Application of compound in preparation of medicine for inhibiting expression of staphylococcus aureus SpA

Abstract

The invention discloses an application of a compound in preparation of a medicine for inhibiting expression of staphylococcus aureus SpA. The compound is badoxolone or a derivative thereof. The badoxolone and the derivative thereof can obviously inhibit gene expression and protein generation of a staphylococcus aureus key virulence factor SpA under nanomolar concentration, and have a wide inhibiting effect on the staphylococcus aureus key virulence factor SpA.

Description

Technical Field

[0001] The invention relates to the technical field of microbiology and medicinal chemistry, and in particular to application of a compound in preparing a drug for inhibiting the expression of Staphylococcus aureus SpA. Background Art

[0002] Staphylococcus aureus ( Staphylococcus aureus , S. aureus ) usually causes skin or soft tissue infections. However, once the bacteria enter the bloodstream, patients may face serious and life-threatening illnesses, including pneumonia, osteomyelitis, bacteremia, endocarditis, and toxic shock syndrome. Due to its high degree of multidrug resistance and as a major cause of healthcare-associated infections, the bacteria has become one of the most common causes of morbidity and mortality caused by infectious pathogens worldwide. S. aureus , MRSA) has become the most common antibiotic-resistant pathogen in hospitals, posing a major threat to public health. Currently, vancomycin and linezolid are used as the last line of antibiotics against MRSA infections, but the emergence of resistant strains has gradually weakened the effectiveness of these treatments. Existing antibiotics work through bacteriostatic or bactericidal mechanisms, and this selective pressure may lead to the emergence of drug resistance. Therefore, there is an urgent need to develop new alternative strategies with different mechanisms of action to deal with S. aureus Infection challenges.

[0003] Since the expression and regulation of virulence factors are crucial for the establishment and maintenance of bacterial infection, scientists have proposed new therapeutic strategies targeting bacterial virulence. S. aureus Staphylococcal protein A (SpA) plays an important role in the pathogenic process. SpA is a highly conserved cell wall protein. S. aureus strains, and as a superantigen helps S. aureus Successfully evades the host's innate and adaptive immune responses. SpA can bind to the Fcγ region of human and animal immunoglobulins (IgG), preventing specific antibodies from binding to the Fc fragment, thereby weakening Fc receptor-mediated phagocytosis, recognition, and killing. S. aureus SpA can also bind to immunoglobulin M (IgM) and immunoglobulin D (IgD) on the surface of B cells, non-specifically activate these cells, induce the production of a large number of inflammatory factors, and lead to an overreaction of the immune system. S. aureus One of the important factors in maintaining survival and causing the infection to worsen during the infection process.

[0004] At present, the research on SpA is mainly focused on the development stage of vaccines and neutralizing antibodies, which have shown certain protective effects in animal models, but their safety is still an issue that cannot be ignored and needs further evaluation and verification. Therefore, the development of small molecule drugs that can inhibit the expression of SpA may become a potential alternative treatment strategy.

[0005] Bardoxolone (CDDO) and Bardoxolone Methyl (CDDO-Me) are semisynthetic triterpenoids derived from oleanolic acid. They regulate the antioxidant and anti-inflammatory responses in the body by activating Nrf2 and inhibiting the NF-κB signaling pathway, thereby protecting cells from oxidative stress and inflammatory damage. Currently, CDDO-Me has been developed as an oral antioxidant and inflammatory regulator. Therefore, Nrf2 activators Bardoxolone and Bardoxolone Methyl can exert antiviral effects through multiple mechanisms and have good clinical application prospects. It is worth noting that there have been no reports on CDDO or CDDO-Me as SpA expression inhibitors at home and abroad so far, and no studies have reported drug monomer compounds that can significantly inhibit SpA expression at nanomolar concentrations. Summary of the invention

[0006] The present invention provides an application of bardoxolone and its derivatives in preparing a drug for inhibiting the expression of SpA of Staphylococcus aureus. Bardoxolone and its derivatives can significantly inhibit the expression of SpA, a key virulence factor of Staphylococcus aureus.

[0007] The technical solution of the present invention is as follows: The invention discloses an application of a compound in preparing a drug for inhibiting the expression of Staphylococcus aureus SpA. The compound is bardoxolone or a derivative thereof.

[0008] Furthermore, the compound is bardoxolone or methyl bardoxolone.

[0009] Bardoxolone (CDDO), whose molecular formula is C 31 H 41 NO4, whose CAS number is 218600-44-3, and whose structure is shown in formula (I); Bardoxolone methyl (CDDO-Me), its molecular formula is: 32 H 43 NO4, whose CAS number is 218600-53-4, and whose structure is shown in formula (II); .

[0010] Bardoxolone or methyl bardoxolone can significantly inhibit the gene expression and protein production of SpA, a key virulence factor of Staphylococcus aureus, at nanomolar concentrations.

[0011] Bardoxolone or methyl bardoxolone has a broad inhibitory effect on SpA of Staphylococcus aureus.

