Device for detecting heart virus infection and application thereof

Abstract

The invention provides a device for detecting heart virus infection and application of the device, and the device comprises an RNA virus detection module which adopts a Pan-PCR strategy to carry out amplification detection on eight known types of RNA viruses; the DNA virus detection module adopts a capture probe to detect DNA viruses, and the capture probe is designed based on viruses and sequences detected by capture sequencing; and the metagenome sequencing module is used for carrying out virus metagenome sequencing on samples with negative results of the RNA virus detection module and the DNA virus detection module. According to the method, virus detection is carried out on the heart tissue through a step-by-step detection strategy, and the method is the most comprehensive detection method in current detection means. Firstly, known RNA viruses are detected, then DNA viruses are detected, and when the detection is negative, metagenome sequencing is carried out. According to the method, the accuracy and efficiency of heart virus infection detection are improved.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and in particular relates to a device for detecting cardiac virus infection and application thereof. Background Art

[0002] Myocarditis is a common inflammatory heart disease, accounting for about 8.6%-12% of sudden cardiac death in young adults. In clinical practice, patients with the novel coronavirus 2019 (COVID-19) often suffer from cardiac damage, with the incidence of myocarditis being about 1%-7%. Myocarditis is unique in that its initial symptoms are not significant. However, as inflammation gradually intensifies, it may cause acute and fatal cardiovascular events such as heart failure, cardiogenic shock, and even sudden death. Therefore, early and accurate detection of myocarditis is crucial so that timely and aggressive treatment can be implemented to reduce the incidence of fatal cardiovascular events.

[0003] Viral infection is considered to be the main cause of myocarditis, and some viruses are particularly closely related to myocarditis. The first to be affected is Coxsackievirus, especially group B virus, which is highly associated with myocarditis. Group B virus is an enterovirus that is widely present in the population, and the infection rate in children is particularly high. After infection with group B virus, patients may experience symptoms such as fever, rash, muscle pain, and even myocarditis in severe cases. Secondly, adenovirus is also a common virus that can cause myocarditis and respiratory infections. Adenovirus is widely distributed in nature and among people, and is mainly transmitted through droplets. After infection with adenovirus, patients may experience symptoms such as fever, cough, sore throat, and myocarditis in severe cases. Although rubella virus is a rare cause of myocarditis, it is still one of the potential causes. Rubella virus is mainly transmitted through droplets, and after infection, symptoms such as rash, fever, and joint pain are manifested. Pregnant women infected with rubella virus may cause congenital malformations, and in severe cases, may cause myocarditis. Influenza virus is also a common virus that causes myocarditis, especially in severe cases of influenza. Influenza virus is transmitted through droplets and contact, and symptoms after infection include fever, cough, sore throat, muscle aches, etc. Parvovirus B19 (PVB19) is mainly transmitted through contact, and infection can cause symptoms such as fever and rash, leading to myocarditis. Finally, although human immunodeficiency virus (HIV) is relatively rare, it may still be associated with myocarditis. HIV is an immune system virus that causes damage to the immune system after infection, increasing the risk of infection with other viruses. In some cases, HIV infection may lead to myocarditis. In addition to the viruses mentioned above, Epstein-Barr virus, cytomegalovirus, etc. are also related to the occurrence of myocarditis. These viruses affect myocardial cells through different mechanisms, leading to the occurrence of myocarditis.

[0004] The diagnosis of viral myocarditis is mainly attempted by detecting viruses in body fluids, such as blood or saliva. However, existing detection methods still have certain limitations in diagnostic accuracy. It is worth noting that viral myocarditis has the potential to restore cardiac function with early therapeutic intervention. Therefore, timely and accurate diagnosis is crucial for early treatment to prevent chronic fibrosis, permanent loss of cardiac function, and even the occurrence of heart failure. Although viral infection plays an important role in the pathogenesis of lymphocytic myocarditis, most cases are negative for PCR and only positive for parvovirus B19. In patients with chronic heart failure, viruses (mainly PVB19) were detected in 67% of endomyocardial biopsy samples by PCR analysis, and 27% of the samples showed myocardial infection caused by different pathogens. The presence of these viruses may be related to the chronic course of myocarditis and persistent myocardial damage. Therefore, therapeutic strategies targeting these viruses may improve the condition of patients with chronic heart failure.

