to rice black-streaked dwarf virus. Background Art

[0002] Rice is one of the most important food crops, sustaining the survival of more than half of the world's population. There are many types of rice viruses, which are serious and difficult to control, and have a huge impact on rice production. Rice black-streaked dwarf virus (RBSDV) is a double-stranded RNA virus belonging to the Reoviridae family and the Fijivirus genus. It can be transmitted by the insect vector Laodelphax striatum, harming rice, wheat, corn and many other grass weeds. It can cause rice black-streaked dwarf disease, wheat green dwarf disease and corn rough dwarf disease, causing huge yield and economic losses. At present, there is no effective chemical agent to prevent and control plant viral diseases, and the traditional "insect control and disease prevention" strategy can no longer meet the current agricultural production needs. Breeding new varieties resistant to viral diseases is the most economical, safe and effective way, and has become the mainstream trend of green prevention and control of viral diseases.

[0003] In higher plants, three C18-containing fatty acids (FAs) are the most common unsaturated FAs (UFAs), namely oleic acid (18:1), linoleic acid (18:2), and linolenic acid (18:3). The relative abundance of different fatty acids and their derivatives in plants is mainly regulated by fatty acid desaturases (FADs) and their related enzymes. ω-FADs are the most important and widely used enzymes in the desaturation process of plant fatty acids. FAD7 is responsible for catalyzing the synthesis of C18:2 to 18:3. In the Arabidopsis fad7 / fad8 double mutant, the levels of C18:3 unsaturated fatty acids and ROS are significantly reduced, making it more sensitive to some pathogenic bacteria; silencing of FAD7 in tobacco increases the sensitivity of plants to bacterial, oomycete and viral infection. FAD7 is also involved in the plant's response to abiotic stress. Overexpression of FAD7 promotes low temperature tolerance of tobacco, while antisense inhibition of FAD7 enhances sensitivity to salt stress and drought stress, indicating that FAD7 contributes to plant adaptability to cold, salt stress and drought. Up to now, the role of rice FAD7 in rice resistance to RBSDV infection is still unclear. The present invention obtains stably inherited overexpressed OsFAD7 transgenic rice through genetic engineering technology. Phenotypic observation found that the transfer of OsFAD7 gene had no significant effect on the growth and development of rice. RBSDV inoculation experiments were carried out on wild-type rice and overexpressed transgenic rice, and the results showed that overexpression of OsFAD7 gene can significantly enhance rice resistance to RBSDV. The present invention is of great significance for breeding rice varieties resistant to RBSDV. Summary of the invention

[0004] In one aspect, the present invention provides a desaturated acid lipase, wherein the amino acid sequence of the desaturated acid lipase has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity compared to SEQ ID No. 1. Preferably, the amino acid sequence of the desaturated acid lipase is as shown in SEQ ID No. 1.

[0005] In one embodiment, the desaturated acid lipase is OsFAD7. Preferably, the desaturated acid lipase is derived from rice.

[0006] On the other hand, the present invention also provides a gene encoding the above-mentioned desaturated acid lipase. Preferably, the sequence of the gene is shown as SEQ ID No.2.

[0007] On the other hand, the present invention also provides a biological material comprising the above desaturated acid lipase or its encoding gene. The biological material is selected from: a vector comprising the above desaturated acid lipase or its encoding gene, or a host cell comprising the above desaturated acid lipase or its encoding gene.

[0008] On the other hand, the present invention also provides a vector comprising the above encoding gene, or a host cell comprising the vector.

[0009] In one embodiment, the vector includes a cloning vector and an expression vector.

[0010] In one embodiment, the vector is a plant expression vector.

[0011] In one embodiment, the vector is an expression vector that can transfect or transform plant cells.

[0012] In one embodiment, the vector is an Agrobacterium Ti vector.