[0012] Preferably, the Staphylococcus aureus is USA300 LAC strain, Renji-ST5 strain, USA400 MW2 strain or SA6850 strain.

[0013] The present invention also provides an inhibitor of Staphylococcus aureus SpA, which uses bardoxolone or its derivatives as an effective ingredient.

[0014] The present invention also provides the use of the inhibitor of Staphylococcus aureus SpA in the preparation of a drug for inhibiting the expression of Staphylococcus aureus SpA.

[0015] The present invention also provides a pharmaceutical composition, comprising bardoxolone or its derivatives, and pharmaceutical excipients.

[0016] The present invention also provides application of the pharmaceutical composition in preparing a drug for inhibiting the expression of Staphylococcus aureus SpA.

[0017] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a new pharmacological use of bardoxolone or its derivatives as an inhibitor of the expression of SpA, a key virulence factor of Staphylococcus aureus. The advantages of the present invention are mainly: (1) Bardoxolone and its derivative, methyl bardoxolone, are the first drug monomer compounds that can significantly inhibit the gene expression and protein production of the key virulence factor SpA of Staphylococcus aureus at nanomolar concentrations; (2) Bardoxolone and its derivative methyl bardoxolone have a broad inhibitory effect on SpA of Staphylococcus aureus. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 For Bardosolon to USA300 LAC spa Results of inhibition assays at the transcriptional level.

[0019] Figure 2 The results of the inhibition of SpA protein expression level in USA300 LAC by bardoxolone are shown in Figure 2; (a) is the result of protein immunoblotting, and (b) is the statistical result of grayscale analysis of Figure 2.

[0020] Figure 3The results of the inhibition assay of SpA and human IgG on the surface of USA300 LAC by bardoxolone.

[0021] Figure 4 Effect of bardoxolone on different strains of Staphylococcus aureus spa Results of inhibition assays at the gene transcription level.

[0022] Figure 5 Bardoxolone methyl for USA300 LAC spa Results of inhibition assays at the transcriptional level. DETAILED DESCRIPTION

[0023] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0024] Unless otherwise specified, the experimental methods used in the embodiments of the present invention are all conventional methods; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified; the equipment used is all conventional experimental equipment unless otherwise specified.

[0025] Bardoxolone and methyl bardoxolone were purchased commercially, and their CAS numbers and purities are as follows: bardoxolone, CAS number: 218600-44-3, purity: 98%; methyl bardoxolone, CAS number: 218600-53-4, purity: 98%.

[0026] The structure of bardoxolone is shown in formula (I), and the structure of methyl bardoxolone is shown in formula (II): . Example

[0027] (1) Cultivation of Staphylococcus aureus strains The Staphylococcus aureus strains USA300 LAC and USA400 MW2 used in this experiment were laboratory-preserved strains, and Ranji ST5 and SA6850 were donated by Li Min's research group at Renji Hospital affiliated to Shanghai Jiao Tong University School of Medicine. The culture medium used was tryptic soy agar (TSA) or tryptic soy broth (TSB), and the culture conditions used were 37°C and 250rpm shaking culture.

[0028] (2) Effect of bardoxolone on USA300 LAC strain spa Gene expression level determination The overnight culture of Staphylococcus aureus was diluted into 10 mL TSB medium at a ratio of 1:100 and incubated at 37°C and 250 rpm with shaking. Total RNA was extracted using the Qiagen RNeasy kit and reverse transcribed into cDNA using a high-capacity cDNA reverse transcription kit with RNase inhibitor (Vazyme, R312-01). Subsequently, cDNA was used as a template for real-time quantitative PCR (qPCR) and qPCR reactions were performed with the corresponding primers (see Table 1) and Hieff® qPCR SYBR Green Master Mix (YEASEN, H7901050) to determine the effect of bardoxolone on the USA300 LAC. spa The results are expressed as the fold change of the untreated USA300 LAC strain, and the expression level of the untreated USA300 LAC strain was set to 1. The experiment was performed with three biological replicates, and the results are expressed as the mean ± standard deviation (SD).

[0029] Table 1 Primer information for quantitative reverse transcription-PCR (qRT-PCR) analysis Primer name Primer sequence (5'-3') RT-F GAAAAAGAAAAACATTTATTCAATTCG RT-R AGGCATATTTAAGACTTGATAAAAAGC Results Analysis The measured data are as follows Figure 1 As shown, Bardosolon spa Gene expression is strongly inhibited in a concentration-dependent manner spa The transcription of the gene, at a concentration of 0.2 μg / mL (407 nM), spa The expression of the gene was reduced by more than 90%.