[0005] The virus that infects the heart is a cardiophagic virus, which can be divided into integrated viruses and non-integrated viruses. The current detection strategy used in clinical and research is to use a single PCR technology to detect certain viruses in myocardial tissue. This technology has obvious technical loopholes and is difficult to fully detect potential viral infection sequences in the heart. Therefore, in order to achieve more comprehensive detection of cardiac viruses, it is necessary to build a new cardiac virus infection detection strategy. Summary of the invention

[0006] In view of the shortcomings of the prior art, the purpose of the present invention is to provide a device for detecting cardiac virus infection and its application. The present invention uses the Pan-PCR strategy to comprehensively detect the eight known RNA viruses, ensuring that all known RNA viruses are covered. The step-by-step detection of cardiac virus infection is achieved, which improves the accuracy and efficiency of the detection.

[0007] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides a device for detecting cardiac viral infection, the device comprising:

[0009] RNA virus detection module, which uses Pan-PCR strategy to amplify and detect eight known types of RNA viruses, including Coronavirus, Filamentous virus, Bocavirus, Astrovirus, Influenza virus, Hepatitis E Virus, Eeterovirus 71, and Paramyxovirus;

[0010] The DNA virus detection module uses a capture probe to detect DNA viruses. The capture probe is designed based on the viruses and sequences to be detected by capture sequencing. The DNA viruses include human immunodeficiency virus-1, human T-lymphotropic virus 1, hepatitis B virus-a, herpes virus-6A, Epstein-Barr Virus, adeno-associated virus-2, human papillomavirus type-16, Marek's disease virus, adenovirus, Merkel cell polyomavirus, lymphocytic choriomeningitis virus, Bornavirus 1, hepatitis C virus, virus), Coxsackievirus B3, Influenza Avirus, and cytomegalovirus;

[0011] The metagenomic sequencing module performs viral metagenomic sequencing on samples whose results are negative for both the RNA virus detection module and the DNA virus detection module.

[0012] Currently, the types of viruses that infect the heart can be divided into integrated (DNA viruses) and non-integrated (RNA viruses). For RNA viruses, the current detection strategy is PCR detection of specific types of viruses, and there is a lack of detection strategies for DNA viruses in clinical practice. Although there are methods for detecting body fluids, the biggest drawback of this method is poor specificity and the inability to determine the location of infection.

[0013] The present invention realizes virus detection in cardiac tissue through a step-by-step detection strategy, which is the most comprehensive detection method among the current detection methods. First, the known RNA viruses are detected through 8 known virus genera (which can cover all current RNA virus species), and then the DNA viruses are detected. The candidate viruses are all currently known cardiophagic viruses that can be integrated into the heart. When no known virus type is detected, macrogene detection is performed to achieve comprehensive virus screening.

[0014] In the present invention, the Pan-PCR strategy refers to: performing PCR detection on the virus species.

[0015] Preferably, primers for amplifying coronavirus include CoV-FWD2 and CoV-RVS2;

[0016] CoV-FWD2: GGCWCCWCCHGGNGARCAATT, SEQ ID NO.1;

[0017] CoV-RVS2: GGWAWCCCCAYTGYTGWAYRTC, SEQ ID NO.2.

[0018] Preferably, primers for amplifying filovirus include Filo-MOD-FWD and Filo-MOD-RVS;

[0019] Filo-MOD-FWD: TNTTYTCHVTNCAAAANCAYTGGG, SEQ ID NO.3;

[0020] Filo-MOD-RVS:GCYTCNSMNANNGTTTGNACATT, SEQ ID NO.4.

[0021] Preferably, primers for amplifying Bocavirus include panBOV-R and panBOV-F2;

[0022] panBOV-R: GTACAGTCRTAYTCRTTRAARCACCA, SEQ ID NO.5;

[0023] panBOV-F2: GCAYCARGAYTGGGTNGANCCWGC, SEQ ID NO. 6.

[0024] Preferably, primers for amplifying retrovirus (Astrovirus) include Astr4380F and Astr4811R;

[0025] Astr4380F: GAYTGGRCNCGNTWYGATGGNACNAT, SEQ ID NO.7;

[0026] Astr4811R: GGYTTNACCCACATNCCAAA, SEQ ID NO. 8.

[0027] Preferably, the primers for amplifying influenza virus include FLUAPB1-R and FLUAPB1-NF;

[0028] FLUAPB1-R: GCNGGNCCNAKDTCRYTRTTDATCAT, SEQ ID NO.9;

[0029] FLUAPB1-NF: GATGGGNATGTTYAAYATGYTDAGYAC, SEQ ID NO. 10.