[0013] In one embodiment, the backbone of the vector is a pGWB series vector such as pGWB501, pGWB502, pGWB415, pGWB505, or a pCAMBIA series vector such as pCAMBIA1300, pCAMBIA1301, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, etc., or a pBI series vector such as pBI101, pBI121, pBI221, etc.

[0014] In one embodiment, the vector is circular or linear.

[0015] As used herein, the term "vector" refers to a nucleic acid construct designed for transfer between different host cells. An "expression vector" refers to a vector that has the ability to incorporate and express heterologous DNA fragments in exogenous cells. Many prokaryotic and eukaryotic expression vectors are commercially available. The selection of an appropriate expression vector is well known to those skilled in the art.

[0016] In one embodiment, the host cell is a prokaryotic cell or a eukaryotic cell.

[0017] In one embodiment, the prokaryotic cell is derived from Escherichia coli, yeast or Agrobacterium.

[0018] In one embodiment, the cell is a plant cell.

[0019] In one embodiment, the plant is selected from the group consisting of monocots, dicots, gymnosperms, or a combination thereof.

[0020] In one embodiment, the plant includes: Arabidopsis, wheat, barley, oats, corn, rice, sorghum, millet, soybean, peanut, tobacco, tomato, Arabidopsis, potato, cabbage, rapeseed, lettuce, cucumber, chrysanthemum, water spinach, etc., or a combination thereof.

[0021] In one embodiment, the host cell is introduced with the nucleic acid construct by a method selected from the group consisting of Agrobacterium transformation, gene gun, microinjection, electric shock, ultrasound and polyethylene glycol (PEG)-mediated method.

[0022] On the other hand, the present invention also provides the use of the above desaturated acid lipase, or a biological material comprising the above desaturated acid lipase or a gene encoding the same, in preparing plants with improved traits.

[0023] On the other hand, the present invention also provides a method for preparing a plant with improved traits, the method comprising the step of overexpressing the above-mentioned desaturated acid lipase in plant cells, plant seeds, plant tissues, plant parts or plants.

[0024] In one embodiment, the method comprises overexpressing the desaturated acid lipase using an expression vector, or integrating the desaturated acid lipase into a plant genome to overexpress the desaturated acid lipase.

[0025] In one embodiment, the plant is a plant obtained by regenerating a plant cell or callus with improved traits into a plant body, thereby obtaining a plant with improved traits.

[0026] On the other hand, the present invention also provides a plant with improved traits, which is the plant prepared by the above method.

[0027] On the other hand, the present invention also provides a method for preparing a hybrid plant, wherein the hybrid plant is a plant obtained by hybridizing the plant prepared by the above method with other plants.

[0028] In one embodiment, the trait improvement is to increase the plant's resistance to black-streaked dwarf virus; in one embodiment, the black-streaked dwarf virus is rice black-streaked dwarf virus.

[0029] Specifically, plants that overexpress the desaturated acid lipase can significantly enhance the resistance of plants to RBSDV (rice black-streaked dwarf virus) infection (including phenotypic symptoms and virus content of diseased plants) compared to plants that do not overexpress the desaturated acid lipase. After being infected with RBSDV (rice black-streaked dwarf virus), the symptoms of the plants that overexpress the desaturated acid lipase will be significantly alleviated and the amount of virus accumulation will be significantly reduced.

[0030] In one embodiment, the plant includes any higher plant type amenable to transformation techniques, including monocots, dicots, and gymnosperms.

[0031] In one embodiment, the plant is selected from the group consisting of Gramineae, Leguminosae, Cruciferae, Solanaceae, Apiaceae, or a combination thereof.

[0032] In one embodiment, the plant includes: Arabidopsis, wheat, barley, oats, corn, rice, sorghum, millet, soybean, peanut, tobacco, tomato, Arabidopsis, potato, cabbage, rapeseed, spinach, lettuce, cucumber, chrysanthemum, water spinach, celery, lettuce, or a combination thereof; preferably, the plant is rice.

