SNP molecular marker located on pig chromosome 7 and associated with pig girth and application thereof
By detecting the genotype of the SNP site g.5332818C>T on pig chromosome 7, molecular marker-assisted selection technology was used to improve the waist circumference trait of Duroc pigs, solving the problem of slow breeding progress and achieving rapid and effective genetic improvement and economic benefits.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SOUTH CHINA AGRICULTURAL UNIVERSITY
- Filing Date
- 2023-12-04
- Publication Date
- 2026-06-09
AI Technical Summary
The lack of effective molecular markers in existing technologies for improving pig waist circumference traits has led to slow progress in Duroc pig breeding and affected the economic benefits of enterprises.
We provide SNP molecular markers and their primer pairs located on pig chromosome 7 that are associated with pig waist circumference. By detecting the genotype of the SNP site g.5332818C>T, we use molecular marker-assisted selection technology to eliminate individuals with the CC genotype and increase the frequency of the T allele in each generation, thereby increasing pig waist circumference.
It has accelerated the genetic improvement process of Duroc pigs, increased the waist circumference and weight of breeding pigs, enhanced the production competitiveness of commercial pigs, and improved the economic benefits of enterprises.
Smart Images

Figure CN119120712B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to a SNP molecular marker located on pig chromosome 7 that is associated with pig waist circumference and its application. Background Technology
[0002] Currently, my country's main breeding goal remains large-weight, lean-type pigs. Waist circumference, as an important body size trait, is closely related to many economic traits in livestock and poultry, and is therefore considered an important selection criterion in livestock and poultry breeding. A positive correlation has been reported between chest circumference and back fat thickness in Duroc pigs. Furthermore, chest circumference is also closely related to pig weight (r>0.7). Vargas et al. found a linear relationship between live weight and chest and abdominal circumference in goats. Although there is little research on waist circumference in livestock, it has been reported that waist circumference can predict non-abdominal fat, subcutaneous abdominal fat, and visceral fat in humans. Therefore, understanding the genetic structure of chest, abdominal, and waist circumference will help improve economic traits associated with these conformational traits.
[0003] Duroc pigs are one of the world's most popular commercial pig breeds and are widely used as the terminal sire for Duroc-Landrace-Large White pigs. The role of Duroc as a terminal sire directly affects the production performance of Duroc-Landrace-Large White pigs, and the production performance of commercial pigs directly impacts the economic benefits of farms. Therefore, if marker-assisted selection (MAS) technology can be used to improve the waist circumference trait of the core herd of Duroc pigs, the improved advantages can be passed on to commercial pig offspring to a greater extent, enhancing the production competitiveness of commercial pigs and thus improving the economic benefits of farms. Summary of the Invention
[0004] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide a SNP molecular marker located on chromosome 7 of pigs that is associated with pig waist circumference.
[0005] Another object of the present invention is to provide the application of the above-mentioned SNP molecular markers located on chromosome 7 of pigs and associated with pig waist circumference.
[0006] Another object of the present invention is to provide a primer pair for identifying the aforementioned SNP molecular markers located on pig chromosome 7 that are associated with pig waist circumference.
[0007] A fourth objective of this invention is to provide applications of the aforementioned primer pairs.
[0008] The fifth objective of this invention is to provide a method for genetic improvement of pigs.
[0009] The objective of this invention is achieved through the following technical solution:
[0010] A molecular marker of a pig's waist circumference associated with a SNP located on chromosome 7 of the pig, the SNP site of which corresponds to the C>T mutation at 5332818 bp on chromosome 7 of the International Pig Reference Genome 11.1;
[0011] The nucleotide sequence of the SNP molecular marker located on pig chromosome 7 that is associated with pig waist circumference is shown in SEQ ID NO.1, where M in the sequence is C or T, which leads to different pig waist circumference patterns;
[0012] The SNP site of the SNP molecular marker on pig chromosome 7 that is related to pig waist circumference is the C40-T40 nucleotide mutation at position 40 of the sequence marked in SEQ ID NO:1 (a single base mutation at the 40th nucleotide of this sequence fragment, named: g.5332818C>T);
[0013] The aforementioned SNP molecular markers located on chromosome 7 of pigs and associated with pig waist circumference are used in the identification of waist circumference traits and genetic breeding in Duroc pigs;
[0014] A method for detecting waist circumference in pigs includes the following steps:
[0015] The above-mentioned SNP molecular markers related to pig waist circumference located on pig chromosome 7 were detected. The single nucleotide at position 5332818 of the 5' end of the SNP molecular marker was determined to be either C or T.