[0030] Preferably, the primers for amplifying Hepatitis E Virus include Hepac-F3842 and Hepac-R4229;

[0031] Hepac-F3842: ACDGAYGCKACWACKGTSCTGGGCAT, SEQ ID NO.11;

[0032] Hepac-R4229: ARCWGTCGTARACMGARTCSAARTTRCC, SEQ ID NO. 12.

[0033] Preferably, primers for amplifying Ebovirus 71 include EV5UTRF and EV5UTRR;

[0034] EV5UTRF: GGTCAAGCACTTCTGTTTCCC, SEQ ID NO.13;

[0035] EV5UTRR: GAAACACGGWCACCCAAAGTASTCG, SEQ ID NO. 14.

[0036] Preferably, primers for amplifying Paramyxovirus include PAR-R and PAR-F2;

[0037] PAR-R:GCTGAAGTTACNGGNTCNCCDATRTTNC, SEQ ID NO.15;

[0038] PAR-F2: GTTGCTTCAATGGGTTCARGGNGAYAA, SEQ ID NO. 16.

[0039] The RNA virus amplification primers in the present invention are more comprehensive than previous strategies, covering the most complete RNA virus types currently, achieving comprehensive coverage of virus detection, and can detect as long as a known RNA virus infection exists.

[0040] Preferably, the capture probes cover the entire genome of the DNA virus.

[0041] In the present invention, the size of the capture probe of human immunodeficiency virus-1 is 9181 nt.

[0042] Preferably, the size of the capture probe of human T-lymphotropic virus 1 is 9043 nt.

[0043] Preferably, the size of the capture probe of hepatitis B virus-a is 3215 nt.

[0044] Preferably, the size of the capture probe of Herpes virus-6A is 162114 nt.

[0045] Preferably, the size of the capture probe of Epstein-Barr Virus is 172764 nt.

[0046] Preferably, the capture probe of Adeno-Associated Virus-2 has a size of 4679 nt.

[0047] Preferably, the size of the capture probe for human papillomavirus type-16 is 7906 nt.

[0048] Preferably, the capture probe of Marek's disease virus has a size of 174077 nt.

[0049] Preferably, the size of the adenovirus capture probe is 35937 nt or 34125 nt.

[0050] Preferably, the size of the capture probe of Merkel cell polyomavirus is 5387 nt.

[0051] Preferably, the capture probe of lymphocytic choriomeningitis virus has a size of 3394 nt or 7124 nt.

[0052] Preferably, the size of the capture probe of Bornavirus 1 is 9006nt or 8786nt.

[0053] Preferably, the size of the capture probe of hepatitis C virus is 9358 nt.

[0054] Preferably, the size of the capture probe of Coxsackievirus B3 is 7389 nt.

[0055] Preferably, the size of the capture probe for influenza A virus is 1411 bp.

[0056] Preferably, the size of the cytomegalovirus capture probe is 229354 nt.

[0057] At present, there are only two types of cardioviruses for detection, respiratory viruses and enteroviruses, both of which belong to RNA viruses, and the detection of DNA viruses has not yet been involved. The virus detection probe in the present invention is the only cardiovirus-related probe currently, which can conveniently and quickly perform DNA virus detection on heart tissue, and the selected DNA virus species are the most complete DNA virus species currently recognized by the academic community.

[0058] After capturing the DNA virus, the DNA fragment product is amplified.

[0059] In the present invention, in the metagenomic sequencing module, the method for determining which virus is infected is: the virus detection gold standard (gene detection + first generation verification). That is, the infection situation is determined based on the sequencing results.

[0060] In a second aspect, the present invention provides a primer and probe combination for detecting cardiac viral infection, comprising a primer for detecting RNA viruses and a capture probe for detecting DNA viruses;

[0061] The RNA viruses include Coronavirus, Filamentous virus, Bocavirus, Astrovirus, Influenza virus, Hepatitis E virus, Eterovirus 71 and Paramyxovirus;

[0062] The DNA viruses include human immunodeficiency virus-1, human T-lymphotropic virus 1, hepatitis B virus-a, herpes virus-6A, Epstein-Barr Virus, adeno-associated virus-2, human papillomavirus type-16, Marek's disease virus, adenovirus, Merkel cell polyomavirus, lymphocytic choriomeningitis virus, Bornavirus 1, hepatitis C virus, Coxsackievirus B3, influenza A virus and cytomegalovirus.