[0033] "Overexpression" in the present invention means that the expression amount, activity or expression level of the target gene of the transgenic plant is higher than that of the control plant. In one embodiment, the above-mentioned overexpression can be achieved by introducing an expression vector to overexpress the target gene; in other embodiments, the above-mentioned overexpression can also be achieved by introducing additional copies of the target gene in the plant, by increasing the copy number of the target gene; in other embodiments, it can also be achieved by optimizing the promoter of the target gene, for example, by replacing the original promoter of the target gene with a promoter with higher activity to achieve overexpression of the target gene.

[0034] Compared with the prior art, the advantages and beneficial effects of the present invention are:

[0035] The present invention obtains a transgenic rice that overexpresses OsFAD7 and can be stably inherited through genetic engineering technology. By comparing the tolerance of wild-type and overexpressed transgenic rice to RBSDBV, it is found that transgenic rice plants overexpressing OsFAD7 can significantly enhance the resistance of rice to RBSDBV infection (including phenotypic symptoms and virus content of diseased plants). Therefore, the present invention successfully obtains transgenic rice with resistance to RBSDBV infection through transgenic means, which is of great significance to agricultural development and national food security. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 : Schematic diagram of plant phenotype observation of transgenic rice overexpressing OsFAD7 and the control Zhonghua 11 (ZH11); wherein EV represents the empty vector of the transfer.

[0037] Figure 2 : Western blot experimental verification results of transgenic rice overexpressing OsFAD7; where EV represents the empty vector.

[0038] Figure 3: Schematic diagram of disease symptoms in transgenic plants overexpressing OsFAD7 and the control Zhonghua 11 (ZH11) after RBSDV infection.

[0039] Figure 4 : Results of virus content detection in OsFAD7 overexpressing transgenic plants and the control Zhonghua 11 (ZH11) after RBSDV infection. DETAILED DESCRIPTION

[0040] In this embodiment, the rice chassis variety used is Zhonghua 11.

[0041] Example 1. Extraction of total RNA from rice leaves and synthesis of cDNA sequences

[0042] Take an appropriate amount of rice leaves and grind them thoroughly in liquid nitrogen, and quickly transfer them to a sterile 1.5 mL centrifuge tube that has been frozen with liquid nitrogen. Use RNA extraction reagent TRIzol to extract total RNA from rice leaves; reverse transcribe the extracted total RNA into cDNA using Takara's reverse transcription kit. For specific methods, refer to the kit instructions.

[0043] Example 2: Construction of rice OsFAD7 plant expression vector

[0044] (1) Cloning of the rice OsFAD7 gene

[0045] According to the rice OsFAD7 gene sequence published by NCBI (amino acid sequence as shown in SEQ ID No. 1, DNA sequence as shown in SEQ ID No. 2), primers with Flag tags were designed;

[0046] F: actagggtctcgcaccatggcgttctccctccagc;

[0047] R1: catccttgtaatcgctgccgccggaggaactctgtgcaccatagcgc;

[0048] R2: actagggtctctaccgttacttatcgtcgtcatccttgtaatcgctgccgccggagg.

[0049] The rice cDNA obtained in Example 1 was used as a template and a high-fidelity enzyme was used for PCR amplification. All PCR products were analyzed by 1.5% agarose gel electrophoresis. The target band was purified and recovered using a universal DNA gel purification and recovery kit (Tiangen).

[0050] SEQ ID No.1:

[0051] marlvlseccgltplrlrgrgaialpappslaagprrpvsaaaaggaihrewalrvsaptrltsvveednrgeevveeeargslaaaeaaagevggdgdgfdpgapppfglaeiraaipkhcwvkdpwrsmsyvlrdvvvvlglaaaaarvdswlvwplywaaqgtmfwalfvlghdcghgsfssnaklnsvvghilhssilvpyhgwrishrthhqnhghvekdeswqplserlynsldymtkklrftmpfpmlafplylfarspgkkgshfnpssdlfqpnekkdvitstaswlamvgilagltfvmgplkmlklyavpyvifvmwldfvtylhhhghedklpwyrgkewsylrgglttldrdygwinnvhhdigthvihhlfpqiphyhlveateaakpvlgkyykepeksaplpfhllgvlakslnsdhyvsdtgdvvyyqtdlktsssaqssd