[0016] The preferred type of pig is the American Duroc breed;
[0017] A primer pair for identifying the aforementioned SNP molecular markers on pig chromosome 7 that are associated with pig waist circumference, comprising primers primer-F and primer-R, has the following nucleotide sequence:
[0018] Upstream primer-F: 5'-TAGAGATGGTAAGTGGCGCC-3';
[0019] Downstream primer-R: 5'-GAAGACAGGTGAGGCAGAGT-3';
[0020] The application of the primer pairs described above in identifying the influence of waist circumference traits in breeding pigs;
[0021] Application of the primer pairs in marker-assisted breeding of pigs;
[0022] Application of the primer pairs in increasing waist circumference in breeding pigs;
[0023] A method for genetic improvement of pigs, comprising the following steps:
[0024] Identify the aforementioned SNP molecular markers related to waist circumference on chromosome 7 of pigs in the core breeding population, and make corresponding selections based on these molecular markers: crossbreed individuals with the CT genotype in the core population, and select breeding pigs with the TT and CT genotypes at position 5332818bp on chromosome 7 of the International Swine Reference Genome 11.1 for subsequent generations, while eliminating breeding pigs with the CC genotype at this position, in order to increase the frequency of the T allele at this locus in each generation, thereby increasing the waist circumference of the offspring pigs;
[0025] The preferred type of pig is the American Duroc breed;
[0026] The present invention has the following advantages and effects compared with the prior art:
[0027] (1) This invention studies and identifies the molecular markers that affect pig waist circumference and are located on the nucleotide sequence of pig chromosome 7. It verifies their effect on pig waist circumference traits and finally establishes a molecular marker-assisted selection breeding technology for rapid improvement of pig waist circumference traits. This greatly improves the breeding process of Duroc, meets the needs of the live pig market, increases the price of meat pigs, increases the sales profit of enterprises, and enhances their core competitiveness.
[0028] (2) This invention provides a primer pair for SNP molecular markers located on chromosome 7 of pigs that are related to pig waist circumference. Through this primer pair, an efficient and accurate molecular marker-assisted breeding technology can be established, and traits can be selected quickly and accurately, accelerating the breeding process. It can be applied to the genetic improvement of waist circumference traits in breeding pigs, thereby increasing the waist circumference of pigs, thereby increasing enterprise profits and core competitiveness.
[0029] (3) By selecting the dominant allele of the molecular marker, the present invention provides a method for pig breeding, which can accelerate the genetic progress of Duroc pigs, shorten the time for Duroc improvement, thereby effectively improving the economic benefits of breeding pigs and increasing the profits of enterprises. Attached Figure Description
[0030] Figure 1 This is a genome-wide association study (GWAS) diagram of waist circumference in Duroc pigs on chromosome 7 in American Duroc breeds; where: the horizontal axis represents the chromosome number of the pig; and the vertical axis represents the -logP value.
[0031] Figure 2 This is a graph showing the waist circumference results of pigs with different genotypes. Detailed Implementation
[0032] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0033] Experimental pig herd: A total of 3,479 American Duroc pigs were used in this experiment.
[0034] Example 1
[0035] (1) Laboratory animals
[0036] The experimental pig herd used in this invention consisted of 3,479 purebred American Duroc pigs from the breeding pig division of Guangdong Wens Foodstuff Group Co., Ltd. This herd was the core group of the breeding pig division, and its pedigree records were detailed. The pigs selected for this experiment were fed and watered freely under standardized feeding conditions.
[0037] (2) Sample collection
[0038] Ear tissues from the above-mentioned experimental pigs were collected, soaked in a 75% ethanol solution, and stored at -20°C for later use.