[0063] Preferably, primers for amplifying coronavirus include CoV-FWD2 and CoV-RVS2;

[0064] CoV-FWD2: GGCWCCWCCHGGNGARCAATT, SEQ ID NO.1;

[0065] CoV-RVS2: GGWAWCCCCAYTGYTGWAYRTC, SEQ ID NO.2.

[0066] Preferably, primers for amplifying filovirus include Filo-MOD-FWD and Filo-MOD-RVS;

[0067] Filo-MOD-FWD: TNTTYTCHVTNCAAAANCAYTGGG, SEQ ID NO.3;

[0068] Filo-MOD-RVS:GCYTCNSMNANNGTTTGNACATT, SEQ ID NO.4.

[0069] Preferably, primers for amplifying Bocavirus include panBOV-R and panBOV-F2; panBOV-R: GTACAGTCRTAYTCRTTRAARCACCA, SEQ ID NO.5;

[0070] panBOV-F2: GCAYCARGAYTGGGTNGANCCWGC, SEQ ID NO. 6.

[0071] Preferably, primers for amplifying retrovirus (Astrovirus) include Astr4380F and Astr4811R; Astr4380F: GAYTGGRCNCGNTWYGATGGNACNAT, SEQ ID NO.7;

[0072] Astr4811R: GGYTTNACCCACATNCCAAA, SEQ ID NO. 8.

[0073] Preferably, the primers for amplifying influenza virus include FLUAPB1-R and FLUAPB1-NF;

[0074] FLUAPB1-R: GCNGGNCCNAKDTCRYTRTTDATCAT, SEQ ID NO.9;

[0075] FLUAPB1-NF: GATGGGNATGTTYAAYATGYTDAGYAC, SEQ ID NO. 10.

[0076] Preferably, the primers for amplifying Hepatitis E Virus include Hepac-F3842 and Hepac-R4229;

[0077] Hepac-F3842: ACDGAYGCKACWACKGTSCTGGGCAT, SEQ ID NO.11;

[0078] Hepac-R4229: ARCWGTCGTARACMGARTCSAARTTRCC, SEQ ID NO. 12.

[0079] Preferably, primers for amplifying Ebovirus 71 include EV5UTRF and EV5UTRR;

[0080] EV5UTRF: GGTCAAGCACTTCTGTTTCCC, SEQ ID NO.13;

[0081] EV5UTRR: GAAACACGGWCACCCAAAGTASTCG, SEQ ID NO. 14.

[0082] Preferably, primers for amplifying Paramyxovirus include PAR-R and PAR-F2;

[0083] PAR-R:GCTGAAGTTACNGGNTCNCCDATRTTNC, SEQ ID NO.15;

[0084] PAR-F2: GTTGCTTCAATGGGTTCARGGNGAYAA, SEQ ID NO. 16.

[0085] Preferably, the capture probes cover the entire genome of the DNA virus.

[0086] Preferably, the size of the capture probe of human immunodeficiency virus-1 is 9181 nt.

[0087] Preferably, the size of the capture probe of human T-lymphotropic virus 1 is 9043 nt.

[0088] Preferably, the size of the capture probe of hepatitis B virus-a is 3215 nt.

[0089] Preferably, the size of the capture probe of Herpes virus-6A is 162114 nt.

[0090] Preferably, the size of the capture probe of Epstein-Barr Virus is 172764 nt.

[0091] Preferably, the capture probe of Adeno-Associated Virus-2 has a size of 4679 nt.

[0092] Preferably, the size of the capture probe for human papillomavirus type-16 is 7906 nt.

[0093] Preferably, the capture probe of Marek's disease virus has a size of 174077 nt.

[0094] Preferably, the size of the adenovirus capture probe is 35937 nt or 34125 nt.

[0095] Preferably, the size of the capture probe of Merkel cell polyomavirus is 5387 nt.

[0096] Preferably, the capture probe of lymphocytic choriomeningitis virus has a size of 3394 nt or 7124 nt.

[0097] Preferably, the size of the capture probe of Bornavirus 1 is 9006nt or 8786nt.

[0098] Preferably, the size of the capture probe of hepatitis C virus is 9358 nt.

[0099] Preferably, the size of the capture probe of Coxsackievirus B3 is 7389 nt.

[0100] Preferably, the size of the capture probe for influenza A virus is 1411 bp.