[0052] SEQ ID No.2:

[0053]

[0054] (2) Expression vector construction

[0055] The OsFAD7 gene and pCAMBIA1300 vector were digested with BamHI and SacI, respectively. The OsFAD7 gene was then connected to the pCAMBIA1300 vector using Takara's T4 DNA ligase and transformed into Escherichia coli (E. coli) DH5α competent cells. The positive clones were picked and sent to the company for sequencing. After sequence comparison, the recombinant vector pCAMBIA1300-OsFAD7-Flag was obtained.

[0056] Example 3: Rice genetic transformation

[0057] Rice callus induction: Shell the mature rice seeds and disinfect them with 70% alcohol for 2 minutes on a clean workbench. Then, transfer the seeds to a 25% sodium hypochlorite (NaClO) solution and soak for 60 minutes. After that, pour out the NaClO solution and wash the seeds 4-5 times with sterile distilled water. Use sterile tweezers to place the seeds in the induction medium and place them in an incubator for dark culture. Use tweezers to peel off the callus and transfer it to the subculture medium for culture for 10 days before use for transformation.

[0058] Agrobacterium transfection of callus: On a clean bench, place the induced callus in a sterilized culture dish, add the cultured Agrobacterium solution containing the recombinant vector pCAMBIA1300-OsFAD7-Flag, and shake continuously to allow the callus to fully contact the Agrobacterium and soak for 15 minutes. Then take out the callus and use sterile filter paper to absorb the water on the surface of the callus; then place the callus in a co-culture medium and culture it in a dark incubator for 3 days.

[0059] Screening of resistant callus and acquisition of transgenic plants: Callus was placed on a medium containing 50 mg / L hygromycin for resistance screening, and the screened callus was placed in a differentiation medium for differentiation culture, and cultured in the dark for 3 days and then in the light for 15 days. After the young shoots grew out, they were transferred to the rooting medium and continued to be cultured for about 15 days. The rooting of the green seedlings was observed, and when the roots grew to about 2 cm, they were transplanted into pots and cultured in a greenhouse to obtain the rice plant Flag-OsFAD7 OE with the OsFAD7 gene.

[0060] Positive identification of transgenic plants: extract total protein from positive transgenic plants, prepare 15% SDS-PAGE separation gel and concentration gel, and perform protein electrophoresis. After the protein electrophoresis is completed, cut off the excess gel block and transfer the target protein to the nitrocellulose membrane; after the transfer, take out the nitrocellulose membrane and place it in 5% skim milk powder, block it at room temperature for 2 hours; then incubate it with Flag monoclonal antibody and wash it with TBST for 5 times; place the nitrocellulose membrane in the secondary antibody diluted at a ratio of 1:5000 (diluted in 5% skim milk powder) and incubate it for 1 hour; then add TBST and wash it for 5 times; evenly drop Super ECL plus color developing solution onto the nitrocellulose membrane, let it stand in the dark for 2 minutes, perform chemiluminescence imaging with BIO-RAD gel imaging system, and take pictures and record.

[0061] like Figure 1 As shown: The growth phenotype of Flag-OsFAD7 OE transgenic plants is consistent with that of wild-type rice ZH11 and rice plants transfected with the pCAMBIA1300 empty vector (EV), indicating that the OsFAD7 gene does not affect the normal growth and development of rice.

[0062] like Figure 2 As shown: The expression of OsFAD7 protein in Flag-OsFAD7 OE transgenic plants was detected and it was found that OsFAD7 protein can be expressed normally and stably.