[0039] (3) Pig genome 50K SNP genotyping
[0040] DNA was extracted from ear-like tissue using the phenol-chloroform method as per the standard procedure. The DNA from purebred American Duroc populations was analyzed for quality and concentration using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. All acceptable DNA samples were then uniformly diluted to 50 nmol / µL. 50K SNP genotyping of the entire porcine genome was performed using the GeneSeek Genomic Profiler Porcine 50K SNP genotyping platform. Microarray hybridization and result scanning were conducted according to the Illumina Infinium user manual and standard procedures. Genotypic data were finally retrieved using GenomeStudio software.
[0041] (4) Pig whole genome 50K chip genotyping
[0042] In addition, we filled the genotype data using the SWIM database (http: / / 192.168.142.36:9088 / # / home) to obtain genotype-filled data for American Duroc pigs. To ensure the accuracy and reliability of subsequent genome-wide association analysis results, this study used PLINK v1.9 to perform quality control on the obtained genotype data, removing those with a detection rate <90%, mimor allel frequency (MAF) <1%, or deviations from Hardy-Weinberg equilibrium (HWE) with a p-value ≤10. -6SNP markers were selected, excluding individuals with a detection rate <95%, a family Mendelian error rate >0.1, and SNPs located at unknown locations or on sex chromosomes. The remaining 7,442,761 SNP markers and 3,479 samples from quality control were used for subsequent data analysis.
[0043] (5) Genome-wide association study (GWAS):
[0044] To eliminate population stratification effects, this invention employs a linear mixed model with single-point regression analysis combined with GWAS analysis using the GenABEL software package in R. The analysis model utilizes inter-individual genome similarity to correct for stratification effects. In this study, the chromosome significance threshold was set at 1.00 × 10⁻⁶. -5 .
[0045] GWAS analysis results are as follows Figure 1 As shown. From Figure 1 It is known that in Duroc, there is a locus on chromosome 7 that significantly affects waist circumference, with the strongest association SNP being g.5332818C>T (P = 4.65 × 10⁻⁶). -6 (The 40th nucleotide in SEQ NO.1 corresponds to the C>T mutation at 5332818 bp on chromosome 7 in International Pig Reference Genome Version 11.1).
[0046] (6) Association analysis between different genotypes and waist circumference phenotype in breeding pigs:
[0047] Table 1 shows that the SNP site g.5332818C>T of the molecular marker was significantly correlated with waist circumference (P<0.01), indicating that this molecular marker significantly affects waist circumference in pigs. Assisted selection at this SNP site in pigs could increase waist circumference in the population, thereby accelerating the breeding process of lean-type pigs. Furthermore, according to Table 1... Figure 2 Furthermore, the CT genotype has a higher waist circumference than the CC genotype, indicating that homozygous CC is detrimental to waist circumference in breeding pigs. Waist circumference is an important indicator of growth performance in breeding pigs; a larger waist circumference indicates better growth performance. Therefore, pigs with the CC genotype have relatively poor growth performance. In the breeding process, we need to gradually cull CC-type breeding pigs and retain CT-type breeding pigs to increase the frequency of the T allele at this locus through each generation.
[0048] Table 1. Correlation between SNP sites of molecular markers (g. 5332818C>T) and traits.
[0049]
[0050] Example 2 explains in detail the invention process of detecting SNP markers.
[0051] (1) The target fragment containing the SNP site that is significantly associated with waist circumference performance of the American Duroc strain is a 211 bp nucleotide sequence from chromosome 7. The upstream and downstream primers for sequence amplification are primer-F and primer-R, and their nucleotide sequences are as follows:
[0052] Upstream primer-F: 5'-AGGTCAGAGTGGGGCAGTAA-3';
[0053] Downstream primer primer-R: 5'-AATGGGATTGGATGCGGGTT-3'.
[0054] (2) PCR amplification system and conditions
[0055] Prepare a 10 μL system, including 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O. The PCR conditions are: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, and a final extension at 72℃ for 5 min.