[0101] Preferably, the size of the cytomegalovirus capture probe is 229354 nt.

[0102] In a third aspect, the present invention provides a kit for detecting cardiac viral infection, wherein the kit comprises the primer and probe combination for detecting cardiac viral infection according to the second aspect.

[0103] Preferably, the kit further comprises any one of a nucleic acid extraction reagent, an mRNA reverse transcription reagent or a DNA amplification reagent, or a combination of at least two thereof.

[0104] In a fourth aspect, the present invention provides use of the device for detecting cardiac viral infection described in the first aspect, the primer and probe combination for detecting cardiac viral infection described in the second aspect, or the kit for detecting cardiac viral infection described in the third aspect in the preparation of a product for detecting myocarditis.

[0105] The numerical range described in the present invention not only includes the point values ​​listed above, but also includes any point values ​​between the above numerical ranges that are not listed. Due to space limitations and for the sake of simplicity, the present invention no longer exhaustively lists the specific point values ​​included in the range.

[0106] Compared with the prior art, the present invention has the following beneficial effects:

[0107] (1) The RNA virus amplification primers in the present invention are more comprehensive than previous strategies, covering the most complete RNA virus types currently, and achieving comprehensive coverage of virus detection. As long as there is a known RNA virus infection, it can be detected.

[0108] (2) The virus detection probe in the present invention is the only cardiomyocyte virus-related probe currently available, and can be used to conveniently and quickly detect DNA viruses in cardiac tissues. The selected DNA virus species are the most complete DNA virus species currently recognized by the academic community.

[0109] (3) The present invention realizes virus detection on cardiac tissue through a step-by-step detection strategy, which is the most comprehensive detection method currently available. BRIEF DESCRIPTION OF THE DRAWINGS

[0110] Figure 1 This is the result of PCR analysis of coronavirus and filovirus genomes in myocardial tissue of patients with myocarditis.

[0111] Figure 2 This is the result of PCR analysis of Ebolavirus 71, Paramyxovirus and Astrovirus genomes in myocardial tissue of patients with myocarditis.

[0112] Figure 3 This is the result of PCR analysis of influenza virus, Bocavirus and Hepatitis E Virus genomes in myocardial tissue of patients with myocarditis.

[0113] Figure 4 This is the result of PCR analysis of the PVB19 genome in myocardial tissue of patients with myocarditis.

[0114] Figure 5 is a schematic diagram of the process of detecting cardiac viral infection. DETAILED DESCRIPTION

[0115] The technical solution of the present invention is further described below by specific implementation methods. It should be understood by those skilled in the art that the embodiments are only to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0116] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0117] Example 1

[0118] 1. Patient population

[0119] Patients who underwent heart transplantation for cardiac insufficiency between January 2009 and January 2021 were included in the study if they met the following criteria: (1) successful CMR or ultrasound imaging to assess ventricular size and function, (2) exclusion of coronary artery disease by invasive angiography or exclusion of atherosclerosis by coronary artery pathology, and (3) cardiac pathology fulfilling the Dallas criteria for myocarditis pathology. Patients with valvular disease, hypertrophic cardiomyopathy, congenital heart disease, and those with other severe organ diseases were not included, and a total of 40 patients were included. This study was approved by the Ethics Committee of Beijing Fuwai Hospital, and the study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki. All patients gave written informed consent at the time of enrollment. The established histological criteria were defined as follows: histological evidence of inflammatory infiltration within the myocardium with non-ischemic myocyte degeneration and necrosis. White blood cells ≥14 cells / mm 2 , of which monocytes are up to 4 / mm 2 , CD3 positive T lymphocytes ≥ 7 / mm 2 Inflammation grade (defined as grade I: white blood cells ≥ 14 / mm 2 , of which monocytes do not exceed 4 / mm 2 , CD3 positive T lymphocytes ≥ 7 / mm 2 ; If the level I count is greater than twice the level II count, it is defined as level II).

[0120] 2. Capture and sequence the virus and sequence detected

[0121] Table 1 contains relevant information about the virus.

[0122] Table 1

[0123]

[0124]

[0125] In Table 1, integration / non-integration means that these viruses are common types of viral infections and are generally believed not to integrate into the genome, but some studies have shown that they may integrate. Therefore, in this application, they are included in the scope of DNA virus detection.

[0126] 3. Virus and primer design for Pan-PCR detection

[0127] The virus and primer designs are shown in Table 2.