[0063] Example 4: Artificial inoculation of RBSDV

[0064] (1) The control ZH11 and Flag-OsFAD7-OE transgenic rice seeds were placed in a constant temperature incubator at 37°C for 2 days, sown in a hydroponic box after the seeds germinated, and cultured in an artificial climate chamber at 30°C with 16 h light and 8 h dark;

[0065] (2) Use a brush to gently drive the non-virus gray leafhoppers onto rice plants infected with rice black-streak dwarf virus (RBSDV) to feed the virus for 3-5 days. Then transfer the infected gray leafhoppers to healthy rice seedlings for about 10 days. After the cycle is over, transfer the infected gray leafhoppers to the control ZH11 and Flag-OsFAD7-OE transgenic rice materials at the 2-3 leaf stage. Remove all the infected gray leafhoppers 3 days after infection. Figure 3 As shown: 14 days after inoculation, ZH11 plants showed obvious plant dwarfing symptoms, while the dwarfing symptoms of Flag-OsFAD7-OE transgenic rice were milder.

[0066] Total RNA was extracted from the control ZH11 and Flag-OsFAD7-OE transgenic rice plants inoculated with RBSDV, and reverse transcribed into cDNA using universal primers. RBSDV CP gene-specific quantitative detection primers were designed:

[0067] F:GCCCCACGTTGCATCTTC; R:TGTTGGGCAAAGTGCTAGTTTC;

[0068] The RT-qPCR method was used to detect the accumulation of RBSDV in the control ZH11 and Flag-OsFAD7-OE transgenic rice plants. Figure 4 As shown: The virus accumulation in Flag-OsFAD7-OE transgenic rice plants was significantly reduced compared with that in ZH11 plants.

[0069] The preferred embodiments of the present invention are described in detail above. The detailed description of the technical scheme of the present invention with the help of the optimized embodiment is illustrative rather than restrictive. It cannot be determined that the specific embodiments of the present invention are limited to this. For ordinary technicians in the technical field to which the present invention belongs, without departing from the concept of the present invention, modifications to the technical schemes recorded in the embodiments or equivalent replacement of some of the technical features therein should be deemed to fall within the scope of patent protection determined by the claims submitted by the present invention.

Claims

1. A method for preparing a plant with improved traits, the method comprising the step of overexpressing a desaturated acid lipase in a plant cell, a plant seed, a plant tissue, a plant part or a plant; the desaturated acid lipase is OsFAD7, and the improved trait is to increase the plant's resistance to black-streaked dwarf virus.

2. The method according to claim 1, characterized in that The method comprises over-expressing the desaturated acid lipase by using an expression vector, or integrating the desaturated acid lipase into a plant genome to over-express the desaturated acid lipase.

3. The method according to claim 1 or 2, characterized in that: The plant is a monocotyledon or a dicotyledon.

4. The method according to claim 3, characterized in that The plant is a monocotyledonous plant, preferably rice.

5. The method according to claim 1, characterized in that The amino acid sequence of the desaturated acid lipase has at least 70% sequence identity with SEQ ID No.

1.

6. A method for preparing a hybrid plant, wherein the hybrid plant is a plant obtained by hybridizing a plant prepared by any one of claims 1 to 5 with another plant.

7. Use of a desaturated acid lipase or a gene encoding it or a biological material comprising the desaturated acid lipase in preparing plants with improved traits, wherein the desaturated acid lipase is OsFAD7, and the improved traits are improving the resistance of the plants to black-streaked dwarf virus.

8. The use according to claim 7, characterized in that The biological material is selected from: a vector comprising the desaturated acid lipase or a gene encoding the desaturated acid lipase, or a host cell comprising the desaturated acid lipase or a gene encoding the desaturated acid lipase.

9. The use according to claim 7, characterized in that: The plant is a monocotyledonous plant or a dicotyledonous plant, preferably, rice.

10. The use according to claim 7, characterized in that The amino acid sequence of the desaturated acid lipase has at least 70% sequence identity with SEQ ID No. 1.

Images