[0056] (3) DNA Sequence Sequencing Identification: Sequencing was performed at BGI Genomics Co., Ltd. in Shenzhen, with two sequencing reactions for each gene fragment. The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites. The sequencing results are shown below:
[0057] TAGAGATGGTAAGTGGCGCCCAGAGAGCATACCCTTTAC M(C / T) TGCAAGCCCACCACCCCAGAGCCCACGCCCCAACCACCTTTTTTACTGGGCTCTCACGCCGCTGGGCCAGTACCCATCTGCCCAACTAGGGCCCGCCCTGTGGCCCAGCACCTGCTGAAACTATTCAACCCAGCGAATCCTAAACCCTGCCTACTCTGCCTCACCTGTCTTC
[0058] Note: M marked in the sequence is the mutation site, indicated by an underline (the mutated base in parentheses represents the allele mutation). The beginning and end of the sequence are bolded to indicate the primer binding position.
[0059] Example 3: Analysis of the SNP site g.5332818C>T effect of molecular markers
[0060] This invention provides a SNP molecular marker that can significantly increase waist circumference in Duroc breeding pigs. Using this SNP molecular marker for marker-assisted selection can greatly accelerate the waist circumference breeding process in Duroc pigs. As shown in Table 1, the frequency of the dominant allele T at the SNP locus g.5332818C>T is 0.018 in the population. Therefore, by using molecular marker-assisted selection to gradually cull pigs with the CC genotype within the population, the allele frequency of allele T can be significantly increased, thereby increasing waist circumference, indirectly increasing body weight, accelerating the improvement of lean-type pigs, and effectively improving the economic benefits of pig breeding.
[0061] This invention utilizes the detection of the 40th base mutation site in the SEQ ID NO:1 sequence to perform preliminary association analysis between genotype and waist circumference, providing a novel molecular marker for marker-assisted selection in breeding pigs.
[0062] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. The application of a SNP molecular marker located on pig chromosome 7 that is associated with pig waist circumference in the identification of pig waist circumference traits and in the genetic improvement of pig waist circumference, characterized in that, The nucleotide sequence of the SNP molecular marker on chromosome 7 of pigs that is associated with pig waist circumference is shown in SEQ ID NO.1, where M in the sequence is C or T, which leads to different pig waist circumference traits. Pigs with the CT genotype have a higher waist circumference than those with the CC genotype. The pigs mentioned are American Duroc breeds.
2. A method for detecting waist circumference traits in pigs, characterized in that, It includes the following steps: Detect the SNP molecular markers on pig chromosome 7 as described in claim 1 that are associated with pig waist circumference, wherein the nucleotides of the SNP molecular markers are C or T, and pigs with the CT genotype have a higher waist circumference than those with the CC genotype. The pigs mentioned are American Duroc breeds.
3. The application of a primer pair in identifying waist circumference traits in breeding pigs, characterized in that: The primer pair is used to identify the SNP molecular marker located on chromosome 7 of pigs and associated with pig waist circumference as described in claim 1, and includes primers primer-F and primer-R, whose nucleotide sequences are as follows: Upstream primer-F: 5'-TAGAGATGGTAAGTGGCGCC-3'; Downstream primer-R: 5'-GAAGACAGGTGAGGCAGAGT-3'; The SNP molecular marker indicated that the CT genotype had a higher waist circumference in pigs than the CC genotype. The pigs mentioned are American Duroc breeds.
4. The application of a primer pair in marker-assisted breeding of pigs, characterized in that: The primer pair is used to identify the SNP molecular marker located on chromosome 7 of pigs and associated with pig waist circumference as described in claim 1, and includes primers primer-F and primer-R, whose nucleotide sequences are as follows: Upstream primer-F: 5'-TAGAGATGGTAAGTGGCGCC-3'; Downstream primer-R: 5'-GAAGACAGGTGAGGCAGAGT-3'; The SNP molecular marker indicated that the CT genotype had a higher waist circumference in pigs than the CC genotype. The pigs mentioned are American Duroc breeds.
5. A method for genetic improvement of pigs, characterized in that, It includes the following steps: Identify the SNP molecular markers related to pig waist circumference on chromosome 7 of pigs as described in claim 1 in the core breeding pig population, and make corresponding selections based on the molecular markers: select breeding pigs with the CT genotype of the SNP molecular markers as described in claim 1 for successive generations, eliminate breeding pigs with the CC genotype, and increase the frequency of the allele T at this locus in each generation to increase the waist circumference of the offspring pigs. The pigs mentioned are American Duroc breeds.