[0128] Table 2

[0129]

[0130] 4. Viral Metagenomics Detection Method: Sword of Viral Metagenomics (SVM)

[0131] (1) Experimental Materials

[0132] Experimental reagents: 20% sucrose, animal tissue, 20% sucrose solution (wt / vol) sterilized by filtration, PBS sterilized by filtration, Ty70Ti ultracentrifuge tubes, 1.5mL and 2.0mL enzyme-free centrifuge tubes, grinding steel beads. TaKaRa reagents are shown in Table 3.

[0133] Table 3

[0134]

[0135] (2) Experimental procedures

[0136] 2.1 Virus Concentration in Animal Tissue Samples

[0137] 2.1.1 Take 100 mg of tissue sample, add 1 mL of PBS, add 3 grinding steel beads (3 mm), and shake and grind for 2 minutes.

[0138] 2.1.2 Centrifuge the grinding solution at 4°C and 13,000 g for 10 min to remove the residue and collect the supernatant.

[0139] 2.1.3 Take 500 μL of supernatant from each sample of each tissue, mix them into a pool, place them in a 15 mL centrifuge tube, and filter them with a 0.45 μm filter.

[0140] 2.1.4 Spread 5 mL of 20% (wt / vol) sucrose in a Ty70Ti centrifuge tube, slowly add the filtrate of each sample along the tube wall without dispersing the sucrose pad, and then add PBS to the tube mouth (keep the vacuum in the tube).

[0141] 2.1.5 After weighing and balancing, centrifuge at 450,000 g for 2 h at 4°C.

[0142] 2.1.6 Remove the supernatant, resuspend the precipitate in 500 μL PBS, and gently mix to completely dissolve it. Take 174 μL and place it in a 1.5 mL enzyme-free centrifuge tube and store it at 4°C for subsequent experiments. The remaining sample is also placed in a 1.5 mL enzyme-free centrifuge tube and frozen at -80°C.

[0143] 2.2 Ribozyme digestion

[0144] The free nucleic acid without capsid protection was digested, and the digestion reaction system was shown in Table 4.

[0145] Table 4

[0146]

[0147] 2.3 Nucleic acid extraction

[0148] The digested samples were extracted using the viral genomic DNA / RNA extraction kit (DP315) and eluted with 60 μL of enzyme-free sterile water.

[0149] 2.4sscDNA synthesis (synthesis of two tubes)

[0150] The reaction system is shown in Table 5.

[0151] Table 5

[0152]

[0153] 2.5 RNA degradation

[0154] Add 1 μL RNase H (ribonuclease H) to the obtained cDNA solution and react at 37°C for 30 minutes for backup.

[0155] 2.6 sscDNA purification

[0156] Nucleic acid purification method - ethanol precipitation method:

[0157] 2.6 1 Add 3M NaAc (3 mol / L, pH=5.2) at a volume of 1 / 10 of the DNA solution and mix thoroughly.

[0158] 2.6 2 Add 2.5 times the volume of pre-cooled 100% ethanol and shake to mix thoroughly.

[0159] 2.6.3 Transfer it to -20℃ and let it stand for more than 30 minutes.

[0160] 2.6.4 Centrifuge at 12000 rpm for 15 min at 4°C to precipitate DNA.

[0161] 2.6.5 Discard the supernatant, add 1 / 2 the capacity of the centrifuge tube to 70% ethanol, rinse the precipitate, and centrifuge at 12000g at 4℃ for 10 min.

[0162] 2.6.6 Discard the supernatant and add an appropriate amount of TE buffer to dissolve the precipitate after drying.

[0163] 2.7dscDNA Synthesis

[0164] Table 6

[0165]

[0166] 2.8 Single Primer Amplification

[0167] Prepare the amplification system according to Table 7.

[0168] Table 7

[0169] stencil 2 Primers 2 dNTPs (2.5 mM) 8 <![CDATA[10×PCR Buffer (Mg 2+ plus)]]> 5 Ex Taq 1 <![CDATA[H2O]]> 32 total 50

[0170] The amplification program was: 94°C for 3 min (94°C for 30 s, 50°C for 30 s, 72°C for 2 min), 35 cycles, and 72°C for 5 min.

[0171] 2.9 DNA testing

[0172] 2.9.1 Product inspection: Take 5 μL of PCR product for electrophoresis and observe the bands.