[0030] (3) Determination of the inhibitory effect of bardoxolone on the expression level of SpA protein in USA300 LAC Western blot was used to analyze the effect of bardoxolone on the expression level of SpA protein. USA300 LAC strain was cultured in 10 mL TSB medium at 37°C and 250 rpm for the specified time, and then adjusted to the OD of all samples. 600 The bacteria were collected by centrifugation at 10,000 g, washed once with 1× TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0), and resuspended to an OD of 600to 10. Subsequently, lysostaphin (50µg / mL) was added to 100 μL of bacterial resuspension and incubated at 37°C with shaking at 250rpm for 1.5 hours. After the sample was clarified, 5× SDS loading buffer [250 mMTris-HCl (pH 6.8), 10% SDS, 0.5% bromophenol blue, 50% glycerol, 100 mM DTT] was added and heated at 100°C for 20 minutes. After centrifugation, it was subjected to 12% SDS-PAGE gel electrophoresis (150 V, 90 minutes) and transferred to a PVDF membrane at 320 mA current (90 minutes). After transfer, it was blocked in 5% (wt / vol) skim milk powder for 120 minutes. After discarding the blocking solution, the primary antibody was added and incubated overnight at 4°C. After incubation, the membrane was washed four times with TBST buffer [10 mM Tris-HCl (pH7.5), 150 mM NaCl, 0.05% Tween 20] at room temperature for 20 minutes each time. After washing, the membrane was incubated with horseradish peroxidase-labeled secondary antibody at room temperature for 2 hours, and the above washing steps were repeated again, and imaging was performed using the Tanon-5200 multi imaging system. The experiment was repeated three times, and the results are expressed as mean ± standard deviation (SD).

[0031] Results Analysis The results of the assays were consistent with the gene expression results, e.g. Figure 2 As shown, bardoxolone also has a strong inhibitory effect on SpA protein expression, and can inhibit SpA protein expression in a concentration-dependent manner.

[0032] (4) Determination of the inhibitory effect of bardoxolone on the binding ability of SpA and human IgG on the surface of USA300 LAC SpA is a multifunctional surface protein as it is able to bind to the Fcγ portion of IgG and interfere with the opsonophagocytic capacity of bacteria and the development of adaptive B cell responses. To further investigate the effect of bardoxolone on SpA production, we stained the USA300 LAC strain with FITC-labeled human IgG and observed the samples by laser scanning confocal microscopy.

[0033] Results Analysis Under normal circumstances, the cells showed significant green fluorescence, indicating that the Staphylococcus aureus USA300 LAC strain strongly bound to FITC-labeled IgG. spa Gene Δ spa The strain cannot bind to the fluorescent substance to stimulate green fluorescence ( Figure 3). The addition of bardoxolone (0.2 μg / mL) can significantly inhibit the binding of SpA to human IgG, thereby weakening the production of green fluorescence ( Figure 3 ).

[0034] (5) Effect of bardoxolone on different types of Staphylococcus aureus strains spa Determination of inhibitory effects on gene expression levels To further investigate the broad spectrum of bardoxolone's inhibitory activity against SpA expression, we evaluated the inhibitory activity of bardoxolone against SpA expression in four strains of S. aureus. spa Transcriptional characteristics of genes. These strains include USA300 LAC, Renji-ST5, USA400 MW2, and SA6850. The experiment was performed with three biological replicates, and the results are expressed as mean ± standard deviation (SD).

[0035] Results Analysis The measured data are as follows Figure 4 As shown, bardoxolone (0.2 μg / mL) had an spa Gene expression levels were significantly inhibited, suggesting that bardoxolone has a broad-spectrum inhibitory effect on SpA expression.

[0036] (6) Effect of methyl bardoxolone on USA300 LAC strain spa Gene expression level determination The effects of bardoxolone methyl on spa Inhibition of gene expression levels.

[0037] Results Analysis The measured data are as follows Figure 5 As shown, bardoxolone methyl has an spa The gene expression was significantly inhibited, suggesting that bardoxolone methyl is an inhibitor of SpA expression.

[0038] The embodiments described above provide a detailed description of the technical solutions and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, supplements and equivalent substitutions made within the scope of the principles of the present invention should be included in the protection scope of the present invention.

Claims

1. Use of a compound in the preparation of a drug for inhibiting the expression of Staphylococcus aureus SpA, characterized in that: The compound is bardoxolone or its derivatives.

2. The use according to claim 1, characterized in that: The compound is bardoxolone or methyl bardoxolone.

3. The use according to claim 1, characterized in that: The molecular formula of bardoxolone is C 31 H 41 NO4, whose CAS number is 218600-44-3, and whose structure is shown in formula (I); The molecular formula of bardoxolone methyl is: 32 H 43 NO4, whose CAS number is 218600-53-4, and whose structure is shown in formula (II); 。 4. The use according to claim 1, characterized in that: Bardoxolone or methyl bardoxolone can significantly inhibit the gene expression and protein production of SpA, a key virulence factor of Staphylococcus aureus, at nanomolar concentrations.

5. The use according to claim 1, characterized in that: The Staphylococcus aureus is USA300 LAC strain, Renji-ST5 strain, USA400 MW2 strain or SA6850 strain.

6. An inhibitor of Staphylococcus aureus SpA, characterized in that Bardoxolone or its derivatives are used as active ingredients.

7. Use of the inhibitor of Staphylococcus aureus SpA according to claim 6 in the preparation of a medicament for inhibiting the expression of Staphylococcus aureus SpA.

Images