[0173] 2.9.2 Product recovery: Recover the PCR product according to the DNA purification method (ethanol precipitation method).

[0174] The DNA solution was tested with NanoDrop to determine its quality, i.e., the concentration was not less than 30 ng / μL and the 260 / 280 value should be between 1.8-2.0.

[0175] 2.10 Experimental Results

[0176] Multiple single primer amplifications were performed and recovered until the total amount reached 5 μg and sent for sequencing.

[0177] 5. Molecular biological analysis and sequencing of viral genome

[0178] Polymerase chain reaction (PCR) was performed to verify the virus type detected above, taking PVB-19 as an example. The viral nucleic acid of myocardial tissue was extracted using the TIANamp Virus DNA / RNA Kit (TIANGEN) according to the instructions. Specific primers were designed based on the overlapping regions of contigs and known parvovirus reference sequences on NCBI:

[0179] PVB19-F 5'-AATACACTGTGGTTTTATGGGCCG-3', SEQ ID NO.33;

[0180] PVB19-R 5'-CTAAAATGGCTTTTGCAGCTTCTAC-3', SEQ ID NO. 34.

[0181] Amplification was performed using TSINGKE Master Mix (TSINGKE), with the following program: 95°C for 2 min, (94°C for 30 s, 55°C for 30 s, 72°C for 30 s) × 40 cycles, 72°C for 5 min, 4°C. PCR products were detected by electrophoresis using 1.5% agarose gel (TAE dissolution). The expected product size was 178 bp, and the gel was excised and sequenced by Sanger sequencing for sequence alignment.

[0182] 6. Results

[0183] First, the left ventricular anterior wall tissues of all patients with inflammatory cardiomyopathy were mixed together for viral metagenomic sequencing. After sequence analysis, PVB19 was the only virus found in the failing heart, and no subjects were detected with the genomes of hepatitis C virus, hepatitis E virus, bocavirus, paramyxovirus, astrovirus, and orthomyxovirus ( Figure 1-3 ).

[0184] Subsequent PCR analysis of each patient's myocardial tissue for PVB19 revealed that 22 of the 40 subjects (55%) with inflammatory cardiomyopathy were found to be PVB19 positive ( Figure 4 ), Sanger sequencing of PCR-positive products showed that 100% of the products tested were true positives.

[0185] In summary, the specific process of the present invention is as follows Figure 5 As shown, the present invention uses the Pan-PCR strategy to conduct a comprehensive detection of the eight known types of RNA viruses, ensuring that all known RNA viruses are covered; by designing capture probes to detect whether DNA virus integration exists; in addition, the samples are subjected to viral metagenomic sequencing, and the sequencing results of different viral infections are analyzed, thereby realizing step-by-step detection of cardiac viral infection and improving the accuracy and efficiency of detection.

[0186] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. A device for detecting cardiac viral infection, It is characterized in that The device comprises: RNA virus detection module, which uses Pan-PCR strategy to amplify and detect eight known types of RNA viruses, including coronavirus, filovirus, bocavirus, retrovirus, influenza virus, hepatitis E virus, Ebola virus 71 and paramyxovirus; A DNA virus detection module uses a capture probe to detect DNA viruses. The capture probe is designed based on the viruses and sequences detected by capture sequencing. The DNA viruses include human immunodeficiency virus-1, human T-lymphotropic virus-1, hepatitis B virus-a, herpes virus-6A, smallpox-Patrick virus, adeno-associated virus-2, human papillomavirus-16, Marik's disease virus, adenovirus, Merkel cell polyomavirus, lymphocytic choriovirus, bornavirus 1, hepatitis C virus, coxsackievirus B3, influenza A virus and cytomegalovirus; The metagenomic sequencing module performs viral metagenomic sequencing on samples whose results are negative for both the RNA virus detection module and the DNA virus detection module.

2. The device for detecting cardiac viral infection according to claim 1, It is characterized in that Primers for amplifying coronaviruses include CoV-FWD2 and CoV-RVS2; CoV-FWD2: SEQ ID NO.1; CoV-RVS2: SEQ ID NO.2; Preferably, primers for amplifying filoviruses include Filo-MOD-FWD and Filo-MOD-RVS; Filo-MOD-FWD: SEQ ID NO.3; Filo-MOD-RVS: SEQ ID NO.4; Preferably, primers for amplifying Bocavirus include panBOV-R and panBOV-F2; panBOV-R: SEQ ID NO.5; panBOV-F2: SEQ ID NO.6; Preferably, primers for amplifying retrovirus include Astr4380F and Astr4811R; Astr4380F: SEQ ID NO.7; Astr4811R: SEQ ID NO.

8.

3. The device for detecting cardiac viral infection according to claim 1 or 2, It is characterized in that Primers for amplifying influenza virus included FLUAPB1-R and FLUAPB1-NF; FLUAPB1-R: SEQ ID NO.9; FLUAPB1-NF: SEQ ID NO.10; Preferably, the primers for amplifying hepatitis E virus include Hepac-F3842 and Hepac-R4229; Hepac-F3842: SEQ ID NO.11; Hepac-R4229: SEQ ID NO.12; Preferably, primers for amplifying Ebovirus 71 include EV5UTRF and EV5UTRR; EV5UTRF: SEQ ID NO.13; EV5UTRR: SEQ ID NO.14; Preferably, primers for amplifying Paramyxovirus include PAR-R and PAR-F2; PAR-R: SEQ ID NO. 15; PAR-F2: SEQ ID NO.

16.

4. The device for detecting cardiac viral infection according to any one of claims 1 to 3, It is characterized in that The capture probes cover the entire genome of the DNA virus.

5. A primer and probe combination for detecting cardiac viral infection, It is characterized in that Includes primers for detecting RNA viruses and capture probes for detecting DNA viruses; The RNA viruses include coronaviruses, filoviruses, bocaviruses, retroviruses, influenza viruses, hepatitis E virus, Ebovirus 71, and paramyxoviruses; The DNA viruses include human immunodeficiency virus-1, human T-lymphotropic virus-1, hepatitis B virus-a, herpes virus-6A, variola-pamovirus, adeno-associated virus-2, human papillomavirus-16, Marek's disease virus, adenovirus, Merkel cell polyomavirus, lymphotropic choriovirus, bornavirus 1, hepatitis C virus, coxsackievirus B3, influenza A virus and cytomegalovirus.

6. The primer and probe combination for detecting cardioviral infection according to claim 5, It is characterized in that Primers for amplifying coronaviruses include CoV-FWD2 and CoV-RVS2; CoV-FWD2: SEQ ID NO.1; CoV-RVS2: SEQ ID NO.2; Preferably, primers for amplifying filoviruses include Filo-MOD-FWD and Filo-MOD-RVS; Filo-MOD-FWD: SEQ ID NO.3; Filo-MOD-RVS: SEQ ID NO.4; Preferably, primers for amplifying Bocavirus include panBOV-R and panBOV-F2; panBOV-R: SEQ ID NO.5; panBOV-F2: SEQ ID NO.6; Preferably, primers for amplifying retrovirus include Astr4380F and Astr4811R; Astr4380F: SEQ ID NO.7; Astr4811R: SEQ ID NO.8; Preferably, the primers for amplifying influenza virus include FLUAPB1-R and FLUAPB1-NF; FLUAPB1-R: SEQ ID NO.9; FLUAPB1-NF: SEQ ID NO.10; Preferably, the primers for amplifying hepatitis E virus include Hepac-F3842 and Hepac-R4229; Hepac-F3842: SEQ ID NO.11; Hepac-R4229: SEQ ID NO.12; Preferably, primers for amplifying Ebovirus 71 include EV5UTRF and EV5UTRR; EV5UTRF: SEQ ID NO.13; EV5UTRR: SEQ ID NO.14; Preferably, primers for amplifying Paramyxovirus include PAR-R and PAR-F2; PAR-R: SEQ ID NO. 15; PAR-F2: SEQ ID NO.

16.

7. The primer and probe combination for detecting cardiovirus infection according to claim 5 or 6, It is characterized in that The capture probes cover the entire genome of the DNA virus.

8. A kit for detecting cardiac viral infection, It is characterized in that The kit comprises the primer and probe combination for detecting cardiovirus infection according to any one of claims 5 to 7.

9. The kit for detecting cardiac viral infection according to claim 8, It is characterized in that The kit also includes any one of a nucleic acid extraction reagent, an mRNA reverse transcription reagent or a DNA amplification reagent, or a combination of at least two of them.

10. Use of the device for detecting cardiac virus infection according to any one of claims 1 to 4, the primer and probe combination for detecting cardiac virus infection according to any one of claims 5 to 7, or the kit for detecting cardiac virus infection according to claim 8 in the preparation of a product for detecting myocarditis.

Images